Research Article |
Corresponding author: Alejandro Arteaga ( af.arteaga.navarro@gmail.com ) Academic editor: Robert Jadin
© 2022 Alejandro Arteaga, Amanda Quezada, Jose Vieira, Juan M. Guayasamin.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Arteaga A, Quezada A, Vieira J, Guayasamin JM (2022) Leaving no stone unturned: three additional new species of Atractus ground snakes (Serpentes, Colubridae) from Ecuador discovered using a biogeographical approach. ZooKeys 1121: 175-210. https://doi.org/10.3897/zookeys.1121.89539
|
The genus Atractus includes 146 species of cryptozoic snakes occurring from Panama to northeastern Argentina. Here, a molecular phylogeny of this genus is presented, which encompasses 29% (= 42; six are included here for the first time) of the species currently recognized. Morphological and phylogenetic support is found for three new species of ground snakes, which are described here based on their unique combination of molecular, meristic, and color pattern characteristics. The name A. arangoi Prado, 1939 is revalidated for a Colombian snake species previously subsumed under A. major Boulenger, 1894 based on new material collected in Ecuador. Reidentifications are provided for Atractus voucher specimens and sequences deposited in GenBank. With these changes, the number of Atractus reported in Ecuador increases from 27 to 31 species. Finally, attention is given to the importance of using a biogeographical framework that includes molecular data and a comprehensive geographic sampling when proposing species limits in complex taxonomic groups.
Biodiversity, biogeography, Colubridae, fossorial, phylogeny, new species, taxonomy
Atractus Wagler, 1828 is the most speciose snake genus in the world (
In Ecuador, the exploration of remote mountain ranges (e.g., the Cordillera de Guacamayos, Sumaco Volcano, and the Cordillera del Cóndor) within the last two decades has resulted in the discovery of at least six species of Atractus, including the most heavy-bodied and strikingly colored in the genus (
The use of molecular tools in Atractus systematics is also likely to increase the rate at which new species in this genus are detected and described. Only seven species of Atractus have been described using molecular data in addition to meristic and color pattern characteristics (
Finally, a mention should be made about the importance of using a biogeographical framework that includes molecular data and species distribution models (when the number and quality of locality records is sufficient for these analyses; see
To help clear the waters of Atractus taxonomy, in this work we present a curated phylogeny of the genus, reidentify Atractus sequences in GenBank, present the description of three new species, and provide the revalidation of a taxon previously subsumed under A. major.
This study was carried out in strict accordance with the guidelines for use of live amphibians and reptiles in field research (
Criteria for common name designation are as proposed by
Our terminology for Atractus cephalic shields follows
Locality data for specimens examined in this study. Coordinates represent actual GPS readings taken at the locality of collection or georeferencing attempts from gazetteers under standard guidelines, although some variation from the exact collecting locality will be present. Similarly, elevations are taken from Google Earth and may not exactly match the elevations as originally reported.
Species | Voucher | Country | Province | Locality | Latitude, Longitude | Elev. (m) |
---|---|---|---|---|---|---|
A. arangoi | DHMECN 8343 | Ecuador | Sucumbíos | Bloque 27 | 0.32271, -76.19300 | 264 |
A. arangoi |
|
Ecuador | Napo | Jatun Sacha Biological Station | -1.06633, -77.61640 | 423 |
A. arangoi |
|
Ecuador | Napo | Jatun Sacha Biological Station | -1.06633, -77.61640 | 423 |
A. discovery sp. nov. |
|
Ecuador | Morona Santiago | Campamento Arenales | -2.59253, -78.56507 | 2057 |
A. discovery sp. nov. |
|
Ecuador | Azuay | Amaluza | -2.61583, -78.56538 | 2002 |
A. discovery sp. nov. |
|
Ecuador | Azuay | Amaluza | -2.61583, -78.56538 | 2002 |
A. major |
|
Ecuador | – | – | – | – |
A. major |
|
Ecuador | Orellana | Tambococha | -0.97839, -75.42569 | 194 |
A. major |
|
Ecuador | Orellana | Tambococha | -1.03981, -75.44849 | 210 |
A. major |
|
Ecuador | Orellana | Tambococha | -0.97839, -75.42569 | 194 |
A. major |
|
Ecuador | Pastaza | Campo Villano B | -1.45745, -77.44455 | 331 |
A. major |
|
Ecuador | Pastaza | Río Sarayakillo | -1.72754, -77.48048 | 434 |
A. major |
|
Ecuador | Orellana | Vía Pompeya Sur-Iro | -0.99307, -76.24904 | 246 |
A. major |
|
Ecuador | Sucumbíos | Pañacocha | -0.44791, -76.07097 | 240 |
A. major |
|
Ecuador | Orellana | Vía Pompeya Sur-Iro | -0.99320, -76.24907 | 246 |
A. major |
|
Ecuador | Napo | Comunidad Gareno | -1.04856, -77.37742 | 334 |
A. major | QCAZR 11744 | Ecuador | Pastaza | Lorocachi | -1.65567, -75.96886 | 212 |
A. major |
|
Ecuador | Morona Santiago | Macas-Riobamba | -2.25674, -78.16797 | 1148 |
A. michaelsabini sp. nov. |
|
Ecuador | El Oro | El Chiral | -3.63825, -79.59723 | 1841 |
A. michaelsabini sp. nov. |
|
Ecuador | El Oro | La Chonta | -3.56585, -79.85144 | 1025 |
A. michaelsabini sp. nov. |
|
Ecuador | El Oro | La Chonta | -3.56585, -79.85144 | 1025 |
A. michaelsabini sp. nov. | DHMECN 7644 | Ecuador | Azuay | Reserva Yunguilla | -3.22684, -79.27520 | 1748 |
A. michaelsabini sp. nov. | DHMECN 7645 | Ecuador | Azuay | Reserva Yunguilla | -3.22684, -79.27520 | 1748 |
A. michaelsabini sp. nov. |
|
Ecuador | El Oro | Guanazán | -3.44139, -79.49417 | 2596 |
A. michaelsabini sp. nov. |
|
Ecuador | El Oro | Guanazán | -3.44668, -79.49051 | 2663 |
A. michaelsabini sp. nov. |
|
Ecuador | El Oro | El Panecillo | -3.46753, -79.48248 | 2775 |
A. michaelsabini sp. nov. |
|
Ecuador | El Oro | El Panecillo | -3.46753, -79.48248 | 2775 |
A. michaelsabini sp. nov. |
|
Ecuador | Azuay | Corraleja | -3.38740, -79.22785 | 2660 |
A. michaelsabini sp. nov. |
|
Ecuador | El Oro | Guanazán | -3.46753, -79.48248 | 2750 |
A. pachacamac |
|
Ecuador | Morona Santiago | Macas-Riobamba | -2.24087, -78.27632 | 1644 |
A. resplendens |
|
Ecuador | Tungurahua | Montañas de San Antonio | -1.43413, -78.40726 | 2655 |
A. resplendens |
|
Ecuador | Tungurahua | Montañas de San Antonio | -1.43413, -78.40726 | 2655 |
A. resplendens |
|
Ecuador | Tungurahua | Montañas de San Antonio | -1.43413, -78.40726 | 2655 |
A. roulei |
|
Ecuador | Chimborazo | Alausí | -2.20636, -78.84611 | 2400 |
A. roulei |
|
Ecuador | Azuay | Miguir, 10 km E of | -2.78771, -79.37132 | 2596 |
A. roulei | MZUTI 5107 | Ecuador | Bolívar | Above Balzapamba | -1.83601, -79.13322 | 2026 |
A. roulei |
|
Ecuador | Azuay | Hierba Mala | -2.70430, -79.43367 | 2427 |
A. roulei |
|
Ecuador | Chimborazo | Tixán | -2.16174, -78.81227 | 2892 |
A. roulei |
|
Ecuador | Chimborazo | Tixán | -2.16174, -78.81227 | 2892 |
A. roulei |
|
Ecuador | Chimborazo | Tixán | -2.16174, -78.81227 | 2892 |
A. roulei |
|
Ecuador | Chimborazo | Tixán | -2.16174, -78.81227 | 2892 |
A. roulei |
|
Ecuador | Chimborazo | Tixán | -2.16174, -78.81227 | 2892 |
A. roulei |
|
Ecuador | Chimborazo | Tixán | -2.16174, -78.81227 | 2892 |
A. zgap sp. nov. |
|
Ecuador | Napo | Santa Rosa | -0.31004, -77.78591 | 1500 |
A. zgap sp. nov. |
|
Ecuador | Napo | Borja, 1 km NE of | -0.40954, -77.84005 | 1703 |
A. zgap sp. nov. |
|
Ecuador | Napo | Bosque La Cascada | -0.14572, -77.49593 | 1460 |
Tissue samples from 12 individuals representing seven species (including the three new species described here) were obtained in Ecuador. All specimens included in the genetic analyses were morphologically identified according to
Genomic DNA was extracted from 96% ethanol-preserved tissue samples (liver, muscle tissue, or scales) using either a guanidinium isothiocyanate extraction protocol (
A total of 274 DNA sequences were used to build a phylogenetic tree of the genus Atractus, of which 32 were generated during this work and 242 were downloaded from GenBank, most of which were produced by
Phylogenetic relationships were assessed under both a Bayesian inference (BI) approach in MrBayes 3.2.0 (
We present ranges of occurrence for five species of Atractus, including the three new species described here. Presence localities are derived from museum vouchers (Table
For the first explorative exercise, we used the 19 climate layers from the WorldClim project and assessed which variables were the most important for the model, according to the Jackknife test calculated in MaxEnt (
Selected partitions and models of evolution are presented in Table
Partition scheme and models of evolution used in phylogenetic analyses. Numbers in parentheses indicate codon position.
Partition | Best model | Gene regions | Number of aligned sites |
---|---|---|---|
1 | GTR+I+G | 16S, cytb(3), ND4(1), NT3(1) | 1202 |
2 | HKY+I+G | cytb(1), ND4(2) | 631 |
3 | GTR+I+G | cytb(2), ND4(3) | 630 |
4 | JC | CMOS(1), NT3(3) | 305 |
5 | K80+I | CMOS(2), NT3(2), RAG1(2), RAG1(3) | 794 |
6 | HKY | CMOS(3), RAG1(1) | 423 |
Phylogenetic relationships within Atractus inferred using a Bayesian inference and derived from analysis of 3,985 bp of DNA (gene fragments 16S, CYTB, ND4, C-MOS, NT3, and RAG1). Support values on intra-specific branches are not shown for clarity. Voucher numbers for sequences are indicated for each terminal. Black dots indicate clades with posterior probability values from 95–100%. Grey dots indicate values from 70–94%. White dots indicate values from 50–69% (values < 50% not shown). Colored clades correspond to the species’ distribution presented in the map of Fig.
Atractus roulei is the strongly supported sister species of A. carrioni Parker, 1930, a relationship recovered in previous studies, but we found additional geographically structured genetic divergence within the former species (Figs
Distribution of Atractus arangoi, A. roulei, A. michaelsabini sp. nov., A. zgap sp. nov., and A. discovery sp. nov. in Ecuador and adjacent Colombia. White dots represent localities listed under Suppl. material
We find strong support for the relationship between members of the Atractus iridescens species group, which mirrors the results of
We name or provide redescriptions only for species that are monophyletic in our molecular phylogeny and share diagnostic features of their coloration pattern and lepidosis. Based on these species’ delimitation criteria, which follow the general species concept of
Photographs of living specimens of brown-colored Atractus occurring along the Amazonian slopes of the Andes in Ecuador a A. arangoi
Atractus discovery sp. nov. is placed in the genus Atractus, as diagnosed by
Atractus discovery sp. nov. differs from most of its congeners by having a bright yellow belly with a conspicuous dark brown longitudinal stripe. This species is compared to other small brownish congeneric ground snakes distributed along the Amazonian slopes of the Andes (most of these are pictured in Fig.
Adult male, SVL 284 mm, tail length 28 mm (9.9% SVL); body diameter 7.8 mm; head length 8.8 mm (3.1% SVL); head width 5.6 mm (2.0% SVL); interocular distance 3.4 mm; head slightly distinct from body; snout-orbit distance 3.4 mm; rostral 1.6 mm wide, ca. as broad as high; internasals 0.9 mm wide; prefrontals 2.1 mm wide; frontal 2.9 mm wide, with a curvilinear triangular shape in dorsal view; parietals 2.2 mm wide, ~ 2 × as long as wide; nasal divided; loreal 2.0 mm long, ~ 3 × longer than high; eye diameter 1.1 mm; pupil round; supraoculars 1.3 mm wide; one postocular; temporals 1+2, upper posterior temporal elongate; eight supralabials, fourth and fifth contacting orbit; symphysial 1.0 mm wide, ~ 2 × as broad as long and separated from chinshields by first pair of infralabials; seven infralabials, first four contacting chinshields; chinshields ~ 2 × as long as broad, posterior chinshields absent; four rows of gular scales; dorsal scales arranged in 17/17/17 rows, smooth without apical pits; two preventrals; ventrals 168; anal plate single; 27 paired subcaudals.
The three known specimens of Atractus discovery sp. nov. were found in open areas adjacent to cloud forest border.
Atractus discovery sp. nov. is known only from two localities (Arenales and Amaluza, listed under Suppl. material
The specific epithet discovery is used as a noun in apposition and honors ‘The Explorers Club Discovery Expedition Grants’ (https://www.explorers.org/grants) initiative, a program seeking to foster scientific understanding for the betterment of humanity and all life on Earth and beyond. The grant program supports researchers and explorers from around the world in their quest to mitigate climate change, prevent the extinction of species and cultures, and ensure the health of the Earth and its inhabitants. ‘The Explorers Club Discovery Expedition Grants’ program funded the expedition that resulted in the discovery of this new species of snake.
We consider Atractus discovery sp. nov. to be Data Deficient, following IUCN Red List criteria, because the species belongs to a poorly studied genus of snakes and is known only from three specimens collected recently in a single river valley (Río Paute) in the Amazonian slopes of the Ecuadorian Andes. In addition to the presence of a system of major hydroelectric dams in this valley, most of the native cloud forest habitat in the segment between Amaluza and Arenales has been converted to pastures. However, we consider there is insufficient data to estimate whether this new snake species is restricted to the immediate environs of the type locality or if it is widely distributed along the unexplored cloud forests of the adjacent Sangay National Park.
MZUTI 5311, adult female collected by Diego Piñán in February 2017 at El Chaco, Napo Province, Ecuador (S0.31004, W77.78591; 1500 m).
Atractus zgap sp. nov. is placed in the genus Atractus, as diagnosed by
Atractus zgap sp. nov. is compared to other small brownish congeneric ground snakes distributed along the Amazonian slopes of the Andes (most of these are illustrated in Fig.
Adult female, SVL 376 mm, tail length 37 mm (9.8% SVL); body diameter 9.1 mm; head length 11.7 mm (3.1% SVL); head width 6.4 mm (1.7% SVL); interocular distance 4.3 mm; head slightly distinct from body; snout-orbit distance 3.8 mm; rostral 2.5 mm wide, ca. as broad as high; internasals 1.3 mm wide; prefrontals 2.5 mm wide; frontal 3.1 mm wide, with a curvilinear triangular shape in dorsal view; parietals 2.4 mm wide (56% length); nasal divided; loreal 1.6 mm long, ~ 2 × longer than high; eye diameter 1.7 mm; pupil round; supraoculars 1.2 mm wide; two postoculars; temporals 1+2; seven supralabials, third and fourth contacting orbit; symphysial 1.7 mm wide, ~ 2 × as broad as long, separated from chinshields by first pair of infralabials; seven infralabials, first three contacting chin shields; chinshields ~ 2 × as long as broad, posterior chinshields absent; dorsal scales arranged in 17/17/17 rows, smooth without apical pits; two preventrals; ventrals 173; anal plate single; 25 paired subcaudals.
Most individuals of Atractus zgap sp. nov. have been found during the day hidden under rocks, among herbs, or buried under soft soil in plantations and rural gardens close to remnants of native forest. At night, they have been seen crossing rural roads. Occasionally, during sunny days right after a rain, individuals have been seen crawling on the pavement or on gravel roads (Diego Piñán, pers. comm.).
Atractus zgap sp. nov. is known only from five localities (See Suppl. material
The specific epithet zgap is used as a noun in apposition and honors the ‘Zoological Society for the Conservation of Species and Populations’ (ZGAP) (https://www.zgap.de), a program seeking to conserve unknown but highly endangered species and their natural habitats throughout the world. The ZGAP grant program supports the fieldwork of young scientists who are eager to implement and start conservation projects in their home countries. Specifically, ZGAP has supported the work on endangered Andean reptiles in Ecuador conducted by AA and JV.
We consider Atractus zgap sp. nov. to be Endangered following the IUCN criteria B2a, b (i, iii) (
Atractus roulei Savage, 1960: 68 (part).
Atractus lehmanni
MZUTI 5289, adult female collected by Jorge Luis Romero at the type locality. AMARU 002 (Fig.
Photographs of living specimens of Atractus roulei and A. michaelsabini sp. nov. a A. roulei
Atractus michaelsabini sp. nov. is placed in the genus Atractus, as diagnosed by
Atractus michaelsabini sp. nov. is compared to other members of the A. roulei species group: Atractus carrioni and A. roulei. From A. carrioni, the new species differs in having a loreal scale (Fig.
Adult male, SVL 256 mm, tail length 39 mm (15.2% SVL); body diameter 7.4 mm; head length 10.7 mm (3.1% SVL); head width 6.4 mm (2.5% SVL); interocular distance 3.7 mm; head slightly distinct from body; snout-orbit distance 3.5 mm; rostral 1.9 mm wide, ca. as broad as high; internasals 1.0 mm wide; prefrontals 2.0 mm wide; frontal 3.0 mm wide, with a curvilinear triangular shape in dorsal view; parietals 2.9 mm wide (65% length); nasal divided; loreal 2.2 mm long, ~ 3 × longer than high; eye diameter 1.4 mm; pupil round; supraoculars 1.3 mm wide; one postocular; temporals 1+2; five supralabials, third contacting orbit; symphysial 1.7 mm wide, ~ 3 × as broad as long, separated from chinshields by first pair of infralabials; five infralabials, first three contacting chinshields; chinshields ~ 2 × as long as broad, posterior chinshields absent; dorsal scales arranged in 15/15/15 rows, smooth without apical pits; no preventrals; ventrals 143; anal plate single; 31 paired subcaudals.
Most individuals of Atractus michaelsabini sp. nov. have been found during the day hidden under rocks, mats of rotten vegetation, or buried in soft soil in pastures and maize plantations close to remnants of native forest. At night, they have been seen crossing forest trails. At the type locality, clutches of three or four eggs have been found under soil (Jorge Luis Romero, pers. comm.). Anecdotal information suggests that these snakes are more active during the rainy months (February-May at the type locality; Jorge Luis Romero, pers. comm.).
Atractus michaelsabini sp. nov. is endemic to an estimated 2,530 km2 area along the Pacific slopes of the Andes in southwestern Ecuador. The species occurs in the xeric inter-Andean valley of the Río Jubones as well as on the slopes of the Cordillera de Chilla. Atractus michaelsabini sp. nov. is known from provinces Azuay, El Oro, and Loja, and has been recorded at elevations between 927 and 2922 a.s.l. (Fig.
The specific epithet michaelsabini is a patronym honoring a young nature lover, Michael Sabin, grandson of American philanthropist and conservationist Andrew “Andy” Sabin. The Sabin family is involved in conservation and field research of amphibians and reptiles and has protected over 264,365 acres of critical habitat throughout the world.
We consider Atractus michaelsabini sp. nov. to be Endangered following the IUCN criteria B1a, b (i, iii) (
Our resulting distribution maps increase the number of known localities of occurrence for the studied taxa (listed under Suppl. material
Differences in coloration, scale counts, and size between Atractus arangoi and A. major. The range of each continuous variable is from our own sample,
Variable character | Atractus arangoi | Atractus major | ||
---|---|---|---|---|
Dark brown or black nape stripe | Absent | Present | ||
Dorsal markings | Irregular dark blotches | Complete irregular dark bands anteriorly; blotches posteriorly | ||
Sex | Males (n = 2) | Females (n = 2) | Males (n = 7) | Females (n = 5) |
Maximum SVL | 309 mm | 412 mm | 533 mm | 986 mm |
Ventral scales | 154–163 | 160–161 | 162–165 | 172–177 |
Subcaudal scales | 38–39 | 29–32 | 36–45 | 34–37 |
In his unpublished BSc thesis,
Reidentification of Atractus specimens reidentified in
Voucher | Original identification ( |
Proposed reidentification ( |
Reidentification warranted and substantiated | Identification |
---|---|---|---|---|
MZUTI 4330 | Atractus cerberus | Atractus cf. iridescens | No | Atractus cerberus |
MZUTI 1385, 2649–50, 3323 | Atractus occidentalis | Atractus dunni | No | Atractus microrhynchus |
MZUTI 3758–59 | Atractus esepe | Atractus cf. iridescens and A. iridescens | No | Atractus esepe |
MZUTI 4178 | Atractus iridescens | Atractus iridescens | Identity remained the same, but listed as “reidentified” | Atractus iridescens |
MZUTI 4122 | Atractus microrhynchus | Atractus iridescens | No | Atractus microrhynchus |
DHMECN 7644 | Atractus lehmanni | Atractus roulei | Warranted at time of publication | Atractus michaelsabini sp. nov. |
MZUTI 5109 | Atractus microrhynchus | Atractus dunni | No | Atractus microrhynchus |
MZUTI 5107 | Atractus pyroni | Atractus roulei | Yes | Atractus roulei |
ANF 2390 | Atractus touzeti | Atractus pachacamac | Yes | Atractus pachacamac |
GFM 307 | Atractus schach | Atractus snethlageae | Yes | Atractus snethlageae |
IBSP 71932 | Atractus zebrinus | Atractus triherurus | Yes, but name misspelled | Atractus trihedrurus |
Reidentification of Atractus sequences available in GenBank based on direct examination of voucher specimens.
Voucher | GenBank accession numbers | Identity in GenBank | Identification |
---|---|---|---|
DHMECN 8343 | KY610059, KY610105 | Atractus major | Atractus arangoi |
|
MT507872, MT511989 | Atractus roulei | Atractus michaelsabini sp. nov. |
|
MT507874, MT511990 | Atractus roulei | Atractus michaelsabini sp. nov. |
|
MT507875, MT511981, MT511991 | Atractus roulei | Atractus michaelsabini sp. nov. |
|
MT507876, MT511992 | Atractus roulei | Atractus michaelsabini sp. nov. |
MHUA 14368 | GQ334664, GQ334581, GQ334558, GQ334480 | Atractus wagleri | Atractus lasallei |
Atractus is perhaps the most taxonomically complex snake genus and the work needed to elucidate its evolutionary relationships is just starting. Achieving a comprehensive understanding of the real diversity within this cryptozoic group of snakes will require an approach combining three actions: 1) improving the taxon sampling available for comparison at the molecular level; 2) re-sampling type localities as well as exploring new remote areas; and 3) defining species boundaries among Atractus species using an integrative taxonomic approach, not only scale counts. Below, we discuss how our results help clear the waters in Atractus taxonomy and provide insights on where future research efforts might be most effective.
The molecular phylogenies presented here (Fig.
There is a clade formed by the remaining Ecuadorian Atractus that were included in the phylogeny and are distributed along the Amazonian slopes of the Andes. The new species, A. discovery sp. nov. and A. zgap sp. nov., are included in this group. While the former is the strongly supported sister species to A. resplendens, it has a coloration pattern most similar to A. orcesi (Fig.
The binary environmental niche models (Fig.
In addition to creating a more robust phylogenetic tree of ground snakes, one of the most important actions in the quest towards a more clear, stable, and useful Atractus taxonomy is the correct identification of museum specimens. Based on our review of the reidentifications proposed in
The last point on biogeography deserves elaboration. The use of species distribution models can be used not only to discover and test biogeographical patters but also to test species as hypotheses (
Finally, although Atractus systematics have progressed greatly since Savage published his monograph on the Ecuadorian members of this genus in 1960, many “stones are still left unturned.” The Ecuadorian species A. clarki Dunn & Bailey, 1939, A. collaris Peracca, 1897, A. gaigeae Savage, 1955, and A. occipitoalbus have not been included in a phylogenetic work, and their status remains uncertain. Also, an overwhelming majority of Atractus diversity, both described and undescribed, is in Colombia (
This article was greatly improved by comments of Omar Entiauspe-Neto, Abel Batista, and Robert Jadin. For granting access to the protected forests under their care, we are grateful to Pedro Alvarado of CELEC EP, Martin Schaefer and David Agro of Fundación Jocotoco, and Alex Rosillo of Fundación Jatun Sacha. Special thanks to Eric Osterman, Gabriella Marcano, and María José Quiroz for their assistance and companionship in the field. For providing specimens, photos, and ecological information of Atractus, we are grateful to Diego Piñán and Jorge Luis Romero. For creating the image of the juvenile of A. major, we are grateful to Sebastián Di Doménico. Gabriela Gavilanes provided invaluable lab assistance in generating DNA sequence data. For granting access to specimens under their care, we are grateful to Christopher Raxworthy (
GenBank accession numbers for loci and terminals of taxa and outgroups sampled in this study. Novel sequence data produced in this study are marked with an asterisk (*).
Species | Voucher | 16S | CYTB | ND4 | CMOS | NT3 | RAG1 |
---|---|---|---|---|---|---|---|
A. arangoi | DHMECN 8343 | KY610059 | – | KY610105 | – | – | – |
A. arangoi |
|
ON907812* | ON925021* | ON925012* | – | – | – |
A. arangoi |
|
ON907811* | ON925020* | ON925011* | – | – | – |
A. atlas |
|
MH790470 | MN887669 | MN887691 | MN887640 | MN887715 | MN887745 |
A. badius | MNRJ 26717 | MH790476 | MK835891 | – | MK835864 | MK835980 | MK835948 |
A. boimirim | MPEG 21233 | MH790478 | – | – | MK835866 | MK835982 | MK835951 |
A. carrioni | MZUTI 4195 | KY610046 | – | KY610094 | – | – | – |
A. carrioni |
|
MT507867 | – | MT511983 | – | – | – |
A. carrioni |
|
MT507868 | – | MT511984 | – | – | – |
A. carrioni |
|
MT507869 | – | MT511985 | – | – | – |
A. carrioni |
|
MT507864 | MT511977 | MT511982 | – | – | – |
A. carrioni |
|
MT507865 | MT511978 | – | – | – | – |
A. cerberus | MZUTI 4330 | KY610047 | KY610073 | KY610095 | – | – | – |
A. dapsilis | MNRJ 16796 | MH790480 | MK835894 | MK835926 | MN887642 | MN887716 | MK835951 |
A. discovery sp. nov. |
|
OP225330* | OP244686* | OP225393* | – | – | – |
A. duboisi | MZUTI 62 | KT944041 | – | KT944059 | – | – | – |
A. dunni | MZUTI 2189 | KY610048 | – | KY610096 | – | – | – |
A. dunni | MZUTI 3031 | KY610049 | – | KY610097 | – | – | – |
A. dunni | MZUTI 4318 | KY610050 | KY610074 | KY610098 | – | – | – |
A. dunni | MZUTI 4319 | KY610051 | KY610075 | KY610099 | – | – | – |
A. ecuadorensis | DHMECN 5105 | – | – | KY610100 | – | – | – |
A. elaps |
|
MN855378 | MK835896 | MN887692 | MK835867 | MN887717 | MK835954 |
A. esepe | MZUTI 3758 | KY610053 | KT944052 | KY610102 | – | – | – |
A. esepe | MZUTI 3759 | KT944039 | KT944051 | KT944058 | – | – | – |
A. favae | MZUSP 20211 | MN855380 | MN887670 | – | – | – | – |
A. flammigerus | MNRJ 26720 | MH790488 | MK835903 | MK835932 | MK835873 | MK835994 | – |
A. gigas | MZUTI 3286 | KT944043 | KT944053 | MN891764 | – | – | – |
A. iridescens | DHMECN 9633 | KY610054 | KY610077 | – | – | – | – |
A. iridescens | MZUTI 3548 | KY610055 | KY610078 | – | – | – | – |
A. iridescens | MZUTI 3680 | KY610056 | KY610079 | – | – | – | – |
A. iridescens | MZUTI 4178 | KT944040 | KY610080 | – | MH374931 | – | – |
A. iridescens | MZUTI 4697 | KY610057 | KY610081 | – | – | – | – |
A. lasallei | MHUA 14368 | – | GQ334480 | GQ334581 | – | – | – |
A. latifrons | MPEG 22630 | MH790493 | MK835908 | MN887694 | MK835875 | – | – |
A. major | ANF 1545 | KT944045 | – | KY610104 | – | – | – |
A. major | CORBIDI 223 | MH790497 | – | – | – | – | – |
A. major | MNRJ 26126 | MH790498 | MK835911 | – | – | – | MK835958 |
A. major | MZUSP 20868 | MH790499 | – | – | – | – | – |
A. major | MZUSP 20887 | MH790500 | – | – | – | – | – |
A. major |
|
MH790506 | MK835912 | MK835934 | MN887643 | MK836002 | MN887747 |
A. major |
|
MH790507 | – | MK835935 | – | – | – |
A. major |
|
MH790508 | MK835913 | MK835936 | MK835878 | MK836003 | MK835962 |
A. major |
|
MH790509 | MK835914 | MK835937 | – | MK836004 | MK835963 |
A. major |
|
MH790504 | – | MK835933 | – | MK836000 | MK835960 |
A. major | UFACRB 532 | MH790511 | MK835915 | – | MK835879 | MK836005 | – |
A. michaelsabini sp. nov. | AMARU 002 | ON907809* | ON925018* | ON925009* | – | – | – |
A. michaelsabini sp. nov. | MZUTI 5289 | ON907810* | ON925019* | ON925010* | – | – | – |
A. michaelsabini sp. nov. | DHMECN 7644 | KY610058 | KY610082 | KY610103 | – | – | – |
A. michaelsabini sp. nov. |
|
MT507872 | – | MT511989 | – | – | – |
A. michaelsabini sp. nov. |
|
MT507874 | – | MT511990 | – | – | – |
A. michaelsabini sp. nov. |
|
MT507875 | MT511981 | MT511991 | – | – | – |
A. michaelsabini sp. nov. |
|
MT507876 | – | MT511992 | – | – | – |
A. michaelsabini sp. nov. |
|
ON907808* | ON925017* | ON925008* | – | – | – |
A. microrhynchus | MZUTI 1385 | KY610063 | KY610086 | KY610109 | – | – | – |
A. microrhynchus | MZUTI 2649 | KY610064 | KY610087 | KY610110 | – | – | – |
A. microrhynchus | MZUTI 2650 | KT944038 | KT944050 | KT944057 | – | – | – |
A. microrhynchus | MZUTI 3323 | KY610065 | KY610088 | KY610111 | – | – | – |
A. microrhynchus | MZUTI 4122 | KT944037 | KT944049 | KT944056 | – | – | – |
A. microrhynchus | MZUTI 5109 | KY610060 | KY610083 | KY610106 | – | – | – |
A. modestus | MZUTI 4760 | KY610061 | KY610084 | KY610107 | – | – | – |
A. multicinctus | MZUTI 5106 | KY610062 | KY610085 | KY610108 | – | – | – |
A. orcesi |
|
ON907807* | – | ON925007* | – | – | – |
A. orcesi |
|
ON907806* | ON925016* | ON925006* | – | – | – |
A. pachacamac |
|
MH790524 | MN887672 | MN887697 | MN887647 | MN887723 | MN887751 |
A. paucidens | MZUTI 5102 | KY610066 | ON925015* | KY610112 | – | – | – |
A. resplendens | MZUTI 3996 | KT944042 | KT944055 | KT944060 | – | – | – |
A. riveroi | MNRJ 26087 | MH790526 | MK835916 | – | – | MK836006 | MK835964 |
A. roulei | MZUTI 4503 | KY610069 | KY610090 | KY610116 | – | – | – |
A. roulei | MZUTI 4544 | KY610069 | KY610091 | KY610117 | – | – | – |
A. roulei | MZUTI 5107 | KY610068 | KY610089 | KY610115 | – | – | – |
A. roulei |
|
– | MT511980 | MT511988 | – | – | – |
A. roulei |
|
MT507871 | MT511980 | – | – | – | – |
A. roulei |
|
ON907805* | ON925014* | ON925005* | – | – | – |
A. savagei | MZUTI 4916 | KY610070 | KY610092 | KY610118 | – | – | – |
A. schach | AF 1716 | MH790527 | MK835917 | – | MK835880 | MK836007 | – |
A. snethlageae | MPEG 20605 | MH790513 | MN887678 | MN887705 | MN887655 | MN887731 | MN887759 |
A. tartarus | MPEG 23931 | MH790529 | MK835919 | MK835938 | – | MK836009 | MK835965 |
A. torquatus | MPEG 23686 | MH790532 | MK835921 | MK835941 | – | MK836012 | MK835968 |
A. touzeti |
|
ON907804* | ON925013* | ON925004* | – | – | – |
A. trefauti | MNRJ 26709 | MH790536 | MK835923 | MK835942 | MK835883 | MK836015 | MK835971 |
A. trilineatus | CAS 257740 | MK648018 | MK648027 | MK648035 | MK648043 | – | – |
A. trilineatus | UWISM 2015.18.2 | MK648014 | MK648022 | MK648031 | MK648039 | – | – |
A. typhon | MZUTI 3284 | KT944044 | KT944054 | KT944062 | – | – | – |
A. ukupacha |
|
MH790540 | MN887689 | MN887714 | MN887668 | MN887744 | MN887774 |
A. zgap sp. nov. | MZUTI 5311 | ON907803* | – | ON925003* | – | – | – |
A. zidoki |
|
AF158487 | – | – | – | – | – |
G. godmani | MVZ 233298 | JQ598877 | JQ598932 | – | – | – | – |
S. nebulatus | MVZ 233298 | EU728583 | EU728583 | EU728583 | – | – | – |
List of PCR and sequencing primers and their respective PCR conditions (denaturation, annealing, extension, and number of corresponding cycles) used in this study. All PCR protocols included an initial 3-min step at 94 °C and a final extension of 10 min at 72 °C.
Locus | Primer | Sequence (5’-3’) | Reference | PCR profile |
---|---|---|---|---|
16S | 16Sar-L | CGCCTGTTTATCAAAAACAT |
|
30 cycles of 94 °C (45 sec), 53 °C (45 sec), 72 °C (1 min) |
16Sbr-H-R | CCGGTCTGAACTCAGATCACGT | |||
Cytb | L14910 | GACCTGTGATMTGAAAACCAYCGTTGT |
|
94 °C (1 min), 58 °C (1 min), 72 °C (2 min) [x30–36] |
H16064 | CTTTGGTTTACAAGAACAATGCTTTA | |||
ND4 | ND4 | CACCTATGACTACCAAAAGCTCATGTAGAAGC |
|
94 °C (25 sec), 56 or 60 °C (1 min), 72 °C (2 min) [x25–30] |
Leu | CATTACTTTTACTTGGATTTGCACCA | |||
S78 | CCTTGGGTGTGATTTTCTCACCT |
Table S1
Data type: excel file.
Explanation note: Locality data for species included in Fig.
Figure S1
Data type: Image.
Explanation note: Phylogenetic relationships within Atractus inferred using a maximum-likelihood approach and derived from analysis of 3,985 bp of DNA (gene fragments 16S, cytb, ND4, c-mos, NT3, and RAG1). Support values on intra-specific branches are not shown for clarity. Voucher numbers for sequences are indicated for each terminal. Black dots indicate clades with bootstrap values from 90–100%. Grey dots indicate values from 70–89%. White dots indicate values from 50–69% (values < 50% not shown). Colored clades correspond to the species’ distribution presented in the map of Fig.