Research Article
Print
Research Article
Redescription of Periplaneta arabica (Bey-Bienko, 1938) (Blattodea, Blattidae), with a comparative analysis of three species of Periplaneta Burmeister, 1838 (sensu stricto)
expand article infoXin-Xing Luo‡, Qian-Qian Li‡, Alireza Zamani§, Yan-Li Che‡, Zong-Qing Wang‡
‡ Southwest University, Chongqing, China
§ University of Turku, Turku, Finland

Corresponding author: Zong-Qing Wang ( zqwang2006@126.com )

Academic editor: Fred Legendre
© 2023 Xin-Xing Luo, Qian-Qian Li, Alireza Zamani, Yan-Li Che, Zong-Qing Wang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Luo X-X, Li Q-Q, Zamani A, Che Y-L, Wang Z-Q (2023) Redescription of Periplaneta arabica (Bey-Bienko, 1938) (Blattodea, Blattidae), with a comparative analysis of three species of Periplaneta Burmeister, 1838 (sensu stricto). ZooKeys 1146: 165-183. https://doi.org/10.3897/zookeys.1146.90817
ZooBank: urn:lsid:zoobank.org:pub:D382AF5A-64EC-4AFF-B5AB-1B2B7A976E5B
Open Access

Abstract

The blattid cockroach Periplaneta arabica (Bey-Bienko, 1938) has been poorly understood since its original description. In this study, male and female (including nymph) of P. arabica are paired using DNA barcoding, and their morphological characters (including both external characteristics and genitalia) are described. A detailed comparative morphological study of this species and the closely related Periplaneta americana (Linnaeus, 1758) and Periplaneta lateralis Walker, 1868 was carried out to explore phylogenetically relevant characters.

Keywords

Blattid cockroach, DNA barcoding, female genitalia, habitat adaptation, male genitalia, sexual dimorphism, Shelfordella, taxonomy

Introduction

According to Beccaloni (2014), the Blattinae genus Shelfordella Adelung, 1910 comprised three species before it was synonymized with Periplaneta (Deng et al. 2023). The taxonomic status of Shelfordella remains unclear even though several revisions were carried out by Princis (1954) and Bohn (1985) based on the external morphological characters. In addition, many molecular phylogenetic studies (Legendre et al. 2015; Bourguignon et al. 2018; Arab et al. 2020; Liao et al. 2021; Djernæs and Murienne 2022; Li et al. 2022; Deng et al. 2023) have shown that Periplaneta americana (Linnaeus, 1758), the type species of Periplaneta Burmeister, 1838, is the sister species to Sh. lateralis (Walker, 1868). Considering both molecular data and morphological characters of male genitalia of P. americana and Sh. lateralis, Shelfordella was considered as a synonym of Periplaneta (Deng et al. 2023), resulting in the restoration of Periplaneta lateralis Walker, 1868 and Periplaneta monochroma Walker, 1871, and the transference of Shelfordella arabica Bey-Bienko, 1938 to Periplaneta. Periplaneta arabica was originally described with a female specimen as its type, and the male has not been described.

DNA barcoding has been confirmed to be a helpful tool in discovery of new species, matching nymphs with adults, and revealing sexual dimorphism and cryptic species in cockroaches (Evangelista et al. 2013; Che et al. 2017; Yang et al. 2019; Li et al. 2022; Zhu et al. 2022). Herein, we use DNA barcoding to pair male, female and nymphs of P. arabica, allowing a comprehensive redescription of this species. We also take the opportunity to compare the morphological characters of P. arabica, P. americana and P. lateralis, to show the structural complexity and diversity of species of Periplaneta s.s., as well as to provide detailed information useful for future phylogenetic studies on the genus.

Material and methods

Morphological study

Specimens (stored in absolute ethanol at -20 °C) examined are deposited in the Institute of Entomology, College of Plant Protection, Southwest University, Chongqing, China (SWU). Abdominal segments were soaked in 10% NaOH solution at 70 °C for 10 minutes. They were cleaned in distilled water, dissected in glycerol under a Motic K400 stereomicroscope, then stored in glycerol. Photographs were taken using a Canon M5 plus a Laowa 65 mm F2.8 CA-Dreamer Macro 2X Macro lens attached to a Leica M205A stereomicroscope. All figures were modified in Adobe Photoshop CC 2019. The morphological terminology used in this paper mainly follows Roth (2003). The terminology of veins follows Li et al. (2018), and those of the sclerites of male and female genitalia mainly follows Klass (1997) and McKittrick (1964), respectively. Measurements were obtained by Vernier Caliper.

Abbreviations used are as follows

Cu cubitus

CuA cubitus anterior

CuP cubitus posterior

hlap process (p) of hook of L3

M media

Pcu postcubitus

R radius

RA radius anterior

RP radius posterior

ScP subcostal posterior

V, V[1], V[s] vannal veins

L1, L2, L3, L4C, L4D, L4E L4G sclerites of the left phallomere

R1G, R1H, R1F, R2, R3 sclerites of the right phallomere

DNA extraction, amplification and sequencing

Total DNA extraction was obtained from muscle tissue using the Hipure Tissue DNA Mini Kit, and the remaining specimens were stored in 95% ethanol. The primers used to amplify the 658 bp cytochrome c oxidase subunit I (COI) fragment were COI-F2 (5’- CAACAAATCATAAAGATATTGGAAC-3’) and COI-R2 (5’- TAAACTTCTGGATGACCAAAAAATCA -3’) or COI-F3 (5’- CAACYAATCATAAAGANATTGGAAC -3’) and COI-R3 (5’-TAAACTTCAGGGTGACCAAARAATCA-3’) (Yang et al. 2019). The amplification reaction was in according to the protocols in Wang et al. (2021). The cycling conditions were as follows: initial denaturation at 98 °C for 2 min, followed by 35 cycles of 98 °C for 10 s, 49–51 °C for 10 s, 72 °C for 10 s, and a final extension at 72 °C for 10 min. The PCR products were then sequenced by BGI Technology Solutions Co. Ltd (BGI-Tech) (Beijing, China).

Sequence processing and molecular analysis

A total of 25 COI sequences were analyzed, of which, 17 sequences were from three Periplaneta species (i.e., six sequences of P. arabica, five sequences of P. americana and six sequences of P. lateralis) (Table 1). Sequences were aligned by MAFFT ver. 7 (https://mafft.cbrc.jp/alignment/server/) with the G-INS-i strategy (Katoh et al. 2019), and manually adjusted using MEGA ver. 7.0.26 (Kumar et al. 2007). The intra- and interspecific genetic distances were quantified in MEGA based on the Kimura 2-parameter (K2P) distance model (Kimura 1980) (Suppl. materials 1, 2). The maximum likelihood (ML) tree was constructed in IQ-TREE ver. 1.6.8 (Nguyen et al. 2015) with 10,000 ultrafast bootstrap replicates; the partition scheme and best-fitting substitution models (COI_pos 1, TRN+I+G; COI_pos 2, TVM+I; COI_pos 3, HKY+I+G) were selected in PartionFinder ver. 2.1.1 (Lanfear et al. 2017) by the corrected Akaike Information Criterion (AICc).

Table 1.
Download as
CSV
XLSX

Samples used in ML analyses with localities, voucher numbers, and accession numbers (bold represent the new sequences). Abbreviations: young nymph (YN); late nymph (LN).

Species Voucher number Locality/References Accession Number
Periplaneta arabica 1213(YN), 1208(♀), YL1(♂), SYL (♂), Shelarab1211(LN), YL2(♀) Dehloran, Ilam, Iran OP727639 to OP727640 and OP727649 to OP727652
Periplaneta americana Bahamas: Exuma, Staniel (Pringle et al. 2019) MK936745
1416(♂), Yuanjiang, Yunnan, China OP727642
1124(♂), 1417(♀) Mt Diaoluo, Hainan, China OP727638 and OP727643
1415(♀) Meizhou Island, Fujian, China OP727641
Periplaneta lateralis 2401(♂), 2430(♀), 2433(♀), 2435(♀), 2440(♀) Laboratory Rearing (online shopping) OP727644 and OP727648
Breeds of Kyle Kandilian
(Bourguignon et al. 2018)		 MG882183
Blatta orientalis – Bourguignon et al. (2018) MG882174
Periplaneta brunnea – Bourguignon et al. (2018) MG882182
Periplaneta fuliginosa – Ma et al. (2019) MF149696
Periplaneta australasiae – Ma et al. (2019) MH184379
Cryptocercus meridianus – Li et al. (2017) MG518617
Tryonicus mackerrasae – Bourguignon et al. (2018) MG882205
Hebardina concinna – Deng et al. (2023) ON645482
Mantis religiosa – Ye et al. (2016) NC030265

Results

Molecular analysis

In this study, we used six COI sequences of P. arabica, five COI sequences of P. americana and six COI sequences of P. lateralis. All new sequences were deposited in GenBank with accession numbers OP727638 to OP727652. Intraspecific COI genetic divergence (K2P) of P. arabica and P. lateralis is 0%, but for P. americana, the intraspecific COI genetic divergence ranged from 0.00% to 2.30%. Interspecific COI genetic divergence ranged from 9.9% (P. arabica and P. americana) to 13.1% (P. americana and P. lateralis).

In our ML analyses, samples including adults and nymphs from the same morphospecies are clustered together with high support values (Fig. 1). Periplaneta arabica was recovered as the sister to P. americana on the basis of COI data but with a rather low support (bootstrap support (BS) = 79). These three species (i.e., P. arabica, P. lateralis and P. americana) formed a monophyletic group with Blatta orientalis as the sister (BS = 79 and 60, respectively).

Figure 1. 

Maximum likelihood (ML) tree derived from COI sequences with 10,000 ultrafast bootstrap replicates.

Taxonomy

Periplaneta Burmeister, 1838

Periplaneta Burmeister, 1838: 502. Type species: Periplaneta americana (Linnaeus, 1758). Shelford 1910: 17; Bey-Bienko 1950: 116; Princis 1966: 404; Asahina 1980: 103; Roth 1999: 168.

Cacerlaca Saussure, 1864: 71; Princis 1966: 405.

Paramethana Shelford, 1909: 309; Princis 1966: 473.

Shelfordella Adelung, 1910: 329; Princis 1966: 507; Bohn 1985: 39.

Diagnosis

(based on species covered in this paper; Periplaneta s.s.). Sexual dimorphism indistinct or distinct. Pronotum subelliptical in male, subelliptical or campaniform in female. Tegmina and wings well developed in male, developed or reduced in female. Legs slightly slender. Abdomen with the first tergite unspecialized in male. Hind margin of supra-anal plate hyaline and concave in the middle; cerci long, apically tapering. Hind margin of subgenital plate slightly convex. Genitalia of male: L1 weakly sclerotized with pubescence; hind margin of L4C nearly truncated; the caudal part of L2 with a long spine toward right; L3 with hlap weakly developed; the basal part of L4G constrict. R1H with two long spines at apex; the caudal part of R1G with a long and curved spine toward right. Genitalia of female: Anterior arch (a.a.) with two symmetrical foot-shaped projections; spermathecal plate (sp.pl) nearly crescent-shaped; the enlarged part of spermatheca (sp.) curved, subelliptical or irregular; basivalvulae (bsv.) subelliptical; laterosternal shelf (ltst.sh.) with postero-lateral angle extended towards outer margin.

Periplaneta arabica (Bey-Bienko, 1938)

Figs 2, 3, 4 (in part), 5 (in part), 6

Shelfordella arabica Bey-Bienko, 1938: 235 (Type locality: Mecca, Saudi Arabia); Bohn 2007: 87.

Blatta (Shelfordella) arabica: Princis 1966: 509.

Material examined

(all deposited in SWU). 6 males, 2 females and 7 nymphs; IRAN; Ilam Province: Dehloran county, near the border with Iraq, surroundings of Changuleh [33°0'49.37"N, 46°36'38.63"E, approximate coordinates], unnamed cave, II. 2020, A.H. Aghaei leg.

Diagnosis

Combining the following characteristics, this species is easily distinguished from its congeners: 1) interocular space slightly wider than the interocellar space and less than interantennal space in male, interocular space wider than interantennal space in female; 2) tegmina of female reduced and nearly square; 3) legs slender, pulvilli and arolia absent; 4) hind margin not extending outward and slightly concave in the middle, forming an obtuse angle in supra-anal plate of male; 5) caudal part of L2 with a well sclerotized spine; 6) hlap weakly developed, but larger than that of the other two species; 7) distal part of R1H with two long spines and no serration.

Redescription

Measurements (mm). Male. Body length including tegmen: 30.6–36.4; body length: 24.2–27.3; pronotum length × width: 6.7–7.7 × 7.2–7.7; tegmen length × width: 24.9–29.2 × 4.6–5.4. Female. Body length: 23.5–25.5; pronotum length × width: 6.4–6.8 × 6.6–7.2; tegmen length × width: 4.4–6.4 × 6.6–7.3.

Coloration. Body brown or reddish brown, eyes black, ocelli white; tegmina and wings yellowish brown.

Male (Fig. 2). Head and thorax. Vertex exposed. Interocular space slightly wider than the interocellar space, less than interantennal space. Antenna longer than the body (Fig. 2C). Pronotum subelliptical, with surface sparsely pubescent, the central part of anterior margin depressed, and hind margin slightly convex, the widest point approximately in the middle (Fig. 2D). Tegmina and wings well developed, exceeding the end of abdomen by about 5.3–7.7 mm. Tegmina with ScP strong, the distal part fusing with anterior branches of R; anterior branches of R with 2–4 bifurcations, posterior branches reaching the outer margin; the base of M distinct with 2–4 bifurcations; CuA slender with a few branches; V indistinct (Fig. 2J). Wings with ScP slender, the distal part of RA indistinct, RP slightly strong and distinct; M with 2–3 bifurcations at the end; CuA strong; V distinct (Fig. 2K). Legs (Fig. 2E–I) slender. Front femur type A2 (Fig. 2E). Hind metatarsus longer than the remaining segments combined (Fig. 2H). Pulvilli and arolia reduced; claws symmetrical (Fig. 2I). Abdomen. First tergite unspecialized. Supra-anal plate transversely broad, the lateral margins curved, and the hind margin slightly concave in the middle; the distal part less sclerotized and hyaline (Fig. 2L). Paraprocts (pp.) long strip-shaped and symmetrical. Cerci long, apically tapering. Subgenital plate nearly square, the hind margin slightly convex (Fig. 2M). Styli long, slender. Genitalia (Fig. 2N, O). L1 weakly sclerotized with pubescence. L4C with microspines on the lateral margin; the distal part expanded, hind margin nearly truncated. L2 curved and extended to left, the caudal part with a long spine toward right. L4D small (Fig. 2O). L4E flat. L3 unciform and well sclerotized; the base wide, downwardly tapering; the distal part bifurcated, hlap weakly developed. L4G elliptic with the basal part constricted. R1H flaky, with two long spines at the apex. The basal part of R1G broad, the distal with a long and curved narrow process toward right. R1F irregular and its outer margin thickened. R2 with a ridge-like projection in dorsal view. R3 located at the upper right, triangular and weakly sclerotized.

Figure 2. 

Male of Periplaneta arabica (Bey-Bienko, 1938) A habitus, dorsal view B habitus, ventral view C head D pronotum E front femur F–H tarsi (front, middle, hind) I arolium of hind leg J tegmen K hind wing L supra-anal plate M subgenital plate N phallomere, dorsal view O phallomere, ventral view. Scale bars: 10.0 mm (A, B, J, K); 2.0 mm (C, D, E, F, G, H, L, M, N, O); 0.5 mm (I).

Female (Fig. 3). Head and thorax. Interocular space wider than interantennal space(Fig. 3B). Pronotum campaniform; anterior margin straight and hind margin convex, the widest point after the middle (Fig. 3A). Tegmina square, reduced and not reaching the first tergite of abdomen; lateral margins of tegmina truncated, forming nearly right angle with the anterior margin; R parallel to the anterior margin (Fig. 3I). Hind wings small lobe-like (Fig. 3J). Abdomen (Fig. 3K, L). Hind margin of tergum X (TX) with median invagination, and with a membranous line inside. Paraprocts (pp.) wide, nearly triangular. Subgenital plate divided; median with intersternal fold (inst.f.). Genitalia (Fig. 3K, L). First valve (v.I) sclerotized with dense punctures; the distal part hyaline, and the base fused with first valvifer (vlf.I). First valvifer short, parallel to paratergites (pt.) and laterosternite IX (ltst.IX). Paratergites slender and laterosternite IX irregular. Valvifer II (p.l.) annular. Second valve (v.II) small and flaky, the base fused, connecting with third valve (v.III) by membrane. Third valve (v.III) large and less sclerotized. Anterior arch (a.a.) wide and its central part with two symmetrical foot-shaped projections, surface with microtrichia. Spermathecal plate (sp.pl) well sclerotized and nearly crescent-shaped. Spermathecal opening (sp.o.) located at anterior margin of spermathecal plate. Spermatheca (sp.) divided into two branches, one branch with the distal part enlarged. Basivalvulae (bsv.) subelliptical with punctures. Postero-lateral angle of laterosternal shelf (ltst.sh.) extended towards outer margin. Vestibular sclerite (vst.s.) strip-shaped.

Figure 3. 

Female and nymph of Periplaneta arabica (Bey-Bienko, 1938) A–D, I–L female A pronotum B head C habitus, dorsal view D habitus, ventral view I tegmen J hind wing K genitalia, dorsal view L genitalia, ventral view E–H habitus of nymph, dorsal and ventral views. Scale bars: 10.0 mm (C, D, G, H); 2.0 mm (A, B, E, F, I, K, L); 1 mm (J).

Nymph. Early instars are yellowish brown with ocelli and eyes small; in older nymphs, the body turns brown or reddish brown (Fig. 3E–H).

Distribution

Saudi Arabia (Mecca); Yemen; United Arab Emirates; Oman; Iran (Ilam Province; new country record).

Remarks

Bey-Bienko (1938) first documented and described this species based on a female specimen from Mecca, Saudi Arabia. Bohn (2007) provided some morphological characteristics of the male in the key to genera and species occurring in the United Arab Emirates. After checking the original description by Bey-Bienko (1938) and Bohn (2007) and the images of the type specimens, we consider P. arabica to be characterized by: 1) interocular space slightly wider than the interocellar space in female; 2) pronotum anterior margin straight and hind margin convex in female; 3) tegmina nearly square in female; 4) hind margin slightly concave in the middle to form an obtuse angle in supra-anal plate of male; these characteristics are present in our specimens as well. Therefore, we concluded that our material collected from western Iran should belong to P. arabica. Matching of individuals of different sexes and life stages was possible with DNA barcoding.

Comparative morphology of P. americana, P. arabica and P. lateralis

A detailed morphological comparison of P. americana, P. arabica and P. lateralis was performed in this study. The following intraspecific variations were found in all three species: 1) the number of veins branches of wings; 2) the marks on disc of pronotum in male and female of P. americana; and 3) the color of the pronotum and abdominal tergite of female of P. lateralis.

External morphological characters

The external morphological characteristics of P. americana, P. arabica and P. lateralis (Fig. 4) are compared in Table 2. Males of the three species have similar shapes of pronotum, wings, and supra-anal and subgenital plates, and lack tergite gland. Interocular space and interantennal space of females were both wider than the single eye spacing. The main differences among these three species are as follows: body size (i.e., P. americana > P. arabica > P. lateralis), tegmina and wings of females, and the presence or absence of arolia and pulvilli.

Figure 4. 

A–F In order from left to right, male of P. americana, female of P. americana, male of P. arabica, female of P. arabica, male of P. lateralis, female of P. lateralis A heads B pronota C tegmina D hind wings E supra-anal plates F subgenital plates G hind tarsi (in order from top to bottom: P. americana, P. arabica, P. lateralis) H–J arolia of hind legs (in order: P. americana, P. arabica, P. lateralis). Scale bars: 10.0 mm (C, D P. americana, males of P. arabica and P. lateralis); 2.0 mm (A, B, E–G, and females of P. arabica and P. lateralis in C); 1.0 mm (D females of P. arabica and P. lateralis); 0.5 mm (H–J).

Table 2.
Download as
CSV
XLSX

Comparison of external morphological characters of males and females of three species of Periplaneta s.s. Dimensions are in mm: mean±SEM (standard error of the mean). Abbreviations: Interocular space (IS); ocelli distance (OD); antennal sockets distance (ASD).

Species P. americana P. arabica P. lateralis
male female male female male female
Measured specimens (N) 23 15 6 2 17 13
Body length include tegmen (mm) 37.239±0.5960 33.327±0.3514 32.917±0.8388 – 24.206±0.2286 –
Body length 31.539±0.7966 30.113±0.6298 26.025±0.6537 24.500±1.0000 19.806±0.2397 20.715±0.3665
Distance comparison of IS, OD and ASD IS ≤ OD < ASD OD ≤ IS < ASD OD < IS ≤ ASD OD < ASD < IS OD < IS < ASD OD < IS ≤ ASD
Ocelli size Medium Medium Medium Small Large Medium
Pronotum shape Subelliptical Subelliptical Subelliptical Campaniform Subelliptical Campaniform
Tegmina Well developed Well developed Well developed Reduced and nearly square Well developed Reduced and nearly triangular
Hind wings Well developed Well developed Well developed Reduced and small lobed Well developed Reduced and fused to metanotum
Legs Slightly slender Slightly slender Slender Slender Slightly slender Slightly slender
Front femora Type A2 Type A2 Type A2 Type A2 Type A2 Type A2
Pulvilli Present Present Absent Absent Present Present
Arolia Medium Medium Absent Absent Minute Minute
First tergite of abdomen No tergite gland – No tergite gland – No tergite gland –
Supra-anal plate’s shape Hind margin extending outward and concave in the middle to forma sharp angle Middle of hind margin deeply concave, forming one acute angle Middle of hind margin concave and not extending Hind margin not extending outward and slightly concave in the middle to form an obtuse angle Hind margin extending outward and slightly concave in the middle to form an actue angle Middle of hind margin forming an obtuse angle
Supra-anal plate’s sclerotization degree The distal part less sclerotized and hyaline Less sclerotized in the middle The distal part less sclerotized and hyaline Less sclerotized in the middle The distal part less sclerotized and hyaline Less sclerotized in the middle
Subgenital plate’s shape Hind margin slightly convex – Hind margin slightly convex – Hind margin slightly convex –

Genitalia of male and female

As depicted in Fig. 5, the genitalia of P. americana, P. arabica and P. lateralis are highly similar in appearance but differ in the degree of development of the sclerites. In males (see P. arabica for detailed description), the results ranked in descending order are as follows: P. lateralis > P. arabica > P. americana for the pubescence density in L1, P. arabica > P. americana > P. lateralis for the sclerotization degree of spine in L2, and P. arabica > P. lateralis > P. americana for the development degree of the hlap in L3. In addition, there are certain differences in other aspects, for example, the basal margin of L4C in P. americana and P. arabica bears a row of microspines that is absent in P. lateralis, and a row of serration at the margin of R1H is present in P. americana but absent in P. arabica and P. lateralis. In females (see P. arabica for detailed description), the degree of development of some sclerites (i.e., valvifer II, laterosternite IX, basivalvulae and laterosternal shelf) is ranked as P. americana > P. arabica > P. lateralis. Periplaneta americana differs from P. lateralis and P. arabica in the following characters: hind margin of basivalvulae (bsv.) with two symmetrical protrusions in the former, which is lacking in the latter two; furthermore, the enlargement of spermathecae (sp.) in P. americana is longer and curved (the degree of curvature varies among samples), but usually irregular in P. arabica and subelliptical in P. lateralis.

Figure 5. 

In order from left to right and top to bottom: P. americana, P. arabica, P. lateralis A left phallomere, dorsal and ventral views B right phallomere, dorsal view C L3 D L4G E overall female genitalia F first valve (v.I), first valvifer (vlf.I) and laterosternite IX (ltst.IX) G second valve (v.II) H third valve (v.III) and anterior arch (a.a.) I basivalvulae (bsv.) and spermathecal opening (sp.o.) J laterosternal shelf (ltst.sh.) K spermathecae (sp.). Scale bars: 2.0 mm (E); 1.0 mm (A, B, D, F, G, H, I, J, K); 0.5 mm (C).

Discussion

In recent years, molecular phylogenetic analyses have shown that P. americana has phylogenetic affinity with P. lateralis (Legendre et al. 2015; Bourguignon et al. 2018; Arab et al. 2020; Liao et al. 2021; Djernæs and Murienne 2022; Li et al. 2022; Deng et al. 2023), whereas P. australasiae+P. fuliginosa+P. brunnea would be the sister group to Homalosilpha (Liao et al. 2021; Djernæs and Murienne 2022; Deng et al. 2023). Deng et al. (2023) also included P. japonica and P. karnyi, neither of which clustered with P. americana. This inevitably raised doubts about the characteristics used in the past to distinguish Periplaneta and Shelfordella. Until recently, the development of tegmina and wings, pulvilli and arolia were usually considered the main diagnostic characters between these two genera (Adelung 1910; Bey-Bienko 1938; Bohn 1985). But, based on the phylogenetic results and some genital characteristics, Deng et al. (2023) considered Shelfordella as a synonym of Periplaneta. Considering the results of the current study, we also confirmed that P. americana differs significantly from P. arabica and P. lateralis in these characteristics. Our DNA-based analyses provided favorable evidence in the matching of females and males in all three species, as well as the pairing of adults and nymphs in P. arabica. Therefore, we had the possibility to compare males of these species and found that genitalia of both sexes of these three species were extremely similar, with differences in the developmental degree of sclerites. After a comparative morphological study on the genitalia of Blaberidae, Roth (1970, 1972, 1973) concluded that genital characters could be used as diagnostic characters for tribes, genera and groups. Until now, no such detailed genital comparison has been done in Blattidae, and our study might be helpful to solve the polyphyly of Periplaneta (Djernæs and Murienne 2022; Deng et al. 2023). In addition, considering the close relationship of P. americana and P. lateralis and the fact that both P. arabica and P. lateralis originated from West Asia (Beccaloni 2014), we speculate that P. americana might have originated in this region as well, and later dispersed naturally or was introduced by humans to other parts of the world, before gradually becoming a notorious indoor pest.

Before the extensive usage of molecular data in cockroach systematics, most genera of Blattinae were established mainly on the basis of external morphological characters. As a matter of fact, the wings, pulvilli and arolia of cockroaches are heavily influenced by the environment and lifestyle (Arnold 1974; Bell et al. 2007). In deserts, a cave-dwelling lifestyle is a survival strategy for cockroaches (Roth and Willis 1960). Material of P. arabica reported in this study were sampled from a natural cave in western Iran (Fig. 6), which has a subtropical desert climate (Burstyn et al. 2019). Morphologically, slender antennae and legs, absent pulvilli and arolia, lighter body and very small ocelli of early instars are consistent with the convergent evolution of cave-dwelling species (Bell et al. 2007; Lucañas and Lit 2016). In contrast, P. americana has well-developed tegmina and wings, and developed pulvilli and arolia in both sexes, which could be favorable to facilitate its dispersal and climbing ability (Clemente and Federle 2008), and also beneficial for this species to colonize other environments (e.g., human settlements, tree trunks in the wild, landfills, and shallow caves with abundant guano; Lucañas et al. 2022) in search for food. Therefore, influenced by their environment and lifestyle, these three species have maintained a high similarity in genitalia, but greatly diverged in external morphology.

Figure 6. 

Male of P. arabica from a cave in Ilam, Iran. Photographed by Alireza Zamani.

Acknowledgements

We are deeply thankful to Amir Hossein Aghaei for collecting the specimens of P. arabica. We are especially grateful to Wenbo Deng and Yishu Wang for their professional suggestions. We also sincerely thank Dr. Frédéric Legendre, Dr. Leonid Anisyutkin, and two anonymous reviewers for their valuable suggestions on our manuscript. This study was funded by the National Natural Science Foundation of China (No. 32170458, 31872271, 31772506).

References

  • Adelung Nv (1910) Ueber einige bemerkenswerte Orthopteren aus dem palacarktischen Asien. Horae Societatis Entomologicae Rossicae 39: 328–358.
  • Arab DA, Bourguignon T, Wang ZQ, Ho SYW, Lo N (2020) Evolutionary rates are correlated between cockroach symbionts and mitochondrial genomes. Biology Letters 16(1): 20190702. https://doi.org/10.1098/rsbl.2019.0702
  • Asahina S (1980) Taxonomic notes on non-domiciliary Periplaneta species from the Ryukyus, Taiwan, Hong Kong and Thailand. Japanese Journal of Sanitary Zoology 31(2): 103–115. https://doi.org/10.7601/mez.31.103
  • Beccaloni GW (2014) Cockroach Species File Online. Version 5.0/5.0. World Wide Web electronic publication. http://Cockroach.SpeciesFile.org [accessed 20 May 2022]
  • Bell WJ, Roth LM, Nalepa CA (2007) Cockroaches: ecology, behavior, and natural history. JHU Press, 247 pp.
  • Bey-Bienko GY (1950) Fauna of the USSR. Insects: Blattodea. Institute of Zoology. Academy of Sciences of the URSS Moscow 40: 116. [ns]
  • Bohn H (1985) Blatta furcata (Karny), the nearest relative of the Oriental cockroach (Blatta orientalis L.) (Insecta: Blattodea: Blattidae). Israel Journal of Zoology 33: 39–50.
  • Bohn H (2007) Order Blattoptera. Arthropod fauna of the UAE 1: 84–103.
  • Bourguignon T, Tang Q, Ho SYW, Juna F, Wang ZQ, Arab DA, Cameron SL, Walker J, Rentz D, Evans TA, Lo N (2018) Transoceanic dispersal and plate tectonics shaped global cockroach distributions: Evidence from mitochondrial phylogenomics. Molecular Biology and Evolution 35(4): 970–983. https://doi.org/10.1093/molbev/msy013
  • Burmeister H (1838) Handbuch der Entomologie. Reimer II(2): 397–756.
  • Burstyn Y, Martrat B, Lopez JF, Iriarte E, Jacobson MJ, Lone MA, Deininger M (2019) Speleothems from the Middle East: An example of water limited environments in the SISAL Database. Quaternary 2(2): 16. https://doi.org/10.3390/quat2020016
  • Che YL, Gui SH, Lo N, Ritchie A, Wang ZQ (2017) Species delimitation and phylogenetic relationships in ectobiid cockroaches (Dictyoptera, Blattodea) from China. PLoS ONE 12(1): e0169006. https://doi.org/10.1371/journal.pone.0169006
  • Clemente CJ, Federle W (2008) Pushing versus pulling: Division of labour between tarsal attachment pads in cockroaches. Proceedings of the Royal Society B, Biological Sciences 275(1640): 1329–1336. https://doi.org/10.1098/rspb.2007.1660
  • Deng WB, Luo XX, Liao SR, Wang ZQ, Che YL (2023) Inclusion of rare taxa from Blattidae and Anaplectidae improves phylogenetic resolution in the cockroach superfamily Blattoidea. Systematic Entomology 48(1): 23–39. https://doi.org/10.1111/syen.12560
  • Djernæs M, Murienne J (2022) Phylogeny of Blattoidea (Dictyoptera: Blattodea) with a revised classification of Blattidae. Arthropod Systematics & Phylogeny 80: 209–228. https://doi.org/10.3897/asp.80.e75819
  • Evangelista D, Buss L, Ware JL (2013) Using DNA barcodes to confirm the presence of a new invasive cockroach pest in New York City. Journal of Economic Entomology 106(6): 2275–2279. https://doi.org/10.1603/EC13402
  • Katoh K, Rozewicki J, Yamada KD (2019) MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 4(20): 1160–1166. https://doi.org/10.1093/bib/bbx108
  • Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16(2): 111–120. https://doi.org/10.1007/BF01731581
  • Klass KD (1997) The external male genitalia and the phylogeny of Blattaria and Mantodea. Bonner Zoologische Monographien 42: 1–341.
  • Kumar NP, Rajavel AR, Natarajan R, Jambulingam P (2007) DNA barcodes can distinguish species of Indian mosquitoes (Diptera: Culicidae). Journal of Medical Entomology 44(1): 1–7. https://doi.org/10.1093/jmedent/41.5.01
  • Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B (2017) PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34: 772–773. https://doi.org/10.1093/molbev/msw260
  • Legendre F, Nel A, Svenson GJ, Robillard T, Pellens R, Grandcolas P (2015) Phylogeny of Dictyoptera: Dating the origin of cockroaches, praying mantises and termites with molecular data and controlled fossil evidence. PLoS ONE 10(7): e0130127. https://doi.org/10.1371/journal.pone.0130127
  • Li WJ, Wang ZQ, Che YL (2017) The complete mitogenome of the wood-feeding cockroach Cryptocercus meridianus (Blattodea: Cryptocercidae) and its phylogenetic relationship among cockroach families. International Journal of Molecular Sciences 18(11): 2397. https://doi.org/10.3390/ijms18112397
  • Li XR, Zheng YH, Wang CC, Wang ZQ (2018) Old method not old-fashioned: Parallelism between wing venation and wing-pad tracheation of cockroaches and a revision of terminology. Zoomorphology 137(4): 519–533. https://doi.org/10.1007/s00435-018-0419-6
  • Li Y, Luo XX, Zhang JW, Wang ZQ, Che YL (2022) A new species of Bundoksia Lucañas, 2021 with comments on its subfamilial placement, based on morphological and molecular data. ZooKeys 1085: 145–163. https://doi.org/10.3897/zookeys.1085.72927
  • Liao SR, Wang YS, Jin DT, Chen R, Wang ZQ, Che YL (2021) Exploring the relationship of Homalosilpha and Mimosilpha (Blattodea, Blattidae, Blattinae) from a morphological and molecular perspective, including a description of four new species. PeerJ 9: e10618. https://doi.org/10.7717/peerj.10618
  • Linnaeus C (1758) Systema naturæ 1, Editio Decima. Sweden: Holmiæ, 1–824.
  • Lucañas CC, Lit Jr IL (2016) Cockroaches (Insecta, Blattodea) from caves of Polillo Island (Philippines), with description of a new species. Subterranean Biology 19: 51–64. https://doi.org/10.3897/subtbiol.19.9804
  • Lucañas CC, Lit Jr IL, Quibod MNRM, Bicaldo PRD, Larona AR (2022) Cockroaches from caves in Samal Island, Philippines, with notes on the invasive Periplaneta americana (L.) (Blattodea: Blattidae). Philippine Entomologist 36(1): 15–24.
  • Ma JN, Liu JH, Shen YM, Fan ZX, Yue BS, Zhang XY (2019) Population genetic structure and intraspecific genetic distance of Periplaneta americana (Blattodea: Blattidae) based on mitochondrial and nuclear DNA markers. Ecology and Evolution 9(22): 12928–12939. https://doi.org/10.1002/ece3.5777
  • McKittrick FA (1964) Evolutionary studies of cockroaches. Cornell University Agricultural Experiment Station 389: 1–197.
  • Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Princis K (1954) Wo ist die Urheimat von Blatta orientalis L. zu suchen? Opuscula Entomologica 19: 202–204.
  • Princis K (1966) Blattariae: Suborbo Blattoidea Fam.: Blattidae, Nocticolidae. Orthopterorum Catalogus 8: 404–509.
  • Pringle RM, Kartzinel TR, Palmer TM, Thurman TJ, Fox-Dobbs K, Xu CCY, Hutchinson MC, Coverdale TC, Daskin JH, Evangelista DA, Gotanda KM, A. Man in ’t Veld N, Wegener JE, Kolbe JJ, Schoener TW, Spiller DA, Losos JB, Barrett RDH (2019) Predator-induced collapse of niche structure and species coexistence. Nature 570: 58–64. https://doi.org/10.1038/s41586-019-1264-6
  • Roth LM (1972) The male genitalia of Blattaria. 9. Blaberidae, Gyna spp. (Perisphaeriinae) Phoraspis, Thorax, and Phlebonotus (Epilamprinae). Transactions of the American Entomological Society 98: 185–217.
  • Saussure (1864) Mémoires pour serveir a l’Histoire Naturelle du Mexique des Antilles et des Etats-Unis. Orthoptères de l’Amérique Moyenne 18(3–4): 71.
  • Shelford R (1909) Transactions of the entomological society of London. Royal Entomological Society of London, 309 pp.
  • Shelford R (1910) Orthoptera fam. Blattidae subfam. Blattinae (= Periplanetinae). In: Wytsman P (Ed.) Genera Insectorum. Belgique, 17 pp.
  • Walker F (1868) Catalogue of the specimens of Blattarie in the collection of the British Museum. Printed for the Trustees of the British Museum, 1–239. https://doi.org/10.5962/bhl.title.8495
  • Walker (1871) Catalogue of the specimens of Dermaptera Saltatoria in the collection of the British Museum. Part V. Supplement to the catalogue of Blattariae. Printed for the Trustees of the British Museum, 1–43.
  • Wang YS, Chen R, Jin DT, Che YL, Wang ZQ (2021) New record of Cyrtonotula Uvarov, 1939 (Blaberidae, Epilamprinae) from China, with three new species based on morphological and COI data. ZooKeys 1021: 127–143. https://doi.org/10.3897/zookeys.1021.59526
  • Yang R, Wang ZQ, Zhou YH, Wang ZQ, Che YL (2019) Establishment of six new Rhabdoblatta species (Blattodea, Blaberidae, Epilamprinae) from China. ZooKeys 851: 27–69. https://doi.org/10.3897/zookeys.851.31403
  • Ye F, Lan XE, Zhu WB, You P (2016) Mitochondrial genomes of praying mantises (Dictyoptera, Mantodea): Rearrangement, duplication, and reassignment of tRNA genes. Scientific Reports 6(1): 25634. https://doi.org/10.1038/srep25634
  • Zhu J, Zhang JW, Luo XX, Wang ZQ, Che YL (2022) Three cryptic Anaplecta (Blattodea, Blattoidea, Anaplectidae) species revealed by female genitalia, plus seven new species from China. ZooKeys 1080: 53–97. https://doi.org/10.3897/zookeys.1080.74286

Supplementary materials

Supplementary material 1 

Genetic divergence of distances calculated by K2P model method using cytochrome c oxidase subunit I (COI) gene sequences in MEGA

Xin-Xing Luo, Qian-Qian Li, Alireza Zamani, Yan-Li Che, Zong-Qing Wang

Data type: table (excel file)

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (13.73 kb)
Supplementary material 2 

Interspecific genetic divergence of distances calculated by K2P model method using cytochrome c oxidase subunit I (COI) gene sequences in MEGA

Xin-Xing Luo, Qian-Qian Li, Alireza Zamani, Yan-Li Che, Zong-Qing Wang

Data type: table (excel file)

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (11.45 kb)
login to comment