Research Article |
Corresponding author: Milana Mitrović ( milanadesancic@yahoo.co.uk ) Academic editor: Kees van Achterberg
© 2019 Milana Mitrović, Petr Starý, Miljana Jakovljević, Andjeljko Petrović, Vladimir Žikić, Nicolás Pérez Hidalgo, Željko Tomanović.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Mitrović M, Starý P, Jakovljević M, Petrović A, Žikić V, Pérez Hidalgo N, Tomanović Ž (2019) Integrative taxonomy of root aphid parasitoids from the genus Paralipsis (Hymenoptera, Braconidae, Aphidiinae) with description of new species. ZooKeys 831: 49-69. https://doi.org/10.3897/zookeys.831.31808
|
Species from the genus Paralipsis are obligatory endoparasitoids of root aphids in the Palaearctic. It is known that these species are broadly distributed, parasitizing various aphid hosts and showing great biological and ecological diversity. On the other hand, this group of endoparasitoids is understudied and was thought to be represented by a single species in Europe, viz., Paralipsis enervis (Nees). However, recent description of two new species indicated the possibility of cryptic speciation and recognition of additional Paralipsis species in Europe. In this research, Paralipsis specimens collected during the last 60 years from eight European countries, as well as one sample from Morocco, were subjected to molecular and morphological characterization. Newly designed genus-specific degenerative primers successfully targeted short overlapping fragments of COI of the mitochondrial DNA. Molecular analyses showed clear separation of four independent lineages, two of which are the known species P. enervis and P. tibiator, while two new species are described here, viz., P. brachycaudi Tomanović & Starý, sp. n. and P. rugosa Tomanović & Starý, sp. n. No clear specialization of the taxa to a strict root aphid host has been determined. The recognized mitochondrial lineages were distinct one from another, but with a substantial within-lineage divergence rate, clearly indicating the complexity of this group of parasitoids, on which further research is required in order to clarify the factors triggering their genetic differentiation. We reviewed literature data and new records of Paralipsis enervis aphid host associations and distributions. A key for the identification of all known Paralipsis species is provided and illustrated.
Cryptic speciation, molecular phylogeny, Paralipsis, Paralipsis brachycaudi sp. n., Paralipsis rugosa sp. n.
Parasitoid wasps from the subfamily Aphidiinae (Hymenoptera, Braconidae) attack various aphid phylogenetic lineages, exhibiting several specialized associations with their hosts (
Bearing in mind it was thought that the genus Paralipsis was represented by a single species in Europe, until additional two species were newly described recently, we started this research to address the possibility of cryptic speciation and recognition of additional Paralipsis species in Europe. Since rarely encountered, there is almost a complete lack of knowledge about morphology and reliable characters for diagnostics of these root aphid parasitoids.
A set of wasps collected during the last 60 years from eight European countries and Morocco were initially subjected to morphological characterization. In addition, DNA was extracted from available Paralipsis specimens to perform the amplification and sequencing of the mitochondrial DNA barcoding region of cytochrome c oxidase subunit I (COI). We developed DNA amplification protocol and designed new internal genus-specific degenerative primers in order to retrieve short overlapping COI fragments for molecular characterization of the wasps. Subsequently, we used an integrative approach analyzing the morphological and molecular results to recognize phylogenetic lineages and cryptic species within the analyzed Paralipsis specimens. Two new species in Europe were described. In addition, we reviewed the host aphids and distribution of associations for Paralipsis enervis. A new determination key including all previously known and two newly described species is provided and illustrated.
We were provided with Paralipsis specimens collected during the last 60 years from eight European countries (Czech Republic, France, Germany, Lithuania, Moldova, Serbia, Slovakia, and Spain), in addition to one non-European sample from Morocco (Figure
The list of available Paralipsis specimens subjected to molecular analyses.
Code* | Aphid host | Plant | Sampling year /age of sample at the time of DNA extraction | Sampling locality, collector | Country |
---|---|---|---|---|---|
Pr1Rd* | Forda sp. | Dactylis glomerata L. | 2016 / 2 | Niš, Sićevačka klisura, lgt. V Žikić | Serbia |
PA1 | Anoecia sp. | Agropyrum sp. | 1960 / 58 | Hořenec, BM 60/706, lgt. P Starý | Czech Republic |
PA2 | Anuraphis farfarae (Koch) | Tussilago farfara L. | 1969 / 49 | Leverkusen, Rheinland, lgt. M Boness | Germany |
PA3 | Brachycaudus ballotae (Passerini) | Ballota nigra L. | 1960 / 58 | Praha, lgt. J Holman | Czech Republic |
PA4 | Anuraphis farfarae | Tussilago farfara | 1974 / 44 | Stankovany, Choc pohorie, lgt. P Starý | Slovakia |
PA5 | Dysaphis crataegi (Kaltenbach) | Daucus carota L. | 1959 / 59 | Praha, lgt. Pintera | Czech Republic |
PA6 | Forda marginata Koch | Agropyron repens L. | No data | Erlangen, Nordbayern, lgt. H Zwolfer | Germany |
PA7 | Aphis lambersi (Börner) | Daucus carota L. | 1974 / 44 | Stankovany, Choc pohorie, lgt. P Starý | Slovakia |
PA8 | Aphis sp. | Potentilla anserina (L.) | 1963 / 55 | Sušice, B m, lgt. J Holman | Czech Republic |
PA9 | Unknown | Pastinaca sativa L. | 1959 / 59 | Jičín, Bor, lgt. J Holman | Czech Republic |
PA10 | Forda formicaria von Heyden | Poa pratensis L. | No data | Erlangen, Nordbayern, lgt. H Zwolfer | Germany |
PA11 | Brachycaudus mordvilkoi Hille Ris Lambers | Echium vulgare L. | No data | Čejč, Mm, lgt. J Holman | Czech Republic |
PA12 | Unknown | Unknown | 1960 / 58 | Kisinev, lgt. Adaškevič | Moldova |
PA13 | Tetraneura ulmi (L.) | Avena sativa L. | No data | Erlangen, Nordbayern, lgt. H Zwolfer | Germany |
PA14 | Dysaphis reaumuri (Mordvilko) | Ranunculus sp. | No data | Le Combe, Passy, Ht Savoie, lgt. G Remaudiere | France |
PA15 | Aphis rumicis L. | Rumex sp. | 1987 / 31 | Immezeur, lgt. Sekkar | Morocco |
PA16 | Forda marginata | Poa annua L. | No data | Molety, raj, lgt. Zickai | Lithuania |
PA17 | Forda formicaria | Poaceae | 2013 / 5 | Morales del Arcediano, Leon, lgt.N Pérez Hidalgo | Spain |
PA18 | Forda formicaria | Poaceae | 2013 / 5 | Morales del Arcediano, Leon, lgt. N Pérez Hidalgo | Spain |
PA19 | Forda formicaria | Poaceae | 2013 / 5 | Morales del Arcediano, Leon, lgt. N Pérez Hidalgo | Spain |
PA20* | Forda formicaria | Setaria viridis L. | 1996 / 22 | Sićevačka klisura, lgt. V Žikić | Serbia |
PA21 | Forda formicaria | Bromus sterilis L. | 1998 / 20 | Petnica, lgt. Ž Tomanović | Serbia |
PA22 | Forda formicaria | Bromus sterilis | 1998 / 20 | Petnica, lgt. Ž Tomanović | Serbia |
PA23 | Forda formicaria | Bromus sterilis | 1998 / 20 | Petnica, lgt. Ž Tomanović | Serbia |
PA24 | Forda formicaria | Bromus sterilis | 1998 / 20 | Petnica, lgt. Ž Tomanović | Serbia |
PA26* | Forda formicaria | Unknown | 2015 / 3 | Madrid | Spain |
Our examination of Paralipsis specimens took into account reliable morphological characters used in aphidiinae taxonomy (number of flagellomeres, shape of flagellomere 1 and 2, number of labial and maxillary palpomeres, size and shape of fore tarsus, shape of hind tibia and femur, wing venation pattern, pterostigma shape, ratio between the pterostigma and radial vein 1, petiole shape, propodeal areolation, and ovipositor shape) (
The barcoding region of the mitochondrial cytochrome oxidase c subunit I gene (COI) was chosen for phylogenetic study as a proven informative marker in species delineation for numerous aphidiines (
DNA extraction was conducted using a commercial DNeasy Blood and Tissue Kit (Qiagen Inc., Valencia, California, USA) following the manufacturer’s instructions. Initially, we attempted to amplify the barcoding region of the COI gene from dry material using the standard primer pair LCO1490/HCO2198 (
Since the standard primer pair failed to successfully amplify the barcoding region in more than three specimens, the next step was to test the suitability of the internal degenerative primers designed by
The list of primers used for retrieval of COI sequences from dry Paralipsis specimens.
primer name | 5 ’ 3’ primer sequence | primer direction | Reference |
LCO1490 | GGTCAACAAATCATAAAGATATTGG | Forward |
|
HCO2198 | TAAACTTCAGGCTGACCAAAAAATCA | Reverse | |
Aph2Fd | ATAATTGGWGGATTTGGWAATTG | Forward |
|
Lys1Rd | GAGGAAAAGCYATATCWGGAG | Reverse | |
Lys2Rd | GTWCTAATAAAATTAATTGCHCC | Reverse | |
Lys3Fd | CATTTAGCWGGDATTTCWTC | Forward | |
Pr3Fd | CATTTRGCTGGWATTTCYTC | Forward | |
PeF1 | ATRATTGGWGGRTTTGGWAATTG | Forward | Paralipsis-specific newly designed primers |
PeF2 | GCTCCWGATATAGCTTTTCCTC | Forward | |
PeF3 | TTCTGGWGCTGGTACTGGWTG | Forward | |
PeR1 | CAWCCAGTACCAGCWCCAGAA | Reverse | |
PeF4 | GGTCATAGAGGTATATCTGTTG | Forward | |
PeR2 | CAACAGATATACCTCTATGACC | Reverse | |
PeF5 | RGCTGGWATTTCWTCTATTATGGG | Forward | |
PeR3 | CCCATAATAGAWGAAATWCCAGCY | Reverse | |
PeF6 | CCAGTTTTAGCTGGRGCTATTAC | Forward | |
PeR4 | GTAATAGCYCCAGCTAAAACTGG | Reverse | |
PeF7 | GATCGAAATTTRAATACTAC | Forward | |
PeR5 | GTAGTATTYAAATTTCGATC | Reverse | |
PeR6 | GGATCCCCMCCACCWACAAAATC | Reverse | |
PeR7 | GCTGACCAAAAAATCAAAATAAATGTTG | Reverse |
Products of PCR were obtained in 40 μl following the protocol described by
Maximum likelihood (ML) and maximum parsimony (MP) trees were constructed using the MEGA5 software, with 500 bootstrap replicates performed to assess the branch support (
Barcoding fragments of COI were successfully recovered from 18 specimens. The material subjected to molecular analyses was of different ages in terms of the time passing between sampling until DNA extraction; several of the oldest had been preserved in collections for nearly 60 years. This probably caused DNA disintegration, which resulted in failed attempts to recover the barcoding region with the LCO1490/HCO2198 standard primer pair. The newly designed Paralipsis-specific primers made it possible through diverse combinations to retrieve short subsequences of different length and position from disintegrated DNA of archival specimens. Prior to molecular analyses, all the barcoding sequences were aligned and trimmed to the same length of 568 bp. Comparison of COI barcodes identified 14 haplotypes (PH1-PH14) distinguished by a total of 83 variable sites, of which 51 were parsimony-informative (Table
Phylogenetic relationship inferred using the maximum parsimony (MP) method. The consistency index is (0.533333), the retention index is (0.681818), and the composite index is 0.476540 (0.363636) for all sites and parsimony-informative sites. The MP tree was obtained using the subtree-pruning-regrafting (SPR) algorithm with search level 1, in which the initial trees were obtained by the random addition of sequences (10 replicates). The percentage of replicate trees in which >50% of the associated taxa clustered together in the bootstrap test (500 replicates) is shown next to the branches (in red color). Since the topology is identical, the bootstrap support of branches obtained by the maximum likelihood method is presented in black color as well. Barcoding haplotypes of the analyzed archival Paralipsis specimens are designated with codes from PH1 to PH14, species name, host aphid and host plant. Abbreviations for the countries of origin are as follows: GER – Germany; FRA – France; SRB – Serbia; LIT – Lithuania; CR – Czech Republic; MOL – Moldova; MOR – Morocco; and ESP – Spain.
The list of identified barcoding COI haplotypes in the analyzed Paralipsis specimens.
Haplotype | Specimens sharing the haplotype | Accession number of haplotype in GenBank |
PH1 | Pr1 | MH475319 |
PH2 | PA2 | MH475320 |
PH3 | PA3 | MH475321 |
PH4 | PA6 | MH475322 |
PH5 | PA9 | MH475323 |
PH6 | PA11 | MH475324 |
PH7 | PA12 | MH475325 |
PH8 | PA13 | MH475326 |
PH9 | PA4 | MH475327 |
PH10 | PA15 | MH475328 |
PH11 | PA16 | MH475329 |
PH12 | PA17, PA18, PA19 | MH475330 |
PH13 | PA21, PA23, PA24 | MH475331 |
PH14 | PA26 | MH475332 |
Phylogenetic analysis showed molecular differentiation on the basis of COI barcoding fragments, with recognition of four distinct lineages. The first group includes seven haplotypes: PH1, PH2, PH4, PH5, PH9, PH11, and PH13, which morphologically correspond to the first known species in this genus and in Europe, P. enervis. The specimens were sampled from different aphid hosts (Forda, Aphis, Anuraphis, Dysaphis) in association with different plants originating from Serbia, Germany, France, Lithuania, and the Czech Republic. The average overall divergence rate between the haplotypes within this group was 1%, with distances ranging from 0.4 to 2.5% (Table
The second lineage, a “Mediterranean” clade, includes haplotypes PH12 and PH14 from Spain, and haplotype PH10 from Morocco. The overall divergence rate within this group was 2.8%. Genetic distances show that the haplotype PH12 associated with Forda formicaria is intermediary, diverging from the haplotype PH10 from Aphis rumicis (2.4%) and from the haplotype PH14 associated with Forda formicaria (2%), while the genetic distance between the other two was 4% (Table
The third distinct lineage on the phylogenetic tree consists solely of the haplotype PH7, with unknown host data. The single specimen available from Moldova is characterized by having a very rugose and irregularly carinated propodeum. It is described as the new species P. rugosa sp. n., clearly separated genetically, with average distance from the first, second, and fourth lineage of 7.3, 7.7, and 9.6%, respectively.
Three haplotypes (PH3, PH6, and PH8) originating from Brachycaudus sp. and Tetraneura ulmi aphid hosts from Central Europe (Czech Republic and Germany) are grouped within the fourth distinct lineage. The barcoding haplotypes differ in the range of 1.8 to 3.6%, with an average overall interlineage divergence rate of 2.8% (Table
Genetic distances between the COI barcoding haplotypes of Paralipsis calculated using the Tamura-Nei method.
Group | Haplotype | Tamura-Nei evolutionary distances | ||||||||||||
1 | PH1 | |||||||||||||
PH2 | 0.009 | |||||||||||||
PH4 | 0.004 | 0.013 | ||||||||||||
PH5 | 0.016 | 0.025 | 0.016 | |||||||||||
PH9 | 0.005 | 0.011 | 0.009 | 0.022 | ||||||||||
PH11 | 0.005 | 0.014 | 0.005 | 0.011 | 0.011 | |||||||||
PH13 | 0.004 | 0.013 | 0.007 | 0.016 | 0.009 | 0.005 | ||||||||
2 | PH10 | 0.044 | 0.046 | 0.044 | 0.036 | 0.050 | 0.042 | 0.048 | ||||||
PH12 | 0.050 | 0.056 | 0.050 | 0.037 | 0.056 | 0.048 | 0.054 | 0.024 | ||||||
PH14 | 0.063 | 0.070 | 0.059 | 0.050 | 0.069 | 0.061 | 0.067 | 0.040 | 0.020 | |||||
3 | PH7 | 0.071 | 0.073 | 0.071 | 0.073 | 0.077 | 0.069 | 0.075 | 0.063 | 0.077 | 0.091 | |||
4 | PH3 | 0.048 | 0.046 | 0.048 | 0.051 | 0.050 | 0.046 | 0.048 | 0.074 | 0.084 | 0.098 | 0.095 | ||
PH6 | 0.068 | 0.066 | 0.068 | 0.076 | 0.069 | 0.070 | 0.072 | 0.070 | 0.063 | 0.081 | 0.093 | 0.029 | ||
PH8 | 0.056 | 0.062 | 0.056 | 0.066 | 0.058 | 0.062 | 0.060 | 0.070 | 0.061 | 0.075 | 0.100 | 0.036 | 0.018 |
The median-joining network recognized the same four distinct groups of mitochondrial haplotypes with a confidence limit of 95%: group 1 (P. enervis) – haplotypes PH1, PH2, PH4, PH5, PH9, PH11, and PH13; group 2 (P. tibiator) – haplotypes PH10, PH12, and PH14; group 3 (P. rugosa sp. n.) – the single haplotype PH7 from Moldova; and group 4 (P. brachycaudi sp. n.) - haplotypes PH3, PH6, and PH8 (Figure
Median-joining network obtained for 14 Paralipsis COI barcoding haplotypes. Green circles represent group 1 (P. enervis), with haplotypes PH1, PH2, PH4, PH5, PH9, PH11, and PH13; yellow circles represent group 2 (P. tibiator), with haplotypes PH10, PH12, and PH14; the black circle represents the single haplotype PH7 from Moldova within group 3 (P. rugosa sp. n.); blue circles represent group 4 (P. brachycaudi sp. n.), consisting of haplotypes PH3, PH6, and PH8. Circle size reflects the number of individuals with that haplotype (not to scale). Red dots are median vectors. Black dots are mutational steps.
The presented review includes evidence obtained for the most part from consulted published references about the species. The material was often re-visited, which was possible due to its preservation in available collections (IECR and FBS). The review also includes some new supplementary records (*).
Eriosomatinae
Pemphigini:
Pemphigus sp.: Czech Republic (
Eriosomatini:
Tetraneura ulmi (L.): Czech Republic (
Fordini:
Forda formicaria von Heyden: England (
Forda marginata Koch: Lithuania - Molety, distr. Žičkai, 1-VIII-2012, on Poa annua roots, sample 12HAO4563 I male (J Havelka)
*Spain (Arcos de las Salinas, Teruel, 24/05/2017).
Geoica utricularia (Passerini): Serbia (
Anoeciinae
Anoecia corni (Fabricius): Germany (
Anoecia sp.: England (
Aphidinae
Anuraphis catonii Hille Ris Lambers: Czech Republic (
Anuraphis farfarae (Koch): Czech Republic (
Anuraphis subterranea (Walker): England (
Dysaphis crataegi (Kaltenbach): Czech Republic (
Dysaphis apiifolia petroselini (Börner): Spain (
Dysaphis reaumuri (Mordvilko): *France (La Combe, Hte. Savoie, 12.07.1989, Ranunculus sp., leg. G Remaudière).
Brachycaudus ballotae (Passerini): Czech Republic (
Brachycaudus cardui (L.): Czech Republic (
Brachycaudus jakobi Stroyan: Netherlands (
Brachycaudus mordvilkoi Hille Ris Lambers: Czech Republic (
Brachycaudus sp.: Czech Republic (
Aphis lambersi (Börner): Slovakia (
Aphis roepkei (Hille Ris Lambers): Czech Republic (
Aphis rumicis L.: *Morocco (Immouzer, 28.04.1985, leg. A Sekkat).
Protaphis terricola Rondani: Russia-Western Siberia (
This integrated review contains broad information and also allows a cross-comparison of all the known host aphid-parasitoid locations of P. enervis in the Western Palaearctic. The true distribution range of P. enervis is somewhat more extensive than that derivable from the above review, since in most of the countries the parasitoid wasp was determined from individually sampled specimens with no data on the associated host aphids. Similarly, the distribution data reflect strength of the respective field research efforts. It seems that the northern distribution limits are the Scandinavian countries. The vertical distribution also manifests some peculiarities. Paralipsis enervis was also reared from the root aphid Dysaphis reaumuri sampled in the Alps (France) at approximately 2200 meters (see the review).
On the basis of morphological examination of our available material from across Europe and the Mediterranean and using the COI mitochondrial barcoding marker, we confirmed the existence of the recently described Paralipsis species P. tibiator. In addition, two new Paralipsis species are described below.
Holotype ♀, Czech Republic, Čejč, 28.V.1963, reared from Brachycaudus mordvilkoi Hille Ris Lambers on Echium vulgare L., leg. J Holman; deposited in the IECR collection, slide mounted.
Paratypes 2♀♀, Czech Republic, Prague, 26.IX.1960, reared from Brachycaudus ballotae (Passerini) on Ballota nigra L., leg. J Holman; deposited in the FBS collection, slide mounted. Germany, Erlangen, Nordbayern, reared from Tetraneura ulmi (L.) on Avena sativa L., leg. H. Zwölfer; deposited in the IECR collection, slide mounted.
The new species morphologically resembles P. enervis in petiole shape, absence of longitudinal placodes from flagellomeres 1 (F1) and 2 (F2), and fore wing venation pattern. Paralipsis brachycaudi sp. n. differs from P. enervis in having a longer petiole (Figure
Paralipsis brachycaudi sp. n., female 6 head, anterior view 7 antennae, lateral view 8 scutellum, dorsal view 9 propodeum, dorsal view 10 second-fourth segments of fore tarsus, dorsal view 11 hind leg, lateral view 12 fore wing 13 petiole, dorsal view 14 ovipositor sheath, lateral view.
Female
: Head (Figure
Mesosoma: Mesoscutum smooth, and only moderately sculptured within small central area, usually with four rows of setae along its dorsolateral part. Mesoscutum 1.4 times as long as wide. Scutellum (Figure
Metasoma: Petiole (Figure
Length: body 1.5–2.0 mm; fore wing 1.3–1.7 mm.
Coloration: General body color light-brown to brown. Head brown with light-brown mouthparts. Scape and pedicel yellow to light-brown. Flagellomere 1 and 2 yellow, remaining parts of antennae brown. Mesosoma brown. Legs yellow to light-brown. Propodeum yellow. Metasoma brown. Petiole yellow. Ovipositor sheath dark-brown.
Male: unknown.
The name of the new species is derived from that of its aphid host.
Czech Republic, Germany.
Holotype female, Moldova, Kišinev, 26.VI.1960, unknown aphid host and host plant, leg. Adaškevič; deposited in the IECR collection, slide mounted.
The new species differs clearly from all known Paralipsis species in having a strongly rugose propodeum (Figure
Female: Head rounded, smooth, narrower than mesosoma at tegulae, bearing dense setae (Figure
Mesosoma: Mesoscutum smooth, sculptured laterally, with very dense setae laterally. Mesoscutum 1.4 times as long as wide. Scutellum subspherical, strongly rugose with about 15 setae (Figure
Metasoma: damaged.
Length: head and mesosoma combined about 1 mm; fore wing about 1.7 mm.
Coloration: General body color brown. Head brown. Mouthparts light-brown. Scape and pedicel brown with small yellow terminal part. F1 and F2 yellow, remaining parts of antennae brown. Mesosoma brown to light-brown. Legs yellow to light-brown.
Male: unknown.
The name of the new species refers to the very rugose propodeum and scutellum.
Moldova.
1 | Propodeum and scutellum with strong and deep rugosities (Figs |
P. rugosa sp. n. |
– | Propodeum and scutellum smooth or with moderate expressed rugosities (Figs |
2 |
2 | Second-fourth segments of fore tarsus distinctly longer than wide in dorsal view (Fig. |
3 |
– | Second-fourth segments of fore tarsus approximately as long as wide in dorsal view (Fig. |
4 |
3 | Mesoscutum and scutellum smooth and densely setous; flagellomere 1 distinctly longer than F2 (1.3–1.4 times as long as wide); pterostigma triangular, approx. 1.8 times as long as wide | P. tibiator |
– | Mesoscutum and scutellum moderate rugose and setous; F1 subequal to F2 (about 1.1 times as long as wide); pterostigma twice as long as wide | P. planus |
4 | Forewing 2-1A vein absent; Japan and Far East | P. eikoae |
– | Forewing 2-1A vein present, partly or completely sclerotized; Europe | 5 |
5 | Petiole 1.50-1.60 times as long as wide at spiracles level; F1 about 2.0 times as long as wide; F1 and F2 yellow | P. brachycaudi sp. n. |
– | Petiole 1.30–1.40 times as long as wide at spiracles level; flagellomere 1, 2.0–2.2 times as long as wide; basal third of F1 yellow till light brown and remaining part F1 and whole F2 brown | P. enervis |
We have demonstrated here a progress in methodology of DNA amplification by designing Paralipsis-specific degenerative primers to retrieve disintegrated DNA fragments from archived museum specimen collections of which can be considered as biobanks and used to discover new species (
It is necessary to examine in detail all known records of P. enervis in the light of the diagnosis given for the new Paralipsis species described in the present paper. Probably, P. enervis represents a complex of cryptic species, which is a common case among aphid parasitoids (
Although most of our samples originated from central and southern Europe, Paralipsis species are distributed in several European countries, including ones in the northern part of the continent (
The authors are grateful to G Remaudière (Paris, France) (deceased) and J Danilov (Lithuania) for supplying valuable material that contributed significantly to the presented research. We thank Frédérique Bakker (Collection Manager Hymenoptera, Naturalis Biodiversity Center, Leiden, The Netherlands) for loaning us the P. tibiator paratype. This study was supported by the Ministry of Education, Science, and Technological Development of the Republic of Serbia (III43001). P Starý was supported by the Institute of Entomology, Biology Centre of the Czech Academy of Sciences. The sampling of radicicolous aphids on the Iberian Peninsula was conducted in the context of Project CGL2015-68188-P, funded by “Ministerio de Economia, Industria y Competitividad” of Spain (MIMECO).