Research Article
Print
Research Article
Chimena gen. nov., a new spider genus (Araneae, Mysmenidae) from China, with descriptions of two new species and a new combination
expand article infoYucheng Lin‡, Shuqiang Li§
‡ Sichuan University, Chengdu, China
§ Institute of Zoology, Chinese Academy of sciences, Beijing, China

Corresponding author: Yucheng Lin ( linyucheng@scu.edu.cn )

Corresponding author: Shuqiang Li ( lisq@ioz.ac.cn )

Academic editor: Dimitar Dimitrov
© 2022 Yucheng Lin, Shuqiang Li.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Lin Y, Li S (2022) Chimena gen. nov., a new spider genus (Araneae, Mysmenidae) from China, with descriptions of two new species and a new combination. ZooKeys 1125: 69-86. https://doi.org/10.3897/zookeys.1125.85741
ZooBank: urn:lsid:zoobank.org:pub:BC000963-14DB-433C-B517-ED05918968CF
Open Access

Abstract

A new mysmenid genus, Chimena gen. nov., is reported from China. Two new species: C. qiong sp. nov. (Hainan, ♂♀, the type species) and C. nantou sp. nov. (Taiwan, ♀) are illustrated and described in detail. A new combination is suggested: Chimena taiwanica (Ono, 2007) comb. nov. (Taiwan, ♂♀, transferred from Mysmena Simon, 1894). The molecular phylogeny and morphological characters were used to discuss the taxonomy and circumscription of the newly erected genus.

Keywords

Diagnosis, Hainan, mysmenids, new genus, symphytognathoids, Taiwan, taxonomy

Introduction

The spider family Mysmenidae Petrunkevitch, 1928 includes 158 extant species in 14 genera (WSC 2022), making it the second most species-rich spider family of the symphytognathoids. Known species of Mysmenidae are recorded mainly in Asia and South America (Brescovit and Lopardo 2008; Lin and Li 2008, 2013, 2014, 2016; Miller et al. 2009; Feng et al. 2019; Li and Lin 2019; Dupérré and Tapia 2020). Lopardo et al. (2011) suggested that this family is distributed worldwide, and its diversity is grossly underestimated due to their small size and cryptic lifestyle.

In Asia, nearly 50 species of nine genera have been recorded. Simon (1895a, b) first reported three species from Sri Lanka and the Philippines. Baert (1988) described three species from Sulawesi, Indonesia. The Vietnamese mysmenids were first reported by Lin and Li (2014), and three species were recorded. Nearly 40 species from South China have been described in the past 20 years, more than half of them from Yunnan Province (Lin and Li 2008, 2013; Miller et al. 2009). However, the extraordinary species diversity of Mysmenidae in China and surrounding areas needs to be further investigated.

The aim of this paper is to expand the knowledge about the species diversity of Chinese mysmenid spiders by describing a new genus and two new species and proposing one new combination.

Materials and methods

Material

The mysmenid specimens in this study were collected in Taiwan and Hainan, China, between June 2011 and July 2013. All the specimens were collected by sifting leaf litter or by hand and stored in 95% ethanol at –20 °C.

Molecular data

We selected seven specimens from two new species and used the prosoma and all of the legs to extract genomic DNA to amplify COI, H3, 16S, 18S, and 28S. DNA was extracted with the TIANamp Micro DNA Kit (TIANGEN) following the manufacturer’s protocol for animal tissues. The five gene fragments were amplified in 25μL reactions. Primer pairs and PCR protocols are given in Table 1. Raw sequences were edited and assembled using BioEdit v.7.2.5 (Hall 1999). New sequences from this study were deposited in GenBank, and the accession numbers are reported in Table 2. All molecular vouchers and material are stored in the Natural History Museum of Sichuan University in Chengdu (NHMSU), China.

Table 1.
Download as
CSV
XLSX

The loci, primer pairs, and PCR protocols used in this study.

Locus Annealing temperature/time Direction Primer Sequence 5’→3’ Reference
16S 46.45°/30s F 16sb2_12864 CTCCGGTTTGAACTCAGATCA Hormiga et al. 2003
R LR-J-13360 GTAAGGCCTGCTCAATGA Feng et al. 2019
47°/30s F 16S-A CGCCTGTTTATCAAAAACAT Palumbi et al. 1991
R 16S-B CTCCGGTTTGAACTCAGATCA
18S 52.1°/30s F 18s_1F TACCTGGTTGATCCTGCCAGTAG Giribet et al. 1996
R 18s_1000R GTGGTGCCCTTCCGTCAATT Balczun et al. 2005
28SD2 54.9°/30s F 28sa GACCCGTCTTGAAACACGGA Rix et al. 2008
R LSUR GCTACTACCACCAAGATCTGCA
COI 48.95°/30s F LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994
R HCO2198 TAAACTTCAGGGTGACCAAAAAATCA
46°/30s F LCO1490 GGTCAACAAATCATAAAGATATTGG Simon et al. 1994
R COI-Nancy CCCGGTAAAATTAAAATATAAACTTC
H3 48°/30s F H3af ATGGCTCGTACCAAGCAGACVGC Colgan et al. 1998
R H3ar ATATCCTTRGGCATRATRGTGAC
50°/30s F H3nf ATGGCTCGTACCAAGCAGAC
R H3nr ATRTCCTTGGGCATGATTGTTAC
Table 2.
Download as
CSV
XLSX

GenBank accession numbers for newly generated DNA sequences.

Species Identifier 16S 18S 28S COI H3
Chimena taiwanica TW02 OP022513 OP022536 OP022496 OP053348 OP095882
Chimena qiong sp. nov. HN01 OP022508 OP022530 OP022484 OP021152 OP095876
HN02 OP022509 OP022531 OP022485 OP053341 OP095877
HN05 OP022510 OP022532 OP022486 OP053342 OP095878
HN08 OP022511 OP022533 OP022487 – OP095879
HN09 OP022512 OP022535 OP022495 OP053347 OP095881
HN10 – OP022534 OP022488 – OP095880
Chanea suukyii GlgMY01 OP022523 OP022541 OP022501 OP053353 OP095887
GlgMY02 OP022524 OP022542 OP022502 OP053354 OP095888
GlgMY03 OP022525 OP022543 OP022503 OP053355 OP095889
GlgMY04 OP022526 OP022544 OP022504 OP053356 OP095890
GlgMY05 OP022527 OP022545 OP022505 OP053357 OP095891
GlgMY80 OP022528 OP022546 OP022506 OP053358 OP095892
GlgMY98 OP022529 OP022547 OP022507 OP053359 OP095893
Chanea voluta XZ01 OP022516 OP022548 OP022489 OP023992 OP095896
XZ02 OP022517 OP022549 OP022490 OP053345 OP095897
XZ03 OP022518 OP022550 OP022491 OP053346 OP095898
XZ04 OP022519 OP022551 OP022492 OP038899 OP095899
Chanea sp. MS_261_MYA OP022522 OP022539 OP022499 OP053351 OP095885
Chanea sp. MS_263_MYA – OP022540 OP022500 OP053352 OP095886
Chanea sp. MS_250_INN OP022520 OP022537 OP022497 OP053349 OP095883
Chanea sp. MS_251_INN OP022521 OP022538 OP022498 OP053350 OP095884
Chanea sp. INNE02 OP022514 OP022552 OP022493 OP053343 OP095894
Chanea sp. INNE03 OP022515 OP022553 OP022494 OP053344 OP095895

We analysed data from 50 species of symphytognathoids including members of the families Theridiosomatidae Simon, 1881, Mysmenidae, Anapidae Simon, 1895, and Symphytognathidae Hickman, 1931. We used the MAFFT v.7.450 online server (https://mafft.cbrc.jp/alignment/server/) with default parameters to align the sequences of Chimena and Chanea species involved in this study. All sequences were concatenated in SequenceMatrix v.1.7.8 (Vaidya et al. 2011). PartitionFinder2 (Lanfear et al. 2017) was used to identify the best-fit models of molecular evolution for each locus. GTR+I+G was selected for COI, H3, 18S, and 28S, and GTR+G was selected for 16S.

We analysed the data using both maximum parsimony (MP) and Bayesian Inference (BI). The MP tree was constructed using MEGA X (Kumar et al. 2018) with TBR (Tree-Bisection-Reconnection) branch swapping and 2000 bootstrap replicates with all other parameters set to default. BI was performed using MrBayes v.3.2.7 (Ronquist et al. 2012) on the Cipres Science Gateway (Miller et al. 2010), with four Markov Chains (MCMCs) with default heating parameters for 50,000,000 generations until the average standard deviation of split frequencies was less than 0.01. The Markov chains were sampled every 1000 generations, and the first 25% of sampled trees were burn-in.

Morphological data

Specimens were examined and measured under a Leica M205 C stereomicroscope. Further details were examined using an Olympus BX51 compound microscope. Male palps and epigynes were examined and photographed after dissection. They were treated in lactic acid for several minutes, and subsequently embedded in Hoyer’s Solution before photographing. Photos were made with a Canon EOS 60D wide zoom digital camera (8.5 megapixels) mounted on the Olympus BX51 compound microscope. Images were combined using Helicon Focus v.3.10 software (Khmelik et al. 2006). All measurements are in millimetres. Leg measurements are given as follows: total length (femur, patella, tibia, metatarsus, and tarsus). Abbreviations of institutions and morphological terminology are given in Table 3. References to figures in cited papers are listed in lowercase (fig. or figs), and figures in this paper are noted with an initial capital (Fig. or Figs).

Table 3.
Download as
CSV
XLSX

List of abbreviations used in the text or figures.

Morphological terminologies
AER anterior eye row FD fertilization ducts
ALE anterior lateral eyes MN male metatarsal nodule at distal-prolaterally
AME anterior median eyes MS male metatarsal clasping spine
BH basal haematodocha PC paracymbium
CD copulatory ducts PER posterior eye row
CS cheliceral spines rooted at base PLE posterior lateral eyes
CyC cymbial conductor PME posterior median eyes
CyF cymbial fold S spermathecae
CyFs setae on cymbial fold SD spermatic duct
CyP1 process on cymbial conductor SP scape
CyP2 process on paracymbium St subtegulum
E embolus Ti palpal tibia
Institutions
FRIT Forestry Research Institute of Taipei, Taipei, China
IZCAS Institute of Zoology, Chinese Academy of Sciences, Beijing, China
NSMT Department of Zoology, National Science Museum, Tokyo, Japan
NHMSU Natural History Museum of Sichuan University, Chengdu, China

Results

Phylogenetic analysis

The topologies from both the MP and BI analyses (Figs 1, 2) showed mysmenids and theridiosomatids were highly supported as monophyletic in both analyses, although the position of theridiosomatids was not consistent between analyses. Symphytognathidae was rendered polyphyletic by three anapid species. The monophyly of Anapidae is not strongly supported and is rendered paraphyletic due to the placement of the theridiid Steatoda borealis (Hentz, 1850). In the BI tree anapids are divided into two highly supported clades that we refer to as “Anapidae 1” and “Anapidae 2” (Fig. 2), but Anapidae 2 is rendered polyphyletic by the theridiid Steatoda borealis and the linyphiid Linyphia triangularis (Clerck, 1757).

Figure 1. 

Tree topology obtained by maximum likelihood. Numbers at nodes are bootstrap values. Тhe clade of Chimena gen. nov. (yellow) + Chanea is nested within Mysmenidae (blue). Further clades are Symphytognathidae (green), Anapidae (pink) and Theridiosomatidae (orange).

Figure 2. 

Bayesian inference tree. Numbers at nodes posterior probabilities. The monophyly of Mysmenidae (blue), Theridiosomatidae (orange), and Chimena gen. nov. (yellow) are highly supported. Note the paraphyly of Anapidae (pink) and placement of Steatoda_borealis and Linyphia_triangularis within “Anapidae 2”; three anapid species (red star) are nested within Symphytognathidae (green).

Taxonomy

Mysmenidae Petrunkevitch, 1928

Chimena gen. nov.

https://zoobank.org/76A8EC9A-6199-4D97-810E-966B5C675A56

Type species

Chimena qiong sp. nov.

Etymology

The generic name is a combination of the first three letters of China and the latter half of Mysmena. The gender is feminine.

Diagnosis

Chimena gen. nov. differs from other mysmenid genera by the presence of strong spines on the chelicerae of males (as in some Chinese species of Gaoligonga Miller, Griswold & Yin, 2009 and Mysmena Miller, Griswold & Yin, 2009; see fig. 38A in Miller et al. 2009, fig. 8C in Lin and Li 2014, and figs 5E, 6A, 7E in Lin and Li 2008); a very long embolus spiralling around the bulb at least 5 times; and the spermathecae near the posterior margin of the epigyne; the copulatory ducts are highly coiled and extend anteriorly. Chimena gen. nov. is morphologically similar to Chanea Miller, Griswold & Yin, 2009 in having an extremely coiled embolus (cf. Figs 3A, 5A; figs 49A–B, 51A–B in Miller et al. 2009; figs 3A in Lin and Li 2016) and a membranous, translucent, wrinkled scape (Figs 4J, 6J, 7F; fig. 4D in Lin and Li 2016). Males can be distinguished by the presence of a cymbial process (CyP1, CyP2), which is absent in Chanea (Figs 3D, 3F, 5B, 5G vs. 49A, 49B in Miller et al. 2009 and figs 2C, 3C in Lin and Li 2016). Females differ by having the spiral rod-shaped spermathecae close to the posterior margin of the epigyne, versus globular spermathecae located anteriorly in Chanea, as well as the copulatory ducts not being entwined with the fertilization ducts [intertwined in Chanea (Figs 4I, J, 6I, J, 7E–F vs. fig. 49C in Miller et al. 2009 and fig. 4C–D in Lin and Li 2016)].

Description

Carapace pear-shaped, cephalic part distinctly raised in male; clypeus slightly concave. Ocular area black, AME black, others white; AER procurved, PER recurved or straight; ALE adjoined to AME and PLE, AMEs separated by at least its diameter; further separated in males than in females. Two or three pairs of strong spines on anterior surface of male chelicerae (Figs 4E, 6E). Labium fused to sternum. Sternum triangular, slightly plump, posteriorly truncated, light colour anteriorly and centrally. Each leg segment proximally pale yellow, distally darkish grey. Male with a mesal clasping spine and a distal, small nodule prolaterally on metatarsus I (Fig. 3C), female with weakly sclerotized spot on femur I. Abdomen dorsally rounded, surrounded by stripe of white pigmentation laterally and posteriorly. Venter black between epigastric furrow and spinnerets (Figs 4B, D, 6B, D, 7B).

Figure 3. 

Chimena qiong sp. nov., male A left palpal bulb, retrolateral B palpal bulb, prolateral C distal segments of right leg I, prolateral D cymbium, apical E cymbium, retrolateral F left palp, retrolateral G left palp, prolateral. Abbreviations: BH basal haematodocha; CyC cymbial conductor; CyF cymbial fold; CyFs setae on cymbial fold; CyP1 process on cymbial conductor; CyP2 process on paracymbium; PC paracymbium; E embolus; MN male metatarsal nodule at distal-prolaterally; MS male metatarsal clasping spine; SD spermatic duct; St subtegulum; Ti palpal tibia. Scale bars: 0.10 mm.

Figure 4. 

Chimena qiong sp. nov., male (A, B, E, F) and female (C, D, G–J) A, C habitus, dorsal B, D habitus, ventral E prosoma, front-lateral, F, G habitus, lateral H epigyne, ventral I vulva, ventral J vulva, dorsal. Abbreviations: CD copulatory ducts; CS cheliceral spines rooted at base; FD fertilization ducts; MN male metatarsal nodule at distal-prolaterally; MS male metatarsal clasping spine; S spermathecae; SP scape. Scale bars: 0.50 mm (A–D, F, G); 0.20 mm (E); 0.10 mm (H–J).

Male palp. Tibia swollen, proximally narrow and distally broad, larger number of long setae on dorsally than ventrally (Figs 3F–G, 5G–H). Cymbium translucent, encloses ventral and prolateral sides of bulb (Figs 3G, 5E, H). Paracymbium flat, wide, with a few long setae and a horn-shaped process (CyP2) distally (Figs 3D, F, 5B, D). Distal part of cymbium extends to form an apical cymbial conductor (CyC), with horn-shaped or dentoid process (CyP1) attached to lateral margin of cymbial conductor (Figs 3E, F, 5B–D, G–H). Tegulum flat, without any process or projection (Figs 3F, 5D, F). Embolus slender, filiform, elongate, encircles the bulb multiple times, end extends to apex of cymbial conductor (Figs 3F, 5E, G–H).

Figure 5. 

Chimena taiwanica (Ono, 2007) comb. nov., male A left palpal bulb, retrolateral B cymbium, apical C cymbium, dorsal-retrolateral D left palp, apical E left palp, ventral F left palp, dorsal G left palp, retrolateral H left palp, retrolateral. Abbreviations: Cy cymbium; CyC cymbial conductor; CyF cymbial fold; CyFs setae on cymbial fold; CT cymbial tooth; CyP2 process on paracymbium; PC paracymbium; E embolus; SD spermatic duct; St subtegulum; T tegulum; Ti palpal tibia. Scale bars: 0.10 mm.

Epigyne and vulva. Genital area covered with sparse setae, sclerotized spermathecae faintly visible through tegument (Figs 4H, 6H, 7D). Scape wrinkled, membranous, finger-like, short. Spermathecae rod-shaped, spiral, near epigynal posteromargin, separated from one another by about their length. Most of copulatory ducts membranous, extending anteriorly, coiled, overlapped with anterior end of spermathecae. Fertilization ducts relatively long, wide, originating at distal part of spermathecae, middle and proximal parts entwined with spermathecae, distal part thins gradually, inflexed (Figs 4I–J, 6I–J, 7E–F).

Composition

Chimena qiong sp. nov., C. taiwanica (Ono, 2007) comb. nov., and C. nantou sp. nov.

Distribution

China (Hainan, Taiwan).

Chimena qiong sp. nov.

https://zoobank.org/B9AAA398-0B07-4F88-8477-643064500729
Figs 3, 4, 8

Type material

Holotype ♂ (IZCAS) and paratypes 2♀ (IZCAS), China: Hainan Province, Limushan Township, Limushan Natural Reserve, Yinhe Protected Station, 19°12.002'N, 109°43.710'E, 591±20 m, 25.III.2012, Z. Chen leg.; paratypes 2♀ (IZCAS), China: Hainan Province, Changjiang Township, Bawangling Natural Reserve, near the Yaga Convention Centre, 19°04.828'N, 109°07.369'E, 567±20 m, 13.IV.2012, Z. Chen leg.; Paratypes 1♂ (IZCAS); China: Hainan Province, Lingshui County, Diaoluoshan Natural Reserve, 18°43.505'N, 108°52.104'E, 920 m, 18.VI.2011, Y. Zhou leg.

Etymology

The species epithet, a noun in apposition, refers to ‘qiong’, which is short for Hainan Province.

Diagnosis

Males and females are similar to Chimena taiwanica comb. nov. in having a long, coiled embolus and the configuration of the vulva, but they can be distinguished by having three pairs of cheliceral spines (two pairs in the latter) (Fig. 4E vs. Fig. 6E) and a horn-shaped process (CyP1) on the cymbial conductor (tooth-shaped in the latter) (Fig. 3E, G vs. Fig. 5C, H). The female differs from congeners by the strongly spiralled, longer spermathecae (moderately spiralled in C. taiwanica comb. nov., and shorter in C. nantou sp. nov.) (Fig. 4I, J vs. Figs 6I, J, 7E, F).

Figure 6. 

Chimena taiwanica (Ono, 2007) comb. nov., male (A, B, E, F) and female (C, D, G–J) A, C habitus, dorsal B, D habitus, ventral E prosoma, front-lateral F, G habitus, lateral H epigyne, ventral I vulva, ventral J vulva, dorsal. Abbreviations: CD copulatory ducts; CS cheliceral spines rooted at base; FD fertilization ducts; MS male metatarsal clasping spine; S spermathecae; SP scape. Scale bars: 0.50 mm (A–D, F, G); 0.20 mm (E); 0.10 mm (H–J).

Description

Male. Habitus as in Fig. 4A, B, E, F. Total length 0.63. Carapace 0.23 long, 0.24 wide. Clypeus 0.11 high. Sternum 0.20 long, 0.19 wide. Abdomen 0.45 long, 0.44 wide. Length of legs: I 0.92 (0.29, 0.13, 0.18, 0.14, 0.18); II 0.80 (0.27, 0.09, 0.17, 0.12, 0.15); III 0.60 (0.17, 0.08, 0.12, 0.11, 0.12); IV 0.73 (0.21, 0.08, 0.15, 0.14, 0.15). Carapace pale yellow, black on cephalic area, pear-shaped. Cephalic area strongly raised. AER procurved, PER straight. Mouthparts pale brown. Chelicerae bearing 3 pairs of strong spines anteriorly (Fig. 4E). Sternum subtriangular, slightly plump, pale, anterior-centrally and laterally black, posteriorly truncated. Legs pale, gradually darkening to grey at each segment distally. Patella with distodorsal seta, proximal seta on tibia. Mesal clasping spine and distal, small nodule on metatarsus I (Figs 3C, 4B). Abdominal dorsum rounded, darkish grey, with paired light speckles, white stripe laterally and posteriorly. Posterior area of epigastric furrow and spinnerets black. Colulus black, long, tongue shaped.

Palp (Fig. 3A, B, D–G): weakly sclerotized. Femur equal to 2.2× length of patella, patella approximately half of tibial width. Tibia cup-shaped, with dense, long setae dorsally. Cymbium narrow basally, wrapped around bulb ventrally and retrolaterally; distal cymbial conductor triangular, lamellar, a sub-distal tooth-shaped process (CyP1) at medial margin; paracymbium wide, earlobe shaped, bearing a few long setae and a sharp process (CyP2) distally. CyP1 almost same length as CyP2. Cymbial fold located at base of CyP1, with a few short setae (CyFs). Tegulum flat, smooth; subtegulum translucent, inner spermatic duct faintly visible. Embolus very long, filiform, tightly coiled around entire tegulum at least 10 times, distal end extending to cymbial conductor (CyC).

Female. Habitus as in Fig. 4C, D, G. Total length 0.72. Carapace 0.23 long, 0.25 wide. Clypeus 0.06 high. Sternum 0.19 long, 0.17 wide. Abdomen 0.48 long, 0.43 wide. Length of legs: I 0.90 (0.28, 0.12, 0.18, 0.15, 0.17); II 0.82 (0.25, 0.10, 0.18, 0.13, 0.15); III 0.63 (0.18, 0.09, 0.12, 0.11, 0.13); IV 0.76 (0.22, 0.09, 0.15, 0.14, 0.16). Cephalic area moderately raised, chelicerae unmodified, femur I with weak sclerotized spot; other features as in male.

Epigyne (Fig. 4H–J): genital area bears sparse setae, with central dark speckle. Scape tongue shaped, protruded, rugose, membranous. Spermathecae long, claviform, separated by about their length, base near epigynal posterior margin. Copulatory ducts membranous, translucent, distal part overlapping and convoluted at spermathecae anteriorly. Fertilization ducts long, middle and proximal parts entwined with spermathecae, distal part extends horizontally to atrium.

Distribution

China (Hainan) (Fig. 8).

Chimena taiwanica (Ono, 2007), comb. nov.

Figs 5, 6, 8

Mysmena taiwanica Ono, in Ono et al. 2006: 73, figs 8–19 (♂♀).

Type material

Holotype ♂ (FRIT) and paratypes 2♀ (NSMT), China: southern Taiwan, Kaohsiung Hsien, Shanping Work Station of Liukuei Research Center, ca 700 m, by sifting soil litter in a forest, 9.III.2005, H. Ono leg. Not examined.

Examined materials

6♂13♀ (IZCAS), China: central Taiwan, Nantou County, Ren’ai Township, Xinsheng Village, Huisun Farm, 24°05.279'N, 121°02.078'E, 788 m, 1.VII.2013, G. Zheng leg.

Diagnosis

Chimena taiwanica comb. nov. is similar to C. qiong sp. nov. in having strong, modified cheliceral spines in the males (cf. Figs 6E, 4E), a long and multi-coiled embolus (cf. Figs 5A, 3A), and in females, the similar configuration of the vulva, as in that of C. nantou sp. nov. (cf. Figs 6J, 4J, 7F). Males of C. taiwanica can be distinguished by having 2 pairs of cheliceral spines (3 pairs in C. qiong sp. nov.) (Fig. 6E vs. Fig. 4E and figs 8, 10 in Ono et al. 2006) and a tooth-shaped process (CyP1) (process horn-shaped in C. qiong) (Fig. 5C, H vs. Fig. 3E, G). The female differs from C. qiong sp. nov. by the moderately spiralled, thinner spermathecae tapered at the base (strongly spiralled, thicker and blunt at the base in C. qiong sp. nov.) (Fig. 6I, J vs. Fig. 4I, J); and from C. nantou sp. nov. by the longer spermathecae narrowed in the middle (shorter and wider at the middle in C. nantou sp. nov.) (Fig. 6I, J vs. Fig. 7E, F).

Description

Male. Habitus as in Fig. 6A, B, E, F. Total length 0.65. Carapace 0.24 long, 0.24 wide. Clypeus 0.12 high. Sternum 0.22 long, 0.20 wide. Abdomen 0.43 long, 0.43 wide. Length of legs: I 0.96 (0.30, 0.13, 0.19, 0.14, 0.20); II 0.84 (0.27, 0.11, 0.17, 0.13, 0.16); III 0.62 (0.17, 0.09, 0.12, 0.11, 0.13); IV 0.74 (0.22, 0.09, 0.15, 0.14, 0.16). Features same as in C. qiong sp. nov., except for 2 paired spines on chelicerae and darker body colouration.

Palp (Fig. 5A–H): weakly sclerotized. Femur equal to 2.4× length of patella, patella about half of tibial width. Tibia cup-shaped in prolateral view, slightly wider than long, bearing long setae with more dorsally than ventrally. Cymbium constricted basally, enwrapping bulb ventrally and retrolaterally; distal cymbial conductor (CyC) triangular, lamellar, tooth-shaped process (CyP1) at medial margin (Fig. 5G). Paracymbium long, with sharp distal process (CyP2), a few long setae (Fig. 5C, G). CyP1 smaller and shorter than CyP2. Cymbial fold at base of CyP1 (Fig. 5B), with a few short setae (CyFs). Tegulum flat, smooth, button-shaped (Fig. 5D); subtegulum translucent, spermatic duct faintly visible. Embolus very long, filiform, strongly sclerotized, tightly coiled around entire tegulum ca 8 times, distal end extended slightly beyond cymbial conductor (CyC) (Fig. 5G, H).

Female. Habitus as in Fig. 6C, D, G. Total length 0.78. Carapace 0.24 long, 0.22 wide. Clypeus 0.06 high. Sternum 0.24 long, 0.20 wide. Abdomen 0.46 long, 0.44 wide. Length of legs: I 1.00 (0.30, 0.13, 0.20, 0.15, 0.22); II 0.86 (0.27, 0.12, 0.17, 0.13, 0.18); III 0.68 (0.18, 0.09, 0.14, 0.14, 0.15); IV 0.78 (0.23, 0.10, 0.16, 0.14, 0.17). Cephalic area lower than in male, chelicerae unmodified, femur I with weak sclerotized spot; other features as in male.

Epigyne (Fig. 6H–J): vulval configuration similar to C. qiong sp. nov. Spermathecae narrow, proximally base tapering, separated by more than their length.

Distribution

China (Taiwan) (Fig. 8).

Remarks

Although the type specimens of Chimena taiwanica comb. nov. (= Mysmena taiwanica Ono, 2007) have not been examined for this study, the modified strong spines on the male chelicerae, the very long, multiply coiled embolus around the bulb, the paracymbium with two processes (CyP1, CyP2), the shape of epigyne, and the protruded scape depicted in the original illustrations (see figs 8, 10, 12–15, 18–19 in Ono et al. 2006: 74–76) leave little doubt that our identification is correct. Additionally, the specimens examined here were also collected from Taiwan, not too far from the type locality.

Chimena nantou sp. nov.

https://zoobank.org/DCD77110-6568-4DBA-9B03-8063C16EBC41
Figs 7, 8

Type material

Holotype ♀ (IZCAS), China: Taiwan, Nantou County, Ren’ai Township, Songgang Village, 24°05.222'N, 121°10.335'E, 2067 m, 2.VII.2013, G. Zheng leg.

Etymology

The new species is named after the type locality; noun in apposition.

Diagnosis

Chimena nantou sp. nov. shares a similar configuration of the vulva to C. qiong sp. nov. and C. taiwanica comb. nov., but differs from the former by the shorter spermathecae with fewer spirals (longer and with more spirals in C. qiong) (cf. Fig. 7E, F vs. Fig. 4I, J), and from the latter by the more compact spermathecae (elongated in the latter) (cf. Fig. 7E, F vs. Fig. 6I, J).

Figure 7. 

Chimena nantou sp. nov., holotype female A habitus, dorsal B habitus, ventral C habitus, lateral D epigyne, ventral E vulva, ventral F vulva, dorsal. Abbreviations: CD copulatory ducts; FD fertilization ducts; S spermathecae; SP scape. Scale bars: 0.50 mm (A–C); 0.10 mm (D–F).

Description

Female: Habitus as in Fig. 7A–C. Total length 0.75. Carapace 0.25 long, 0.23 wide. Clypeus 0.07 high. Sternum 0.24 long, 0.22 wide. Abdomen 0.45 long, 0.42 wide. Length of legs: I 0.98 (0.30, 0.13, 0.19, 0.14, 0.22); II 0.87 (0.27, 0.12, 0.17, 0.14, 0.18); III 0.66 (0.19, 0.09, 0.14, 0.14, 0.16); IV 0.80 (0.23, 0.10, 0.16, 0.15, 0.18). Somatic features as in female of C. taiwanica comb. nov.

Epigyne (Fig. 7D–F): vulval configuration similar to C. qiong sp. nov. and C. taiwanica comb. nov. Genital area bears sparse setae, without a dark speckle. Spermathecae short, tapering at distal end and proximal base, separated by ca 1.1× their length. Scape knob shaped, rugose, membranous. Copulatory ducts translucent. Most of fertilization ducts intertwined with spermathecae, distal part of fertilization ducts thin, inflected.

Male. Unknown.

Distribution

China (Taiwan) (Fig. 8).

Figure 8. 

Distribution records of three Chimena spp.: C. qiong sp. nov. (red dot), C. taiwanica (green dot) and C. nantou sp. nov. (blue dot).

Discussion

We tested the phylogenetic and taxonomic position of Chimena gen. nov. based on molecular data and unique morphological evidence. The results of our analyses indicate that Chimena gen. nov. is highly supported. However, further detailed phylogenetic analysis based on more mysmenid specimens will help better place the mysmenid species and genera.

Acknowledgements

We thank Yuri M. Marusik (Magadan, Russia) and an anonymous referee for insightful comments, and are especially grateful to Dimitar Dimitrov (Bergen, Norway), the subject editor of this manuscript, for his kind help. Danni Sherwood (UK) and Sarah Crews (San Francisco, USA) kindly checked the English of the final draft. This study was supported by the National Natural Foundation of China (NSFC-31972870, 31772410, 31750002).

References

  • Baert L (1988) The Ochyroceratidae and Mysmenidae from Sulawesi (Araneae). Indo-Malayan Zoology 5: 9–22.
  • Brescovit AD, Lopardo L (2008) The first record on the spider genus Trogloneta Simon in the southern hemisphere (Araneae, Mysmenidae), with descriptions of three new species from Brazil and remarks on the morphology. Acta Zoologica, Stockholm 89(2): 93–106. https://doi.org/10.1111/j.1463-6395.2007.00296.x
  • Dupérré N, Tapia E (2020) Megadiverse Ecuador: A review of Mysmenopsis (Araneae, Mysmenidae) of Ecuador, with the description of twenty-one new kleptoparasitic spider species. Zootaxa 4761(1): 1–81. https://doi.org/10.11646/zootaxa.4761.1.1
  • Hall TA (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. https://10.1021/bk-1999-0734.ch008
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35(6): 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B (2017) Partitionfinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34(3): 772–773. https://doi.org/10.1093/molbev/msw260
  • Lopardo L, Giribet G, Hormiga G (2011) Morphology to the rescue: Molecular data and the signal of morphological characters in combined phylogenetic analyses – a case study from mysmenid spiders (Araneae, Mysmenidae), with comments on the evolution of web architecture. Cladistics 27(3): 278–330. https://doi.org/10.1111/j.1096-0031.2010.00332.x
  • Miller JA, Griswold CE, Yin CM (2009) The symphytognathoid spiders of the Gaoligongshan, Yunnan, China (Araneae, Araneoidea): Systematics and diversity of micro-orbweavers. ZooKeys 11: 9–195. https://doi.org/10.3897/zookeys.11.160
  • Miller MA, Pfeiffer WT, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Gateway Computing Environments Workshop (GCE), 1–8. https://doi.org/10.1109/gce.2010.5676129
  • Ono H, Chang YH, Tso IM (2006) Three new spiders of the families Theridiidae and Anapidae (Araneae) from southern Taiwan. Memoirs of the National Science Museum, Tokyo 44: 71–82. https://doi.org/10.2476/asjaa.44.71
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Simon E (1895a) Etudes arachnologiques. 26e. XLI. Descriptions d’espèces et de genres nouveaux de l’ordre des Araneae. Annales de la Société Entomologique de France 64: 131–160.
  • Simon E (1895b) Histoire naturelle des araignées. Deuxième édition, tome premier. Roret, Paris, 761–1084.
  • Vaidya G, Lohman DJ, Meier R (2011) SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27(2): 171–180. https://doi.org/10.1111/j.1096-0031.2010.00329.x
  • WSC (2022) World Spider Catalog. Version 23.0. Natural History Museum Bern. [accessed April 21, 2022]
login to comment