Research Article |
|
Corresponding author: Yucheng Lin ( linyucheng@scu.edu.cn ) Corresponding author: Shuqiang Li ( lisq@ioz.ac.cn ) Academic editor: Dimitar Dimitrov
© 2022 Yucheng Lin, Shuqiang Li.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Lin Y, Li S (2022) Chimena gen. nov., a new spider genus (Araneae, Mysmenidae) from China, with descriptions of two new species and a new combination. ZooKeys 1125: 69-86. https://doi.org/10.3897/zookeys.1125.85741
|
A new mysmenid genus, Chimena gen. nov., is reported from China. Two new species: C. qiong sp. nov. (Hainan, ♂♀, the type species) and C. nantou sp. nov. (Taiwan, ♀) are illustrated and described in detail. A new combination is suggested: Chimena taiwanica (Ono, 2007) comb. nov. (Taiwan, ♂♀, transferred from Mysmena Simon, 1894). The molecular phylogeny and morphological characters were used to discuss the taxonomy and circumscription of the newly erected genus.
Diagnosis, Hainan, mysmenids, new genus, symphytognathoids, Taiwan, taxonomy
The spider family Mysmenidae Petrunkevitch, 1928 includes 158 extant species in 14 genera (
In Asia, nearly 50 species of nine genera have been recorded.
The aim of this paper is to expand the knowledge about the species diversity of Chinese mysmenid spiders by describing a new genus and two new species and proposing one new combination.
The mysmenid specimens in this study were collected in Taiwan and Hainan, China, between June 2011 and July 2013. All the specimens were collected by sifting leaf litter or by hand and stored in 95% ethanol at –20 °C.
We selected seven specimens from two new species and used the prosoma and all of the legs to extract genomic DNA to amplify COI, H3, 16S, 18S, and 28S. DNA was extracted with the TIANamp Micro DNA Kit (TIANGEN) following the manufacturer’s protocol for animal tissues. The five gene fragments were amplified in 25μL reactions. Primer pairs and PCR protocols are given in Table
| Locus | Annealing temperature/time | Direction | Primer | Sequence 5’→3’ | Reference |
|---|---|---|---|---|---|
| 16S | 46.45°/30s | F | 16sb2_12864 | CTCCGGTTTGAACTCAGATCA | Hormiga et al. 2003 |
| R | LR-J-13360 | GTAAGGCCTGCTCAATGA |
|
||
| 47°/30s | F | 16S-A | CGCCTGTTTATCAAAAACAT | Palumbi et al. 1991 | |
| R | 16S-B | CTCCGGTTTGAACTCAGATCA | |||
| 18S | 52.1°/30s | F | 18s_1F | TACCTGGTTGATCCTGCCAGTAG | Giribet et al. 1996 |
| R | 18s_1000R | GTGGTGCCCTTCCGTCAATT | Balczun et al. 2005 | ||
| 28SD2 | 54.9°/30s | F | 28sa | GACCCGTCTTGAAACACGGA | Rix et al. 2008 |
| R | LSUR | GCTACTACCACCAAGATCTGCA | |||
| COI | 48.95°/30s | F | LCO1490 | GGTCAACAAATCATAAAGATATTGG | Folmer et al. 1994 |
| R | HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA | |||
| 46°/30s | F | LCO1490 | GGTCAACAAATCATAAAGATATTGG | Simon et al. 1994 | |
| R | COI-Nancy | CCCGGTAAAATTAAAATATAAACTTC | |||
| H3 | 48°/30s | F | H3af | ATGGCTCGTACCAAGCAGACVGC | Colgan et al. 1998 |
| R | H3ar | ATATCCTTRGGCATRATRGTGAC | |||
| 50°/30s | F | H3nf | ATGGCTCGTACCAAGCAGAC | ||
| R | H3nr | ATRTCCTTGGGCATGATTGTTAC |
We analysed data from 50 species of symphytognathoids including members of the families Theridiosomatidae Simon, 1881, Mysmenidae, Anapidae Simon, 1895, and Symphytognathidae Hickman, 1931. We used the MAFFT v.7.450 online server (https://mafft.cbrc.jp/alignment/server/) with default parameters to align the sequences of Chimena and Chanea species involved in this study. All sequences were concatenated in SequenceMatrix v.1.7.8 (
We analysed the data using both maximum parsimony (MP) and Bayesian Inference (BI). The MP tree was constructed using MEGA X (
Specimens were examined and measured under a Leica M205 C stereomicroscope. Further details were examined using an Olympus BX51 compound microscope. Male palps and epigynes were examined and photographed after dissection. They were treated in lactic acid for several minutes, and subsequently embedded in Hoyer’s Solution before photographing. Photos were made with a Canon EOS 60D wide zoom digital camera (8.5 megapixels) mounted on the Olympus BX51 compound microscope. Images were combined using Helicon Focus v.3.10 software (
| Morphological terminologies | |||
|---|---|---|---|
| AER | anterior eye row | FD | fertilization ducts |
| ALE | anterior lateral eyes | MN | male metatarsal nodule at distal-prolaterally |
| AME | anterior median eyes | MS | male metatarsal clasping spine |
| BH | basal haematodocha | PC | paracymbium |
| CD | copulatory ducts | PER | posterior eye row |
| CS | cheliceral spines rooted at base | PLE | posterior lateral eyes |
| CyC | cymbial conductor | PME | posterior median eyes |
| CyF | cymbial fold | S | spermathecae |
| CyFs | setae on cymbial fold | SD | spermatic duct |
| CyP1 | process on cymbial conductor | SP | scape |
| CyP2 | process on paracymbium | St | subtegulum |
| E | embolus | Ti | palpal tibia |
| Institutions | |||
| FRIT | Forestry Research Institute of Taipei, Taipei, China | ||
|
|
Institute of Zoology, Chinese Academy of Sciences, Beijing, China | ||
|
|
Department of Zoology, National Science Museum, Tokyo, Japan | ||
|
|
Natural History Museum of Sichuan University, Chengdu, China | ||
The topologies from both the MP and BI analyses (Figs
Bayesian inference tree. Numbers at nodes posterior probabilities. The monophyly of Mysmenidae (blue), Theridiosomatidae (orange), and Chimena gen. nov. (yellow) are highly supported. Note the paraphyly of Anapidae (pink) and placement of Steatoda_borealis and Linyphia_triangularis within “Anapidae 2”; three anapid species (red star) are nested within Symphytognathidae (green).
Chimena qiong sp. nov.
The generic name is a combination of the first three letters of China and the latter half of Mysmena. The gender is feminine.
Chimena gen. nov. differs from other mysmenid genera by the presence of strong spines on the chelicerae of males (as in some Chinese species of Gaoligonga Miller, Griswold & Yin, 2009 and Mysmena Miller, Griswold & Yin, 2009; see fig. 38A in
Carapace pear-shaped, cephalic part distinctly raised in male; clypeus slightly concave. Ocular area black, AME black, others white; AER procurved, PER recurved or straight; ALE adjoined to AME and PLE, AMEs separated by at least its diameter; further separated in males than in females. Two or three pairs of strong spines on anterior surface of male chelicerae (Figs
Chimena qiong sp. nov., male A left palpal bulb, retrolateral B palpal bulb, prolateral C distal segments of right leg I, prolateral D cymbium, apical E cymbium, retrolateral F left palp, retrolateral G left palp, prolateral. Abbreviations: BH basal haematodocha; CyC cymbial conductor; CyF cymbial fold; CyFs setae on cymbial fold; CyP1 process on cymbial conductor; CyP2 process on paracymbium; PC paracymbium; E embolus; MN male metatarsal nodule at distal-prolaterally; MS male metatarsal clasping spine; SD spermatic duct; St subtegulum; Ti palpal tibia. Scale bars: 0.10 mm.
Chimena qiong sp. nov., male (A, B, E, F) and female (C, D, G–J) A, C habitus, dorsal B, D habitus, ventral E prosoma, front-lateral, F, G habitus, lateral H epigyne, ventral I vulva, ventral J vulva, dorsal. Abbreviations: CD copulatory ducts; CS cheliceral spines rooted at base; FD fertilization ducts; MN male metatarsal nodule at distal-prolaterally; MS male metatarsal clasping spine; S spermathecae; SP scape. Scale bars: 0.50 mm (A–D, F, G); 0.20 mm (E); 0.10 mm (H–J).
Male palp. Tibia swollen, proximally narrow and distally broad, larger number of long setae on dorsally than ventrally (Figs
Chimena taiwanica (Ono, 2007) comb. nov., male A left palpal bulb, retrolateral B cymbium, apical C cymbium, dorsal-retrolateral D left palp, apical E left palp, ventral F left palp, dorsal G left palp, retrolateral H left palp, retrolateral. Abbreviations: Cy cymbium; CyC cymbial conductor; CyF cymbial fold; CyFs setae on cymbial fold; CT cymbial tooth; CyP2 process on paracymbium; PC paracymbium; E embolus; SD spermatic duct; St subtegulum; T tegulum; Ti palpal tibia. Scale bars: 0.10 mm.
Epigyne and vulva. Genital area covered with sparse setae, sclerotized spermathecae faintly visible through tegument (Figs
Chimena qiong sp. nov., C. taiwanica (Ono, 2007) comb. nov., and C. nantou sp. nov.
China (Hainan, Taiwan).
Holotype
♂ (
The species epithet, a noun in apposition, refers to ‘qiong’, which is short for Hainan Province.
Males and females are similar to Chimena taiwanica comb. nov. in having a long, coiled embolus and the configuration of the vulva, but they can be distinguished by having three pairs of cheliceral spines (two pairs in the latter) (Fig.
Chimena taiwanica (Ono, 2007) comb. nov., male (A, B, E, F) and female (C, D, G–J) A, C habitus, dorsal B, D habitus, ventral E prosoma, front-lateral F, G habitus, lateral H epigyne, ventral I vulva, ventral J vulva, dorsal. Abbreviations: CD copulatory ducts; CS cheliceral spines rooted at base; FD fertilization ducts; MS male metatarsal clasping spine; S spermathecae; SP scape. Scale bars: 0.50 mm (A–D, F, G); 0.20 mm (E); 0.10 mm (H–J).
Male. Habitus as in Fig.
Palp
(Fig.
Female. Habitus as in Fig.
Epigyne
(Fig.
China (Hainan) (Fig.
Mysmena taiwanica
Ono, in
Holotype
♂ (FRIT) and paratypes 2♀ (
6♂13♀ (
Chimena taiwanica comb. nov. is similar to C. qiong sp. nov. in having strong, modified cheliceral spines in the males (cf. Figs
Male. Habitus as in Fig.
Palp
(Fig.
Female. Habitus as in Fig.
Epigyne
(Fig.
China (Taiwan) (Fig.
Although the type specimens of Chimena taiwanica comb. nov. (= Mysmena taiwanica Ono, 2007) have not been examined for this study, the modified strong spines on the male chelicerae, the very long, multiply coiled embolus around the bulb, the paracymbium with two processes (CyP1, CyP2), the shape of epigyne, and the protruded scape depicted in the original illustrations (see figs 8, 10, 12–15, 18–19 in
Holotype
♀ (
The new species is named after the type locality; noun in apposition.
Chimena nantou sp. nov. shares a similar configuration of the vulva to C. qiong sp. nov. and C. taiwanica comb. nov., but differs from the former by the shorter spermathecae with fewer spirals (longer and with more spirals in C. qiong) (cf. Fig.
Female: Habitus as in Fig.
Epigyne
(Fig.
Male. Unknown.
We tested the phylogenetic and taxonomic position of Chimena gen. nov. based on molecular data and unique morphological evidence. The results of our analyses indicate that Chimena gen. nov. is highly supported. However, further detailed phylogenetic analysis based on more mysmenid specimens will help better place the mysmenid species and genera.
We thank Yuri M. Marusik (Magadan, Russia) and an anonymous referee for insightful comments, and are especially grateful to Dimitar Dimitrov (Bergen, Norway), the subject editor of this manuscript, for his kind help. Danni Sherwood (UK) and Sarah Crews (San Francisco, USA) kindly checked the English of the final draft. This study was supported by the National Natural Foundation of China (NSFC-31972870, 31772410, 31750002).