Research Article |
Corresponding author: Edgar Lehr ( elehr@iwu.edu ) Academic editor: Anthony Herrel
© 2017 Edgar Lehr, Rudolf von May, Jiri Moravec, Juan Carlos Cusi.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Lehr E, von May R, Moravec J, Cusi JC (2017) A new species of Phrynopus (Amphibia, Anura, Craugastoridae) from upper montane forests and high Andean grasslands of the Pui Pui Protected Forest in central Peru. ZooKeys 713: 131-157. https://doi.org/10.3897/zookeys.713.20776
|
We describe a new species of Phrynopus from the upper montane forests and high Andean grasslands (puna) of the Pui Pui Protected Forest and its close surroundings (Región Junín, central Peru) and compare it morphologically and genetically with other species of Phrynopus.
Phrynopus inti sp. n. is known from four localities outside and two localities inside the Pui Pui Protected Forest between 3350 and 3890 m a.s.l. Studied specimens of the new species are characterized by a snout-vent length of 27.2–35.2 mm in males (n = 6), and 40.4 mm in a single female, by having the skin on dorsum and flanks smooth with scattered tubercles, venter smooth, by lacking a tympanum, and males without vocal slits and nuptial pads. In life, the dorsum is pale grayish brown with or without dark brown blotches, or dorsum blackish brown with small yellow flecks, throat, chest and venter are pale grayish brown with salmon mottling, groin is pale grayish brown with salmon colored flecks, and the iris is golden orange with fine dark brown reticulations. The new species is morphologically most similar to Phrynopus kauneorum and P. juninensis. For the latter we describe the coloration in life for a specimen obtained at the type locality. A molecular phylogenetic analysis based on mitochondrial and nuclear DNA sequences inferred that the new species is most closely related to Phrynopus kauneorum, P. miroslawae, P. tautzorum, and an undescribed species distributed at high elevation in Región Pasco, central Peru.
Describimos una nueva especie de Phrynopus de los bosques montanos altos y los pajonales altoandinos (Puna) del Bosque de Protección Pui Pui y sus áreas cercanas (Región de Junín, Perú central) y la comparamos morfológica y genéticamente con otras especies de Phrynopus. Phrynopus inti sp. n. es conocido de cuatro localidades fuera y dos localidades dentro del Bosque de Protección Pui Pui entre 3350 y 3890 m s.n.m. La nueva especie se caracteriza por tener una longitud hocico-cloaca de 27.2–35.2 mm en machos (n = 6) y 40.4 mm en una hembra, por tener la piel dorsal y los flancos lisos con tubérculos dispersos, el vientre liso, por carecer de un tímpano, y los machos carecer de hendiduras vocales y almohadillas nupciales. En vida, el dorso es marrón grisáceo pálido con o sin manchas marrón oscuro o el dorso es marrón oscuro con pequeñas manchas amarillas; la garganta, pecho y vientre son marrón grisáceo pálido con motas de color salmón, la ingle es marrón grisácea con manchas de color salmón y el iris es dorado naranja con finas reticulaciones marrón oscuro. La nueva especie es morfológicamente muy similar a Phrynopus kauneorum y P. juninensis. Para este último, describimos la coloración en vida de un espécimen obtenido en la localidad tipo. Un análisis filogenético molecular basado en secuencias de ADN mitocondrial y nuclear infirió que la nueva especie está más estrechamente relacionada con Phrynopus kauneorum, P. miroslawae, P. tautzorum, y una especie no descrita distribuida en zonas altoandinas de la Región Pasco, Perú central.
Andes, montane forest, puna, frogs, DNA barcoding, molecular phylogeny, Phrynopus inti , new species
Andes, bosque montano, puna, ranas, códigos de barras de ADN, filogenia molecular, Phrynopus inti , especie nueva
The Pui Pui Protected Forest (Bosque de Protección Pui Pui, hereafter PPPF; Figs
Fieldwork. The puna of the PPPF was reached by walking 1.5 days along a trail from Toldopama (11°30'15.4"S, 74°55'32.7"W, 3670 m a.s.l., two hours by car from Satipo) to Tarhuish (11°23'23.2"S; 74°57'02.5"W, 3783 m a.s.l.; Fig.
Pui Pui Protected Forest indicated in red outline with collecting sites (1–6) of Phrynopus inti sp. n., star indicating type locality, and the estimated distributional area of 101.3 km2 in blue. 1 = Toldopampa valley, 3670 m a.s.l., 2 = Satipo-Toldopampa Road at km 134, 3350 m a.s.l., 3 = Quebrada Tasta, 3609 m a.s.l., 4 = Polylepis forest patch near trail from Tasta to Tarhuish, 3886 m a.s.l., 5 = Antuyo, 3700 m a.s.l., 6 = close to Laguna Sinchon, 3890 m a.s.l. Map by J.C. Cusi.
Morphological characters. The format for the description follows
Maps. Maps were made with ArcGIS 10.0 (
Molecular phylogenetic analysis. Our analysis included DNA sequence data from Phrynopus species that were available in GenBank (as of 1 August 2017; Table
GenBank accession numbers for the taxa and genes sampled in this study. Bold font indicates new sequences generated for this study. Taxonomy follows
Taxon | 16S | 12S | COI | RAG1 | Tyr | Voucher_Nbr |
---|---|---|---|---|---|---|
Hypodactylus brunneus | EF493357 | EF493357 | na | EF493422 | EF493484 | KU178258 |
Hypodactylus dolops | EF493394 | EF493394 | na | EF493414 | EF493483 | na |
Ischnocnema guentheri | EF493533 | EF493533 | na | EF493407 | EF493510 | na |
Lynchius flavomaculatus | EU186667 | EU186667 | na | EU186745 | EU186766 | KU218210 |
Lynchius nebulanastes | EU186704 | EU186704 | na | na | na | KU181408 |
Lynchius oblitus | AM039639 | AM039707 | na | na | na | MTD45954 |
Lynchius oblitus | AM039640 | AM039708 | na | na | na | MHSNM19914 |
Lynchius parkeri | EU186705 | EU186705 | na | na | na | KU181307 |
Lynchius simmonsi | JF810004 | JF809940 | na | JF809915 | JF809894 | QZ41639 |
Oreobates amarakaeri | JF809996 | JF809934 | na | JF809913 | JF809891 | MHNC6975 |
Oreobates ayacucho | JF809970 | JF809933 | na | JF809912 | JF809890 | MNCN_IDlR5024 |
Oreobates cruralis | EU186666 | EU186666 | na | EU186743 | EU186764 | KU215462 |
Oreobates gemcare | JF809960 | JF809930 | na | JF809909 | na | MHNC6687 |
Oreobates granulosus | EU368897 | JF809929 | na | JF809908 | JF809887 | MHNC3396 |
Phrynopus auriculatus | EF493708 | EF493708 | na | na | na | KU291634 |
Phrynopus auriculatus | MF186348 | MF186290 | MF186466 | na | MF186582 | MUBI 6471 |
Phrynopus barthlenae | AM039653 | AM039721 | na | na | na | SMF81720 |
Phrynopus barthlenae | MF186350 | MF186292 | MF186464 | na | na | MHNSM20609 |
Phrynopus bracki | EF493709 | EF493709 | na | EF493421 | na | USNM286919 |
Phrynopus bufoides | AM039645 | AM039713 | na | na | na | MHNSM19860 |
Phrynopus heimorum | AM039635 | AM039703 | MF186462 | MF186545 | MF186580 | MTD45621 |
Phrynopus heimorum | AM039636 | AM039704 | na | na | na | MTD45622 |
Phrynopus horstpauli | AM039647 | AM039715 | na | na | na | MTD44334 |
Phrynopus horstpauli | AM039651 | AM039719 | na | na | na | MTD44333 |
Phrynopus horstpauli | MF186364 | MF186303 | na | na | MF186584 | MTD44335 |
Phrynopus inti sp. n. | MF651901 | na | na | MF651916 | na | MUSM31203 |
Phrynopus inti sp. n. | MF651902 | MF651909 | na | MF651917 | na | MUSM31968 |
Phrynopus inti sp. n. | MF651903 | MF651910 | na | na | na | MUSM31976 |
Phrynopus inti sp. n. | MF651904 | MF651911 | na | na | na | MUSM31984 |
Phrynopus inti sp. n. | MF651905 | MF651912 | na | na | na | NMP6V75584 |
Phrynopus inti sp. n. | MF651906 | MF651913 | na | MF651918 | MF651921 | UMMZ_245218 |
Phrynopus inti sp. n. | MF651907 | MF651914 | na | MF651919 | na | UMMZ_245219 |
Phrynopus juninensis | MF651908 | MF651915 | na | MF651920 | na | MUSM33258 |
Phrynopus kauneorum | AM039650 | AM039718 | na | na | na | MTD44332 |
Phrynopus kauneorum | AM039655 | AM039723 | na | na | na | MHNSM20595 |
Phrynopus miroslawae | MF186393 | MF186312 | MF186463 | MF186542 | MF186585 | MUBI 6469 |
Phrynopus nicoleae | MF186394 | MF186313 | MF186468 | MF186546 | MF186577 | MUBI 6441 |
Phrynopus pesantesi | AM039656 | AM039724 | na | na | na | MTD45072 |
Phrynopus sp. | AM039657 | AM039725 | na | na | na | MTD45075 |
Phrynopus sp. | AM039660 | AM039728 | na | na | na | MTD44759 |
Phrynopus tautzorum | AM039652 | AM039720 | na | na | na | MHNSM20613 |
Phrynopus tribulosus | EU186725 | EU186707 | na | na | na | KU291630 |
Phrynopus tribulosus | MF186423 | MF186329 | MF186469 | na | MF186578 | MUBI 6451 |
Phrynopus tribulosus | MF186424 | MF186330 | MF186467 | MF186547 | MF186579 | MUBI 7166 |
Extraction, amplification, and sequencing of DNA followed protocols previously used for Neotropical terrestrial breeding frogs (
We used Geneious R6, version 6.1.8 (
We employed a Bayesian approach using MrBayes, version 3.2.0 (
Molecular phylogenetic analysis. Placement of the new species in the genus Phrynopus was strongly supported by this analysis. We recovered a well-supported tree (Figure
Uncorrected p-distances of the 16S mitochondrial rRNA gene for 30 specimens of Phrynopus, including the new species.
1 | 2 | 3 | 4 | 5 | 6 | 7 | ||
1 | Phrynopus auriculatus KU291634 | 0.000 | ||||||
2 | Phrynopus auriculatus MUBI 6471 | 0.002 | 0.000 | |||||
3 | Phrynopus barthlenae MHNSM20609 | 0.138 | 0.135 | 0.000 | ||||
4 | Phrynopus barthlenae SMF81720 | 0.118 | 0.115 | 0.000 | 0.000 | |||
5 | Phrynopus horstpauli MTD44333 | 0.114 | 0.112 | 0.040 | 0.039 | 0.000 | ||
6 | Phrynopus horstpauli MTD44334 | 0.114 | 0.112 | 0.040 | 0.039 | 0.000 | 0.000 | |
7 | Phrynopus horstpauli MTD44335 | 0.115 | 0.112 | 0.040 | 0.039 | 0.000 | 0.000 | 0.000 |
8 | Phrynopus pesantesi MTD45072 | 0.105 | 0.103 | 0.040 | 0.037 | 0.035 | 0.035 | 0.035 |
9 | Phrynopus bufoides MHNSM19860 | 0.121 | 0.119 | 0.073 | 0.064 | 0.060 | 0.060 | 0.060 |
10 | Phrynopus tautzorum MHNSM20613 | 0.119 | 0.116 | 0.077 | 0.070 | 0.066 | 0.066 | 0.066 |
11 | Phrynopus miroslawae MUBI 6469 | 0.132 | 0.130 | 0.084 | 0.072 | 0.074 | 0.074 | 0.074 |
12 | Phrynopus inti MUSM31203 | 0.125 | 0.123 | 0.080 | 0.070 | 0.072 | 0.072 | 0.073 |
13 |
Phrynopus inti |
0.125 | 0.123 | 0.080 | 0.070 | 0.072 | 0.072 | 0.073 |
14 |
Phrynopus inti |
0.125 | 0.123 | 0.080 | 0.070 | 0.072 | 0.072 | 0.073 |
15 | Phrynopus inti MUSM31968 | 0.125 | 0.123 | 0.080 | 0.070 | 0.072 | 0.072 | 0.073 |
16 | Phrynopus inti NMP6V75584 | 0.128 | 0.126 | 0.082 | 0.072 | 0.075 | 0.075 | 0.075 |
17 | Phrynopus inti MUSM31976 | 0.123 | 0.121 | 0.070 | 0.064 | 0.068 | 0.068 | 0.069 |
18 | Phrynopus inti MUSM31984 | 0.131 | 0.128 | 0.070 | 0.064 | 0.066 | 0.066 | 0.067 |
19 | Phrynopus sp. MTD45075 | 0.114 | 0.112 | 0.069 | 0.062 | 0.056 | 0.056 | 0.056 |
20 | Phrynopus sp. MTD44759 | 0.119 | 0.117 | 0.064 | 0.059 | 0.053 | 0.053 | 0.053 |
21 | Phrynopus kauneorum MHNSM20595 | 0.128 | 0.125 | 0.088 | 0.079 | 0.081 | 0.081 | 0.082 |
22 | Phrynopus kauneorum MTD44332 | 0.128 | 0.125 | 0.088 | 0.079 | 0.081 | 0.081 | 0.082 |
23 | Phrynopus bracki USNM286919 | 0.110 | 0.108 | 0.082 | 0.074 | 0.074 | 0.074 | 0.075 |
24 | Phrynopus juninensis MUSM33258 | 0.141 | 0.138 | 0.126 | 0.109 | 0.114 | 0.114 | 0.115 |
25 | Phrynopus heimorum MTD45621 | 0.146 | 0.143 | 0.137 | 0.124 | 0.124 | 0.124 | 0.125 |
26 | Phrynopus heimorum MTD45622 | 0.146 | 0.143 | 0.137 | 0.124 | 0.124 | 0.124 | 0.125 |
27 | Phrynopus nicoleae MUBI 6441 | 0.137 | 0.135 | 0.124 | 0.108 | 0.111 | 0.111 | 0.112 |
28 | Phrynopus tribulosus KU291630 | 0.137 | 0.134 | 0.124 | 0.108 | 0.111 | 0.111 | 0.112 |
29 | Phrynopus tribulosus MUBI 6451 | 0.136 | 0.134 | 0.124 | 0.110 | 0.110 | 0.110 | 0.111 |
30 | Phrynopus tribulosus MUBI 7166 | 0.136 | 0.134 | 0.124 | 0.110 | 0.110 | 0.110 | 0.111 |
8 | 9 | 10 | 11 | 12 | 13 | 14 | ||
1 | Phrynopus auriculatus KU291634 | |||||||
2 | Phrynopus auriculatus MUBI 6471 | |||||||
3 | Phrynopus barthlenae MHNSM20609 | |||||||
4 | Phrynopus barthlenae SMF81720 | |||||||
5 | Phrynopus horstpauli MTD44333 | |||||||
6 | Phrynopus horstpauli MTD44334 | |||||||
7 | Phrynopus horstpauli MTD44335 | |||||||
8 | Phrynopus pesantesi MTD45072 | 0.000 | ||||||
9 | Phrynopus bufoides MHNSM19860 | 0.051 | 0.000 | |||||
10 | Phrynopus tautzorum MHNSM20613 | 0.058 | 0.064 | 0.000 | ||||
11 | Phrynopus miroslawae MUBI 6469 | 0.068 | 0.082 | 0.049 | 0.000 | |||
12 | Phrynopus inti MUSM31203 | 0.054 | 0.063 | 0.066 | 0.068 | 0.000 | ||
13 |
Phrynopus inti |
0.054 | 0.063 | 0.066 | 0.068 | 0.000 | 0.000 | |
14 |
Phrynopus inti |
0.054 | 0.063 | 0.066 | 0.068 | 0.000 | 0.000 | 0.000 |
15 | Phrynopus inti MUSM31968 | 0.054 | 0.063 | 0.066 | 0.068 | 0.000 | 0.000 | 0.000 |
16 | Phrynopus inti NMP6V75584 | 0.054 | 0.063 | 0.070 | 0.072 | 0.000 | 0.000 | 0.000 |
17 | Phrynopus inti MUSM31976 | 0.048 | 0.054 | 0.062 | 0.064 | 0.017 | 0.017 | 0.017 |
18 | Phrynopus inti MUSM31984 | 0.049 | 0.054 | 0.067 | 0.073 | 0.023 | 0.023 | 0.023 |
19 | Phrynopus sp. MTD45075 | 0.039 | 0.051 | 0.049 | 0.062 | 0.023 | 0.023 | 0.023 |
20 | Phrynopus sp. MTD44759 | 0.042 | 0.055 | 0.053 | 0.065 | 0.028 | 0.028 | 0.028 |
21 | Phrynopus kauneorum MHNSM20595 | 0.052 | 0.070 | 0.069 | 0.077 | 0.045 | 0.045 | 0.045 |
22 | Phrynopus kauneorum MTD44332 | 0.052 | 0.070 | 0.069 | 0.077 | 0.045 | 0.045 | 0.045 |
23 | Phrynopus bracki USNM286919 | 0.068 | 0.069 | 0.081 | 0.075 | 0.081 | 0.081 | 0.081 |
24 | Phrynopus juninensis MUSM33258 | 0.109 | 0.114 | 0.117 | 0.114 | 0.118 | 0.118 | 0.118 |
25 | Phrynopus heimorum MTD45621 | 0.134 | 0.147 | 0.136 | 0.142 | 0.133 | 0.133 | 0.133 |
26 | Phrynopus heimorum MTD45622 | 0.134 | 0.147 | 0.136 | 0.142 | 0.133 | 0.133 | 0.133 |
27 | Phrynopus nicoleae MUBI 6441 | 0.114 | 0.120 | 0.136 | 0.143 | 0.128 | 0.128 | 0.128 |
28 | Phrynopus tribulosus KU291630 | 0.114 | 0.120 | 0.136 | 0.143 | 0.128 | 0.128 | 0.128 |
29 | Phrynopus tribulosus MUBI 6451 | 0.113 | 0.120 | 0.136 | 0.140 | 0.129 | 0.129 | 0.129 |
30 | Phrynopus tribulosus MUBI 7166 | 0.113 | 0.120 | 0.136 | 0.140 | 0.129 | 0.129 | 0.129 |
15 | 16 | 17 | 18 | 19 | 20 | 21 | ||
1 | Phrynopus auriculatus KU291634 | |||||||
2 | Phrynopus auriculatus MUBI 6471 | |||||||
3 | Phrynopus barthlenae MHNSM20609 | |||||||
4 | Phrynopus barthlenae SMF81720 | |||||||
5 | Phrynopus horstpauli MTD44333 | |||||||
6 | Phrynopus horstpauli MTD44334 | |||||||
7 | Phrynopus horstpauli MTD44335 | |||||||
8 | Phrynopus pesantesi MTD45072 | |||||||
9 | Phrynopus bufoides MHNSM19860 | |||||||
10 | Phrynopus tautzorum MHNSM20613 | |||||||
11 | Phrynopus miroslawae MUBI 6469 | |||||||
12 | Phrynopus inti MUSM31203 | |||||||
13 |
Phrynopus inti |
|||||||
14 |
Phrynopus inti |
|||||||
15 | Phrynopus inti MUSM31968 | 0.000 | ||||||
16 | Phrynopus inti NMP6V75584 | 0.000 | 0.000 | |||||
17 | Phrynopus inti MUSM31976 | 0.017 | 0.018 | 0.000 | ||||
18 | Phrynopus inti MUSM31984 | 0.023 | 0.023 | 0.008 | 0.000 | |||
19 | Phrynopus sp. MTD45075 | 0.023 | 0.024 | 0.015 | 0.016 | 0.000 | ||
20 | Phrynopus sp. MTD44759 | 0.028 | 0.029 | 0.022 | 0.017 | 0.008 | 0.000 | |
21 | Phrynopus kauneorum MHNSM20595 | 0.045 | 0.048 | 0.037 | 0.040 | 0.043 | 0.049 | 0.000 |
22 | Phrynopus kauneorum MTD44332 | 0.045 | 0.048 | 0.037 | 0.040 | 0.043 | 0.049 | 0.000 |
23 | Phrynopus bracki USNM286919 | 0.081 | 0.084 | 0.079 | 0.083 | 0.073 | 0.077 | 0.086 |
24 | Phrynopus juninensis MUSM33258 | 0.118 | 0.119 | 0.113 | 0.116 | 0.115 | 0.116 | 0.113 |
25 | Phrynopus heimorum MTD45621 | 0.133 | 0.137 | 0.141 | 0.141 | 0.133 | 0.135 | 0.146 |
26 | Phrynopus heimorum MTD45622 | 0.133 | 0.137 | 0.141 | 0.141 | 0.133 | 0.135 | 0.146 |
27 | Phrynopus nicoleae MUBI 6441 | 0.128 | 0.128 | 0.130 | 0.125 | 0.123 | 0.119 | 0.133 |
28 | Phrynopus tribulosus KU291630 | 0.128 | 0.128 | 0.130 | 0.125 | 0.123 | 0.119 | 0.133 |
29 | Phrynopus tribulosus MUBI 6451 | 0.129 | 0.129 | 0.132 | 0.126 | 0.124 | 0.120 | 0.135 |
30 | Phrynopus tribulosus MUBI 7166 | 0.129 | 0.129 | 0.132 | 0.126 | 0.124 | 0.120 | 0.135 |
22 | 23 | 24 | 25 | 26 | 27 | 28 | ||
1 | Phrynopus auriculatus KU291634 | |||||||
2 | Phrynopus auriculatus MUBI 6471 | |||||||
3 | Phrynopus barthlenae MHNSM20609 | |||||||
4 | Phrynopus barthlenae SMF81720 | |||||||
5 | Phrynopus horstpauli MTD44333 | |||||||
6 | Phrynopus horstpauli MTD44334 | |||||||
7 | Phrynopus horstpauli MTD44335 | |||||||
8 | Phrynopus pesantesi MTD45072 | |||||||
9 | Phrynopus bufoides MHNSM19860 | |||||||
10 | Phrynopus tautzorum MHNSM20613 | |||||||
11 | Phrynopus miroslawae MUBI 6469 | |||||||
12 | Phrynopus inti MUSM31203 | |||||||
13 |
Phrynopus inti |
|||||||
14 |
Phrynopus inti |
|||||||
15 | Phrynopus inti MUSM31968 | |||||||
16 | Phrynopus inti NMP6V75584 | |||||||
17 | Phrynopus inti MUSM31976 | |||||||
18 | Phrynopus inti MUSM31984 | |||||||
19 | Phrynopus sp. MTD45075 | |||||||
20 | Phrynopus sp. MTD44759 | |||||||
21 | Phrynopus kauneorum MHNSM20595 | |||||||
22 | Phrynopus kauneorum MTD44332 | 0.000 | ||||||
23 | Phrynopus bracki USNM286919 | 0.086 | 0.000 | |||||
24 | Phrynopus juninensis MUSM33258 | 0.113 | 0.105 | 0.000 | ||||
25 | Phrynopus heimorum MTD45621 | 0.146 | 0.118 | 0.113 | 0.000 | |||
26 | Phrynopus heimorum MTD45622 | 0.146 | 0.118 | 0.113 | 0.000 | 0.000 | ||
27 | Phrynopus nicoleae MUBI 6441 | 0.133 | 0.111 | 0.121 | 0.119 | 0.119 | 0.000 | |
28 | Phrynopus tribulosus KU291630 | 0.133 | 0.111 | 0.121 | 0.119 | 0.119 | 0.000 | 0.000 |
29 | Phrynopus tribulosus MUBI 6451 | 0.135 | 0.110 | 0.123 | 0.121 | 0.121 | 0.002 | 0.002 |
30 | Phrynopus tribulosus MUBI 7166 | 0.135 | 0.110 | 0.123 | 0.121 | 0.121 | 0.002 | 0.002 |
29 | 30 | |||||||
1 | Phrynopus auriculatus KU291634 | |||||||
2 | Phrynopus auriculatus MUBI 6471 | |||||||
3 | Phrynopus barthlenae MHNSM20609 | |||||||
4 | Phrynopus barthlenae SMF81720 | |||||||
5 | Phrynopus horstpauli MTD44333 | |||||||
6 | Phrynopus horstpauli MTD44334 | |||||||
7 | Phrynopus horstpauli MTD44335 | |||||||
8 | Phrynopus pesantesi MTD45072 | |||||||
9 | Phrynopus bufoides MHNSM19860 | |||||||
10 | Phrynopus tautzorum MHNSM20613 | |||||||
11 | Phrynopus miroslawae MUBI 6469 | |||||||
12 | Phrynopus inti MUSM31203 | |||||||
13 |
Phrynopus inti |
|||||||
14 |
Phrynopus inti |
|||||||
15 | Phrynopus inti MUSM31968 | |||||||
16 | Phrynopus inti NMP6V75584 | |||||||
17 | Phrynopus inti MUSM31976 | |||||||
18 | Phrynopus inti MUSM31984 | |||||||
19 | Phrynopus sp. MTD45075 | |||||||
20 | Phrynopus sp. MTD44759 | |||||||
21 | Phrynopus kauneorum MHNSM20595 | |||||||
22 | Phrynopus kauneorum MTD44332 | |||||||
23 | Phrynopus bracki USNM286919 | |||||||
24 | Phrynopus juninensis MUSM33258 | |||||||
25 | Phrynopus heimorum MTD45621 | |||||||
26 | Phrynopus heimorum MTD45622 | |||||||
27 | Phrynopus nicoleae MUBI 6441 | |||||||
28 | Phrynopus tribulosus KU291630 | |||||||
29 | Phrynopus tribulosus MUBI 6451 | 0.000 | ||||||
30 | Phrynopus tribulosus MUBI 7166 | 0.000 | 0.000 |
Phrynopus sp. A in Lehr, von May, Moravec, & Cusi (2017)
English: Inti Andes Frog. Spanish: Rana Andina Inti.
(Figs
(Figs
MUSM 31184,
We assign this species to Phrynopus based on molecular evidence (Fig.
A species of Phrynopus having the following combination of characters: (1) Skin on dorsum and flanks shagreen with scattered, low tubercles, more dense on dorsum; skin on venter smooth; discoidal fold absent, thoracic fold present; prominent supratympanic fold; dorsolateral folds absent; (2) tympanic membrane and tympanic annulus absent; (3) snout rounded in dorsal and lateral views; (4) upper eyelid without enlarged tubercles; width of upper eyelid narrower than IOD; cranial crests absent; (5) dentigerous processes of vomers minute or absent; (6) vocal slits and nuptial pads absent; (7) Finger I shorter than Finger II; tips of digits bulbous, rounded; (8) fingers without lateral fringes; (9) ulnar and tarsal tubercles absent; (10) heel without tubercles; inner tarsal fold absent; (11) inner metatarsal tubercle rounded, about three times as large as ovoid outer metatarsal tubercle; supernumerary plantar tubercles absent; (12) toes without lateral fringes; basal webbing absent; Toe V slightly longer than Toe III; toe tips bulbous, rounded, about as large as those on fingers; (13) in life, dorsum pale grayish brown with or without dark brown blotches or blackish brown with small yellow flecks; throat, chest and venter pale grayish brown with salmon mottling, groin pale grayish brown with salmon colored flecks; iris golden orange with fine dark brown reticulations; (14) SVL 27.2–35.2 mm in males (n = 6), and 40.4 mm in single female.
Phrynopus inti sp. n. is readily distinguished from its 34 congeners in Peru (
Head as wide as body, wider than long, HW 110% of HL; HW 38% of SVL; HL 35% of SVL; snout short, rounded in dorsal and lateral views (Figs
Skin on dorsum shagreen with scattered, low tubercles, more dense on posterior half of body, dorsolateral folds absent (Fig.
Hind limbs long and slender, TL 39% of SVL; FL 43% of SVL; dorsal surface of hind limbs shagreen with few low tubercles; anterior surfaces of thighs shagreen, posterior surfaces of thighs weakly areolate; heel without a conical tubercle; outer surface of tarsus without tubercles; outer metatarsal tubercle rounded, weakly conical, about four times as large as prominent ovoid inner metatarsal tubercle; supernumerary plantar tubercles absent; subarticular tubercles low, ovoid in dorsal view, most distinct on base of toes; toes without lateral fringes; basal webbing absent; toe tips bulbous, rounded, lacking circumferential grooves, about as large as those on fingers; relative lengths of toes: 1 < 2 < 3 < 5 < 4; Toe V slightly longer than Toe III (Fig.
Measurements of the holotype (in mm).SVL 32.5; tibia length 12.7; foot length 14.0; head length 11.3; head width 12.5; eye diameter 3.4; interorbital distance 3.5; upper eyelid width 3.3; internarial distance 2.9; eye-nostril distance 2.3.
Coloration of the holotype in life (Fig.
Coloration of the holotype in preservative. Dorsum tan with dark brown blotches and dark brown X-shaped marking on shoulder region and an irregular shaped dark brown interorbital blotch. Flanks paler than dorsum, with few pale brown flecks. Canthal and supratympanic stripes dark brown. Upper lip with few pale brown flecks. Arms and legs dorsally tan with few pale and dark brown blotches and flecks. Groin creamy white. Throat, chest and venter creamy white and pale gray mottled. Ventral surfaces of hand and feet creamy white. Iris pale gray.
All paratypes (Figs
Measurements (in mm) of adult type specimens of Phrynopus inti sp. n. M = male, F = female. For other abbreviations see materials and methods.
Characters | MUSM |
|
MUSM | NMP6V | MUSM | MUSM | MUSM |
---|---|---|---|---|---|---|---|
31203 | 245220 | 31183 | 75584 | 31984 | 31976 | 31968 | |
Sex | M | M | M | M | M | M | F |
SVL | 27.2 | 27.4 | 32.5 | 34.2 | 35.1 | 35.2 | 40.4 |
TL | 10.3 | 9.9 | 12.7 | 14.0 | 13.3 | 14.0 | 15.7 |
FL | 12.2 | 11.6 | 14.0 | 15.4 | 13.7 | 13.8 | 17.1 |
HL | 9.4 | 9.9 | 11.3 | 11.4 | 11.9 | 13.0 | 13.5 |
HW | 10.5 | 10.6 | 12.5 | 12.2 | 12.6 | 13.4 | 14.5 |
ED | 2.4 | 2.7 | 3.4 | 3.1 | 3.4 | 3.1 | 3.5 |
IOD | 3.0 | 2.8 | 3.5 | 3.7 | 3.0 | 3.7 | 3.5 |
EW | 2.5 | 2.4 | 3.3 | 3.2 | 2.8 | 3.3 | 3.4 |
IND | 2.1 | 2.5 | 2.9 | 2.7 | 2.6 | 2.9 | 3.1 |
E–N | 1.9 | 1.9 | 2.3 | 2.1 | 2.5 | 2.6 | 3.0 |
Measurements (in mm) and proportions of male type specimens of Phrynopus inti sp. n.; ranges followed by means and one standard deviation in parentheses. For abbreviations see materials and methods.
Characters | Phrynopus inti sp. n. |
Males (n = 6) | |
SVL | 27.2–35.2 (31.9 ± 3.4) |
TL | 9.9–14.4 (12.4 ± 1.7) |
FL | 11.6–15.4 (13.5 ± 1.2) |
HL | 9.4–13.0 (11.2 ± 1.2) |
HW | 10.5–13.4 (12.0 ± 1.1) |
ED | 2.4–3.4 (3.0 ± 0.4) |
IOD | 2.8–3.7 (3.3 ± 0.4) |
EW | 2.4–3.3 (2.9 ± 0.4) |
IND | 2.1–2.9 (2.6 ± 0.3) |
E–N | 1.9–2.6 (2.2 ± 0.3) |
TL/SVL | 0.36–0.41 |
FL/SVL | 0.39–0.45 |
HL/SVL | 0.33–0.37 |
HW/SVL | 0.36–0.39 |
HW/HL | 1.00–1.10 |
E–N/ED | 0.68–0.84 |
EW/IOD | 0.83–0.94 |
The species epithet inti is derived from the Quechuan noun “Inti”, the Incan sun god. The golden-orange iris reminds us of the sun.
Phrynopus inti sp. n. is known from four localities outside and two localities inside the Pui Pui Protected Forest between 3350 and 3890 m a.s.l., covering an estimated area of 101.3 km2 (Figs
The type locality, Quebrada Tasta (Fig.
Type locality and habitats of Phrynopus inti sp. n. Satipo-Toldopampa Road at km 134 on left side of street coming from Satipo, 3350 m a.s.l., 23 June 2013 (A); Quebrada Toldopampa, 3670 m a.s.l., 22 June 2013 (B); Type locality, Quebrada Tasta, 3609 m a.s.l., 20 May 2012 (C); Antuyo, PPPF, 3700 m a.s.l., 27 June 2013 (D); Laguna Sinchon, PPPF, 3890 m a.s.l., 29 June 2013 (E). Photos by E. Lehr.
One male specimen (MUSM 31203) had as ectoparasites five trombiculid mites on the right side in the area of the upper arm insertion. Such parasites are not uncommon in Andean frogs (e.g.,
The IUCN Red List criteria (
With a snout-vent length of up to 40.4 mm, Phrynopus inti sp. n. represents one of the largest species of the genus. Usually, Phrynopus species are characterized by a small robust body, short limbs, narrow or only slightly expanded tips of toes and fingers, and absence of a tympanum. These morphological features seem to be associated with a life in moss layers and grass bunches at elevations between 2600 and 4400 m a.s.l. (
Our phylogenetic analysis suggested that Phrynopus nicoleae, Chaparro, Padial & De la Riva, 2008 is a junior synonym of Phrynopus tribulosus Duellman & Hedges, 2008. The high genetic similarity between P. nicoleae and P. tribulosus was originally identified by
We thank A. Catenazzi and I. De la Riva for their helpful comments and corrections that improved our manuscript. The chief of the community Toldopampa V. Avellaneda helped us to find qualified guides, to rent horses, and allowed us to camp in the community house. We thank the director of the PPPF biologist J. Ríos, the park guards H. Llantoy Cárdenas, L.F. Zevallos García, and J.M. Doñe Sánchez, and three local guides, E. Bórquez Quintana, B. Porras Bórquez, and C. Avellaneda Solano. We thank J.H. Córdova (MUSM, Lima) for loan of material and Lydia Smith and the Evolutionary Genomics Laboratory at the Museum of Vertebrate Zoology (UC Berkeley) for facilitating molecular laboratory work. Fieldwork by EL was funded by a Northern European Explorers Grant (GEFNE13-11) from National Geographic Society Science and Exploration Europe. Illinois Wesleyan University provided a Junior Faculty Leave in 2012. RvM thanks the National Science Foundation Postdoctoral Research Fellowship in Biology (DBI-1103087) and the National Geographic Society Committee for Research and Exploration (Grant # 9191-12). The work of JM was financially supported by the Ministry of Culture of the Czech Republic (DKRVO 2013, 2014/14, 2015/15, 2016/15 and 2017/15, National Museum, Prague, 00023272). Collecting permits (N° 001-2012-SERNANP-JEF, N°-0120-2012-AG-DGFFS-DGEFFS, N°-064-2013-AG-DGFFS-DGEFFS, R.D._N°_359-2013-MINAGRI-DGFFS-DGEFFS) and export permits were issued by the Ministerio del Ambiente, Lima, Peru. We thank the University of Michigan Museum of Zoology (
Comparative specimens examined
Phrynopus barthlenae: Peru: Huánuco: ca. 15 km SE Maraypata, near Laguna Gwengway, 3680 m: MUSM 20606 (holotype).
Phrynopus bufoides: Peru: Pasco: La Victoria, 4100 m: MUSM 18074 (holotype), Paucartambo: Río Gayco, 10°49'9.211"S, 75°58'56.21"W, 4345 m: MUSM 32084.
Phrynopus curator: Yanachaga-Chemillén National Park (Sector San Daniel), 3000 m: MUSM 31106 (holotype).
Phrynopus daemon: Peru: Huánuco: Distrito de Churubamba, Cordillera de Carpish, Unchog elfin forest, 3341 m: MUSM 32747 (paratype).
Phrynopus interstinctus: Peru: Huánuco: Cordillera de Carpish, San Marcos, 3100 m: MUSM 29543 (holotype), 3160 m: MUSM 29544–29545 (paratypes).
Phrynopus juninensis: Peru: Junín: road between Cachiyacu and Hacienda Cascas (11°12'43.1"S, 75°35'31.9"W), 3508 m: MUSM 33258.
Phrynopus kauneorum: Peru: Huánuco: Chaglla, Palma Pampa, 3020 m: MUSM 20459 (holotype), MUSM 19894, 20700; Huánuco: Carpish de Moyobamba: MUSM 18585.
Phrynopus peruanus: Peru: Junín: Puna of Maraynioc (11°21'35.2"S, 75° 28'52.6"W), 3825 m: MHNSM 19977–78.
Locus | Primer | Sequence (5’-3’) | Reference | |
---|---|---|---|---|
16S | 16SAR | F | CGCCTGTTTATCAAAAACAT |
|
16SBR | R | CCGGTCTGAACTCAGATCACGT |
|
|
12S | L25195 | F | AAACTGGGATTAGATACCCCACTA |
|
H2916 | R | GAGGGTGACGGGCGGTGTGT |
|
|
COI | dgLCO1490 | F | GGTCAACAAATCATAAAGAYATYGG |
|
dgHCO2198 | R | TAAACTTCAGGGT GACCAAARAAYCA |
|
|
RAG1 | R182 | F | GCCATAACTGCTGGAGCATYAT |
|
R270 | R | AGYAGATGTTGCCTGGGTCTTC |
|
|
Tyr | Tyr1C | F | GGCAGAGGAWCRTGCCAAGATGT |
|
Tyr1G | R | TGCTGGGCRTCTCTCCARTCCCA |
|