Research Article |
Corresponding author: Eijiroh Nishi ( nishi-eijiroh-nr@ynu.ac.jp ) Academic editor: Greg Rouse
© 2022 Eijiroh Nishi, Hirokazu Abe, Katsuhiko Tanaka, Naoto Jimi, Elena K. Kupriyanova.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Nishi E, Abe H, Tanaka K, Jimi N, Kupriyanova EK (2022) A new species of the Spirobranchus kraussii complex, S. akitsushima (Annelida, Polychaeta, Serpulidae), from the rocky intertidal zone of Japan. ZooKeys 1100: 1-28. https://doi.org/10.3897/zookeys.1100.79569
|
A new species of Spirobranchus (Annelida: Serpulidae) is described based on specimens collected at the coastal Shonan area of Sagami Bay and the adjacent areas of Honshu, Japan. Spirobranchus akitsushima sp. nov. forms large aggregations in the intertidal rocky zone of warm-temperate Japanese shores. This species was referred to as Pomatoleios kraussii (Baird, 1864) until the monotypic genus Pomatoleios was synonymized with Spirobranchus. This new species is formally described based on morphologically distinct Japanese specimens with supporting DNA sequence data. The calcareous opercular endplate of Spirobranchus akitsushima sp. nov. lacks a distinct talon, but some specimens have a slight rounded swelling on the endplate underside, while in other species of the S. kraussii complex a talon is present, usually extended, and with bulges. We examined sub-fossil tube aggregations of the new species and suggest that such aggregation stranded ashore is a good indicator of vertical land movements (uplift and subsidence) resulting from past events, such as earthquakes, in Honshu, Japan.
Cosmopolitan species, paleo-aggregation, sea level indicator
The family Serpulidae Rafinesque, 1815 is a unique and distinct group of marine annelids that inhabits self-secreted calcareous tubes and is recorded in all habitats of the world oceans, from the intertidal zone, shallow-water coral reefs to abyssal and hadal depths, as well as in brackish and freshwater habitats. Currently, the family comprises 562 valid species in 69 genera (
Approximately 70 serpulid species have been recorded in Japanese waters (
Another well-known species of Spirobranchus is distributed in temperate to sub-tropical Japanese coastal areas from Honshu to Kyushu, and in the vicinity of the Nansei Archipelago. This species is known in Japan under the common name “Yakko-kanzashi Gokai” because the ventral side of its opercular peduncle has two dark lateral bands on a white background, which makes it look like “Yakko”: this Japanese word describes a unique hairstyle (or a person with such a hairstyle) with a shaved top of the head and hair around the ears cut in the shape of a plectrum (pick) used for Samisen, a traditional Japanese stringed instrument (
“Yakko-kanzashi” is a gregarious species commonly forming distinct intertidal belts along with barnacles and bivalves. Morphologically, the specimens of “Yakko-kanzashi” are characterized by opercula covered with simple endplates, arrangement of radioles in two semi-circles, absence of collar chaetae in adults, and tough thick-walled blue or purple tubes with sharp or flattened keels. This species has been recorded under a number of scientific names. Initially it was referred to (e.g.,
The assignment of the Japanese Spirobranchus “Yakko-kanzashi” to the morphologically similar intertidal belt-forming Spirobranchus kraussii was based on the wide distribution attributed to S. kraussii. After its original description from warm-temperate coasts of South Africa, the taxon was subsequently reported from numerous tropical and subtropical localities (Persian (Arabian) Gulf, Pakistan, Sri Lanka, Philippines, Hawaii, Australia, China (including Hong Kong), Japan, Korea, Singapore, Suez Canal, and eastern Mediterranean, see
Two specimens collected in Japan from Manazuru, Sagami Bay, Honshu and deposited in the Australian Museum (
Serpulids forming intertidal belts and relics of such assemblages are useful fixed biological indicators (FBIs) as they provide data on short-term fluctuations in sea-level (
The main aim of this study is to formally describe and name the common intertidal gregarious species of Sagami Bay and adjacent areas previously referred to as S. kraussii, using a combination of morphological and molecular data. We also examine and describe in detail paleo-aggregations (stranded ashore and rarely overlapping with the current tube aggregations) of this species.
Specimens were collected around Sagami and Suruga Bay (Fig.
Map of collection sites A Japan and adjacent seas B Sagami Bay, Suruga Bay, and Pacific side of Honshu, and collection sites on Miura Peninsula and Yokohama C collection sites of Miura Peninsula and Yokohama D Wakaejima, Kamakura, type locality of Spirobranchus akitsushima sp. nov. E Hayama F Western part of Miura Peninsula, showing Tsurugizaki and Jogashima G Jogashima H close-up view of collection sites of Jogashima I close-up view of Tsurugizaki. Key: ○: paleo-aggregation, ●(red): current distribution. Arrow in H indicates (A) in Fig.
The holotype, paratypes and additional specimens were deposited in the Natural History Museum and Institute, Chiba (
Terminology for voucher specimens used to produce molecular samples was used following
A total of 14 worms for which DNA has been sequenced (hologenophores sensu
For scanning electron microscopy (SEM) observation specimens were dehydrated through gradual series of ethanol for 10 min in each and finally washed with 100% ethanol for 10 min. The samples then were washed with 1:1 and 1.5:0.5 mixture of 100% ethanol and hexamethyldisalazane (HMDS) for 10 minutes in each, and finally washed with 100% HMDS for 10 min following
The partial sequences of the mitochondrial cytochrome b (cytb) gene, nuclear internal transcribed spacer-2 (ITS2) region, and 18S and 28S rRNA genes were used for comparisons with congeneric species. Genomic DNA was extracted from posterior abdomens of ethanol-fixed worms collected from the Shonan area (Sagami Bay) and from Omaezaki (Suruga Bay) (Table
Collection information, GenBank accession numbers of specimens used in this study and references. The type specimens of the new Japanese species are deposited in the Natural History Museum and Institute, Chiba, Japan (CBM).
Species | Locality | Accession number | Museum voucher | Reference | |||
---|---|---|---|---|---|---|---|
cytb | ITS2 | 18S | 28S | ||||
S. akitsushima sp. nov. | Kamakura, Japan | LC661622 | LC661636 | LC661650 | LC661664 | CBM-ZW 1127 (holotype) | This study |
Kamakura, Japan | LC661623 | LC661637 | LC661651 | LC661665 | CBM-ZW 1128 | This study | |
Kamakura, Japan | LC661624 | LC661638 | LC661652 | LC661666 | CBM-ZW 1129 | This study | |
Kamakura, Japan | LC661625 | LC661639 | LC661653 | LC661667 | CBM-ZW 1130 | This study | |
Kamakura, Japan | LC661626 | LC661640 | LC661654 | LC661668 | CBM-ZW 1131 | This study | |
Omaezaki, Japan | LC661627 | LC661641 | LC661655 | LC661669 | CBM-ZW 1132 | This study | |
Omaezaki, Japan | LC661628 | LC661642 | LC661656 | LC661670 | CBM-ZW 1133 | This study | |
Omaezaki, Japan | LC661629 | LC661643 | LC661657 | LC661671 | CBM-ZW 1134 | This study | |
Kamakura, Japan | LC661630 | LC661644 | LC661658 | - | CBM-ZW 1135 | This study | |
Kamakura, Japan | LC661631 | LC661645 | LC661659 | - | CBM-ZW 1136 | This study | |
Kamakura, Japan | LC661632 | LC661646 | LC661660 | - | CBM-ZW 1137 | This study | |
Kamakura, Japan | LC661633 | LC661647 | LC661661 | - | CBM-ZW 1138 | This study | |
Kamakura, Japan | LC661634 | LC661648 | LC661662 | - | CBM-ZW 1139 | This study | |
Kamakura, Japan | LC661635 | LC661649 | LC661663 | - | CBM-ZW 1140 | This study | |
Manazuru, Japan | MK308653 | - | MK308668 | - |
|
|
|
Manazuru, Japan | MK308654 | - | MK308669 | - |
|
|
|
Shirahama, Japan | LC604687 | LC604683 | - | - | - |
|
|
Shirahama, Japan | LC604688 | LC604684 | - | - | - |
|
|
S. aloni | Israel | MF319301 | MF319230 | MF319276 | - | VR.25186 |
|
S. bakau | Singapore | MW767145 | - | MW767153 | - | ZRC.ANN.0480 |
|
S. cariniferus | New Zealand | JX144878 | - | JX144817 | - | - |
|
New Zealand | MK775646 | - | MK775626 | MK775605 | - |
|
|
S. corniculatus | Israel | MF319311 | MF319244 | MF319281 | - | VR.25242 |
|
Philippines | KP892811 | KP892792 | KP892778 | - | - |
|
|
Qld, Australia | KP892795 | KP892782 | KP892774 | - | - |
|
|
Qld Australia | - | - | EU19538 | EU195366 | SAM E3608 |
|
|
S. gardineri | Israel | MF319337 | MF319262 | MF319297 | - | VR.25314 |
|
S. giganteus | Brazil | NC032055 | - | - | - | - |
|
S. kraussii | South Africa | MK308650 | - | MK308665 | - |
|
|
S. lamarcki | France | - | - | DQ140404 | EU195354 | ZMA V.Pol.5241 |
|
S. latiscapus | New Zealand | JX144879 | - | JX144821 | - | - |
|
S. lima | France | - | DQ317130 | EU256547 | SAM E3538 |
|
|
S. sinuspersicus | Iran | MN372436 | - | MN372443 | - | ZUTC.6808 |
|
S. taeniatus | SA, Australia | - | - | DQ317120 | EU195353 | SAM E3532 |
|
S. tetraceros | NSW, Australia | MN631161 | - | - |
|
|
|
S. cf. tetraceros | Israel (Red Sea) | MF319335 | MF319257 | MF319295 | - | VR.25311 |
|
Spain (Mediterranean) | MN631163 | - | - | - | MUVHN-ZK0002 |
|
|
S. triqueter | Sweden | - | DQ317121 | EU195348 | SAM E3534 |
|
|
S. sp. 2 | Hawaii, USA | MK308655 | - | MK308670 | - |
|
|
S. sp. 3 | Qld, Australia | MK308647 | - | MK308662 | - |
|
|
S. sp. 5 | Yagachi Island, Japan | LC604689 | LC604681 | LC604685 | - | - |
|
S. sp. 6 | Oura Bay, Japan | LC604691 | LC604679 | LC604686 | - | - |
|
Galeolaria hystrix | New Zealand | JX144861 | - | JX144799 | - | - |
|
SA, Australia | EU200441 | - | DQ314839 | EU256550 | SAM E3526 |
|
|
Galeolaria gemineoa | NSW, Australia | FJ646535 | FJ646551 | - | - | SAM E3721 |
|
The primer pairs used for PCR amplifications and sequencing are listed in Table
Gene | Primer | Direction | Sequence (5’–3’) | Usage | Reference |
---|---|---|---|---|---|
Cytb | cytb-spiroF | Forward | TATTGRGGKGCTACYGTWATTAC | PCR/Sequencing | This study |
cobr825 | Reverse | AARTAYCAYTCYGGYTTRATRTG | PCR/Sequencing |
|
|
ITS | ITS3 | Forward | GCATCGATGAAGAACGCAGC | PCR/Sequencing |
|
ITS4 | Reverse | TCCTCCGCTTATTGATATGC | PCR/Sequencing |
|
|
18S | 18S-1F | Forward | AACCTGGTTKATCCTGCCAGTAGTC | PCR/Sequencing | This study |
18S-1R654 | Reverse | CAACTACGAGCTTTTTAACTGCAAC | Sequencing | This study | |
18S-2F594 | Forward | GCGGTAATTCCAGCTCCAATAG | Sequencing | This study | |
18S-2R1233 | Reverse | GAGTTTCCCCGTGTTGAGTC | Sequencing | This study | |
18S-3F1153 | Forward | CTGAAACTTAAAGGAATTGACGGA | Sequencing | This study | |
18S-R1772 | Reverse | TCACCTACGGAAACCTTGTTACG | PCR/Sequencing |
|
|
28S | D1R | Forward | ACCCGCTGAATTTAAGCATA | PCR/Sequencing |
|
D2C | Reverse | CCTTGGTCCGTGTTTCAAGA | PCR/Sequencing |
|
Phylogenetic analyses based on concatenated gene sequences (cytb + ITS2 + 18S + 28S) and sequences of each gene/region were conducted using the sequences obtained in the present study supplemented with those sourced from DDBJ/ENA/ GenBank databases (Table
Maximum likelihood (ML) analyses performed using IQ-TREE (
Serpula gigantea Pallas, 1766.
Pomatoleios crosslandi
non Pixell, 1913. —
Pomatoleios kraussii
non Baird, 1864. —
Pomatoleios kraussii
(Baird, 1865)? [sic]. —
Pomatoleios cf. kraussii. —
Spirobranchus kraussii. —
Spirobranchus
sp. 1. —
Holotype
: Japan • Sagami Bay, Kamakura, Wakaejima Island; 35.300628°N, 139.550868°E; 4 June 2020; Nishi, E. leg.; intertidal rocky shore (Figs
Paratypes
: Japan • 4 specimens; same collection data as for holotype; GenBank: LC661623–LC661626, LC661637–LC661640, LC661651–LC661654, LC661665–LC661668;
Japan • 10 specimens; Sagami Bay, Hayama, Chojagasaki; 35.253254°N, 139.578030°E; 8 June 2020; Nishi, E. leg.; intertidal rocky shore, on vertical rocks (see Figs
Tubes
white, blue, or purple, inside and outside (Fig.
Field view of collection sites, aggregation, tubes of Spirobranchus akitsushima sp. nov. A, B Wakaejima, Kamakura C–E Hayama, Sagami Bay F, G Tsurugizaki, Miura Peninsula H–J Nojima, Yokohama. Aggregation of Yokohama found on concrete wall (I), around mean-sea level, thickness ~ 3–5 cm (H, J) K–O tubes of Kamakura population P, Q Ogasawara specimens. Scale bars: 1 mm (K, L, M, N, O, P), 2 mm (Q).
Operculum
with inversely conical to shallow ampulla, covered with calcareous endplate (Fig.
Peduncle
broad, triangular in cross-section, with simple (unbranched) distal lateral wings (Fig.
Radioles
arranged in two semicircles (Fig.
Collar and thoracic membranes. Collar trilobed, with extensive ventral lobe covering almost entire crown (Fig.
Thorax
with six thoracic uncinigerous segments, juveniles with collar chaetae and adults without. Length 2.0 mm in holotype, 1.6–2.5 in paratypes, width 1.0 mm in holotype, 0.7–1.2 in paratypes. Collar chaetae in juveniles simple limbate and with numerous hairlike processes at the base of distal limbate part (Spirobranchus chaetae). Apomatus chaetae absent. Thoracic chaetae limbate (Fig.
Abdomen
with 46 chaetigers in holotype, 34 to 60 chaetigers in paratypes. Length 3.6 mm in holotype, 3.0–4.0 mm in paratypes. Two or three achaetous segments in anteriormost abdomen (Fig.
Colour
oblique lateral stripes of alternating white and gray colors sometimes appearing in opercular peduncles of live specimens (Fig.
Aggregations of Spirobranchus akitsushima sp. nov. were common on vertical natural rocks in Hayama (Fig.
Type and non-type specimens of Spirobranchus akitsushima sp. nov. A–E, H, I Kamakura specimens F Hayama specimens B, C mature female specimen A ventral view, lateral band of peduncle (arrows) D, F, G dorsal view B, E lateral view E bilobed wing tip (arrows) F, G operculum in dorsal view, middle constriction (arrows) H, I dissected endplate H lower view, covered with a blue membrane I lateral view. Abbreviations: ac, achaetous chaetiger; ap, apron; c, collar; pd, peduncle; w, wing. Scale bars: 1 mm (A, B); 2 mm (C, D, F, G); 0.5 mm (E, H, I).
Scanning electron microscopy images of operculum (A–H) and chaetae (I–M) of Spirobranchus akitsushima sp. nov. A–D ventral view of endplate E–H lateral view. Note that some endplates are with a rounded swelling (sw), B–D. I thoracic capillary chaetae, scales are in close-up J thoracic uncini K abdominal true trumpet-shaped chaetae L abdominal uncini. Scale bars: 0.1 mm (A–H); 0.01 mm (I–L).
Both Recent and sub-fossil tube aggregations were also found in Tsurugizaki. The paleo-aggregations (P1 of Fig.
Intertidal rocky shore of Kamakura, Sagami Bay, Honshu, Japan.
The specific epithet refers to Akitsushima, another name of Japan in the Nara era, ~ 1,300 years ago, as appeared in Kojiki (The Records of Ancient Matters) and Nihon Shoki (The Chronicle of Japan).
Spirobranchus akitsushima sp. nov. is superficially similar to both S. kraussii from South Africa and S. sinuspersicus Pazoki, Rahimian, Struck, Katouzian & Kupriyanova, 2020 from the Persian Gulf.
Comparison of formally described taxa from the Spirobranchus kraussii complex. Sizes are in mm.
Characters | S. kraussii | S. sinuspersicus | S. lirianeae | S. bakau | S. manilensis | S. akitsushima sp. nov. |
---|---|---|---|---|---|---|
Total body length | 31 in adults, 9.6–11.7 in juveniles | 15 in adults, 2.5–3.5 in juveniles | 5 in adults | 3–14 in adults | 8–18 in adults | 5–12 in adults, 2–4 in juveniles |
No. of abdominal chaetigers | 70+10 | 41+6 | ~46 | 27–45 | 38–41 | 30–60 |
Achaetous abdominal segments | anterior to middle segments | anterior 1–2 segments | at least first one | anterior 1–3 segments | anterior 1–3 segments | anterior 2–3 segments |
Peduncular lateral wings | Y-shaped appearance | V-shaped appearance | ? V-shaped appearance | ? V-shaped appearance | ? V-shaped appearance | Y- or V-shaped |
Peduncular wing origin | Dorso-left of radiolar lobes | Dorso-central of radiolar lobes | Slightly left to mid-dorsal line | left to near medial line | left to near medial line | Dorso-left of radiolar lobes |
Peduncular wing tips | smooth and pointed | tapering, rarely fringed | rounded | tapering or with truncated | tapering | not fringed, rarely bilobed |
Talon of endplate | oval, with ~ 10 small protrusions | circular, with 2 or 3 small protrusions | extending into ampulla, basally ending in five rounded teeth | peg-like structure extending into ampulla, terminally bifid or trifid | extending into ampulla, with a series of tooth-like serrations along the edge | absent, no protrusions, or with a rounded swelling |
Thoracic uncini | saw-shaped | saw- and saw-to-rasp-shaped | saw-shaped | saw-to-rasp-shaped | ? | saw-shaped |
Spirobranchus lirianeae Brandão & dos Santos Brasil, 2020, another species of the S. kraussii-complex from Brazilian waters, has a concave opercular endplate and its talon is with protuberances, while abdominal uncini have 13 or 14 teeth. The subtidal solitary species inhabits tubes with a single sharp longitudinal keel. In S. akitsushima sp. nov. the tube has either a flattened projection of the tube keel (Fig.
Spirobranchus bakau Sivananthan, Shantti, Kupriyanova, Quek, Yap & Teo, 2021, recently described from mangrove roots of the Singapore intertidal zone, has very characteristic tubes with wing-like keel structures and in some cases with lateral keels (
Spirobranchus manilensis Sivananthan, Shantti, Kupriyanova, Quek, Yap & Teo, 2021 (non Pillai, 1965), originally described from Manila Bay, Philippines, has also characteristic tubes with white to pale brown color, with one to two keels; peduncle with peduncular wings ending in pointed tips; operculum with sub-triangular talon, extending downwards from endplate into tissue of opercular ampulla, with a series of tooth-like serrations along the edge (
Spirobranchus akitsushima sp. nov. has peduncles originating from the left side as in S. kraussii (
The upper surface of the endplate is flat and unadorned in all species of the S. kraussii complex, but the talon on the lower surface of the endplate appears useful for species delimitation in the complex. The endplate of the new Japanese species is characteristic as it has no talon (= lacking bulges or ornamentations), while other valid species from South Africa, Persian Gulf, Singapore, Brazil, and the Philippines have distinct talons (
In the phylogenetic analysis based on the concatenated dataset (cytb + ITS +18S +28S), the species of S. kraussii complex were recovered as a monophyletic clade with high aBayes support (≥ 0.95), but with low SH-aLRT (75.0%) and UFBoot support (62%) values (Fig.
Maximum likelihood tree of Spirobranchus species inferred from concatenated gene/region sequence (cytb + ITS2 + 18S + 28S rRNA) obtained from the present study and from DDBJ/EMBL/GenBank (Table
The intra-specific p-distance for cytb sequences of the 18 specimens of our new species was 0.0%. The inter-specific p-distance between the cytb sequences of S. kraussii-complex species used for phylogenetic reconstruction in the present study excluding the new species ranged from 14.6–6.9%, with the largest between S. sinuspersicus and S. cariniferus and the lowest between Spirobranchus spp. 2 and 3 sensu
Pairwise distances (p-distance) for cytb sequences between Spirobranchus kraussii-complex species used for phylogenetic reconstruction in this study. The p-distances between S. akitsushima sp. nov. and the other species are shown as mean values.
Spirobranchus species | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | |
---|---|---|---|---|---|---|---|---|---|---|
1 | S. akitsushima sp. nov. | |||||||||
2 |
S. sp. 6 sensu |
0.038 | ||||||||
3 |
S. sp. 5 sensu |
0.213 | 0.217 | |||||||
4 | S. bakau | 0.201 | 0.188 | 0.149 | ||||||
5 | S. kraussii | 0.221 | 0.207 | 0.226 | 0.205 | |||||
6 |
S. sp. 2 sensu |
0.205 | 0.210 | 0.235 | 0.208 | 0.189 | ||||
7 |
S. sp. 3 sensu |
0.198 | 0.207 | 0.248 | 0.234 | 0.211 | 0.146 | |||
8 |
S. cariniferus (in |
0.224 | 0.223 | 0.218 | 0.227 | 0.245 | 0.261 | 0.267 | ||
9 |
S. cariniferus (in |
0.226 | 0.228 | 0.225 | 0.242 | 0.252 | 0.258 | 0.255 | 0.018 | |
10 | S. sinuspersicus | 0.237 | 0.248 | 0.248 | 0.260 | 0.254 | 0.251 | 0.257 | 0.263 | 0.269 |
Maximum Likelihood tree of Spirobranchus species inferred from mitochondrial cytb (A), nuclear ITS2 (B), 18S (C), and 28S rRNA (D) gene/region sequences obtained from the present study and from DDBJ/EMBL/GenBank (Table
In addition to Spirobranchus kraussii and S. cariniferus, five new species, one from Arabian (Persian) Gulf, one from Brazil, two from South Asia, and the last one from Japan, identifiable mainly by the opercular characters, were recently formally described and named in the Spirobranchus kraussii complex (e.g.,
Live aggregations of Spirobranchus akitsushima sp. nov. are common on the shorelines of Sagami Bay and Miura Peninsula, while sub-fossil tube aggregations have also been recorded in Jogashima and Tsurugizaki along Miura Peninsula. The blue- or purple-colored subfossil tubes with prominent characteristic keels and lateral transversal ridges were well preserved (Fig.
Fouling serpulids forming aggregations on artificial substrates are commonly reported as introduced or cryptogenic species (possible introductions) (see
Our molecular phylogenetic analysis using four molecular markers (cytb, ITS2, 18S, and 28S rDNA) has led us to distinguish species among morphologically very similar taxa of S. kraussii complex in Japan. The present study showed that the specimens from Manazuru as mentioned by
The status of Spirobranchus sp. 6 sensu
Future genetic studies of these Japanese and other Asian populations (e.g.,
We are grateful to Dr. G. Kobayashi for his unpublished observations and sequence data, and for samples from Seto. We thank the staff of the Instrumental Analyses Center of Yokohama National University for the use of scanning electron microscope. We thank R. Bastida-Zavala and an anonymous reviewer for their useful suggestions and corrections. This study was partly supported by the grant (JPMEERF20204R01) from the Environment Research and Technology Development Fund of the Environmental Restoration and Conservation Agency of Japan to HA, and the Australian Biological Resources Study (ABRS) grant RG18-21 to EK.