New species of bone-eating worm Osedax from the abyssal South Atlantic Ocean (Annelida, Siboglinidae)

Yoshihiro Fujiwara; Naoto Jimi; Paulo Y.G. Sumida; Masaru Kawato; Hiroshi Kitazato

doi:10.3897/zookeys.814.28869

Research Article

New species of bone-eating worm Osedax from the abyssal South Atlantic Ocean (Annelida, Siboglinidae)

Yoshihiro Fujiwara^‡, Naoto Jimi^§, Paulo Y.G. Sumida^|, Masaru Kawato^‡, Hiroshi Kitazato^¶‡

‡ Japan Agency for Marine-Earth Science and Technology, Yokosuka, Japan

§ Hokkaido University, Sapporo, Japan

| University of São Paulo, São Paulo, Brazil

¶ Tokyo University of Marine Science and Technology, Tokyo, Japan

Corresponding author: Yoshihiro Fujiwara ( fujiwara@jamstec.go.jp )

Academic editor: Greg Rouse

This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation: Fujiwara Y, Jimi N, Sumida PYG, Kawato M, Kitazato H (2019) New species of bone-eating worm Osedax from the abyssal South Atlantic Ocean (Annelida, Siboglinidae). ZooKeys 814: 53-69. https://doi.org/10.3897/zookeys.814.28869

ZooBank: urn:lsid:zoobank.org:pub:25C70410-51D8-445C-99A1-A7E158CFD507

Abstract

A new species of bone-eating annelid, Osedax braziliensis sp. n., found in a sunken whale carcass at a depth of 4,204 m at the base of the São Paulo Ridge in the South Atlantic Ocean off the Brazilian coast is described. The organism was retrieved using the human-occupied vehicle Shinkai 6500 during the QUELLE 2013 expedition. This is the 26^th species of the genus and the first discovery from the South Atlantic Ocean, representing the deepest record of Osedax worldwide to date. This species morphologically resembles Osedax frankpressi but is distinguished by the presence of a yellow bump or patch behind the prostomium and its trunk length. Molecular phylogenetic analysis using three genetic markers (COI, 16S, and 18S) showed that O. braziliensis sp. n. is distinct from all other Osedax worms reported and is a sister species of O. frankpressi.

Keywords

Polychaeta , São Paulo Ridge, taxonomy, whale-fall ecosystem

Introduction

Whale falls provide an extensive food supply to the oligotrophic deep-sea environments and harbour a unique biological assemblage, which is considered a “whale-fall ecosystem” (Smith et al. 1989, 2015). This ecosystem is known to be chemosynthesis-based, similar to hydrothermal vent and hydrocarbon seep ecosystems, but dynamic succession has been reported (Smith and Baco 2003). Numerous scavengers such as deep-sea sharks, hagfish, and small crustaceans devour the soft whale tissues when the carcasses reach the deep-sea floor (mobile-scavenger stage) (Smith and Baco 2003). After consumption of most soft tissues, organically enriched sediments and exposed bones are colonised by dense assemblages of opportunistic polychaetes and crustaceans (enrichment opportunist stage) (Smith and Baco 2003). Reducing chemicals such as sulphide are produced through anaerobic bacterial decomposition of organic materials in bones and support chemoautotrophs and chemoautotrophic symbiont-harbouring invertebrates as energy sources of primary production (sulphophilic stage) (Smith and Baco 2003). After the depletion of organic materials in the whale bones, the exhausted bones are thought to act as colonisation substrata primarily for suspension feeders (reef stage) but have never been observed in situ (Smith and Baco 2003).

One of the most unique organisms that has appeared in the whale-fall environment is an annelid polychaete of genus Osedax Rouse, Goffredi & Vrijenhoek, 2004 (Annelida, Siboglinidae), commonly known as bone-eating worms, discovered in whale carcasses in Monterey Bay (Rouse et al. 2004). Unlike other siboglinids, Osedax lack a discrete trophosome, the organ housing symbiotic bacteria in vestimentiferans and pogonophorans (Rouse et al. 2004). Instead, female Osedax possesses a vascularised “root” system penetrating the bone marrow (Rouse et al. 2004). Osedax worms are believed to acquire nutrition from the bones through their roots (Tresguerres et al. 2013, Miyamoto et al. 2017). Intracellular heterotrophic bacteria localise in the roots, but their role remains unclear (Goffredi et al. 2014). Surprisingly, all the visible worms are female, and the males are dwarfs, with the exception of one species (Rouse et al. 2015). Morphological characterisation of Osedax has been minimal thus far. The body size, palp colour, presence/absence of pinnules and their location on palps, presence/absence of oviduct and its length, and root form are examples of the limited characteristics used for species identification (Vrijenhoek et al. 2009).

To the best of our knowledge, 25 Osedax species have been described to date, and some additional undescribed species were reported from the West and East Pacific, North and South Atlantic, Mediterranean, Sub-Antarctic, and Antarctic (Rouse et al. 2004, Glover et al. 2005, Fujikura et al. 2006, Braby et al. 2007, Fujiwara et al. 2007, Goffredi et al. 2007, Rouse et al. 2008, Vrijenhoek et al. 2008, Vrijenhoek et al. 2009, Glover et al. 2013, Amon et al. 2014, Rouse et al. 2015, Taboada et al. 2015, Sumida et al. 2016, Rouse et al. 2018). Two species, i.e., Osedax rubiplumus Rouse, Goffredi & Vrijenhoek, 2004 and Osedax frankpressi Rouse, Goffredi & Vrijenhoek, 2004, were first described from the bones of a grey whale carcass at a depth of 2,891 m in Monterey Bay, California, in 2004 (Rouse et al. 2004). Osedax mucofloris Glover, Källström, Smith & Dahlgren, 2005 and Osedax japonicus Fujikura, Fujiwara & Kawato, 2006 were reported from environments with relatively shallow water at depths of 125 m in Swedish waters and 220 m near Japan, respectively (Glover et al. 2005, Fujikura et al. 2006). Osedax antarcticus Glover, Wiklund, Taboada, Avila, Cristobo, Smith, Kemp, Jamieson & Dahlgren, 2013, Osedax crouchi Amon, Wiklund, Dahlgren, Copley, Smith, Jamieson & Glover, 2014, Osedax deceptionensis Taboada, Cristobo, Avila, Wiklund & Glover, 2013, Osedax nordenskjoeldi Amon, Wiklund, Dahlgren, Copley, Smith, Jamieson & Glover, 2014, and Osedax rogersi Amon, Wiklund, Dahlgren, Copley, Smith, Jamieson & Glover, 2014 were described from the Antarctic Ocean at depths between 10 and 1,446 m (Glover et al. 2013, Amon et al. 2014, Taboada et al. 2015). Osedax roseus and Osedax priapus were reported from Monterey Bay, and the latter showed some unique morphological features, i.e., only two palps (four are typical) and no male dwarfism (Rouse et al. 2008, 2015). Recently, 14 species from Monterey Bay were simultaneously described (Rouse et al. 2018). Additionally, the genomes of several undescribed species were sequenced and deposited in the international nucleotide sequence databases.

In 2013, the Iatá-Piúna Expedition, a collaborative scientific cruise between Japan and Brazil, was conducted within the framework of the around-the-world research cruise Quelle 2013 (Quest for the Limit of Life) of Japan Agency for Marine-Earth Science and Technology (JAMSTEC) using the HOV Shinkai 6500 (Sumida et al. 2016). A sunken whale carcass was discovered at a depth of 4,204 m at the base of the São Paulo Ridge in the South Atlantic Ocean (Sumida et al. 2016). This was the first record of a natural whale fall in the deep Atlantic Ocean (Sumida et al. 2016). Forty-one benthic taxa including many new species were documented from the carcass in which galatheid crabs, Rubyspira gastropods, and polychaete annelids were dominant (Silva et al. 2015, Sumida et al. 2016, Shimabukuro et al. 2017a, 2017b). The skeleton belonged to an Atlantic minke whale (Balaenoptera bonaerensis) and was composed of nine caudal vertebrae, four of which were colonised by Osedax worms (Sumida et al. 2016, Alfaro-Lucas et al. 2017). Vertebrae not colonised by Osedax were well preserved and in a highly sulphophilic stage with chemosynthetic bacterial mats and numerous epifaunal organisms that fed on them. In contrast, vertebrae colonised by Osedax were heavily degraded and did not exhibit evidence of a sulphophilic stage, harbouring a distinct epifaunal assemblage (Alfaro-Lucas et al. 2017). A molecular phylogenetic analysis using mitochondrial COI sequences showed that the Osedax species from the São Paulo Ridge did not match any other sequences previously reported; therefore, the specimen was thought to be a new species.

Here we report a new species of Osedax collected from the South Atlantic at the deepest point recorded for this genus. Morphological and molecular phylogenetic characteristics are described.

Materials and methods

Specimen collection

Whale vertebrae harbouring Osedax worms were collected at a depth of 4,204 m at the base of the São Paulo Ridge (28°31.12'S, 41°39.41'W), southwest Atlantic Ocean during the HOV Shinkai 6500 dives on April 24, 2013 (dive #1334), and April 26, 2013 (dive #1336), in the YK13-04 leg1 cruise using R/V Yokosuka (Figs 1–2). Upon recovery, the bones were immediately transferred to fresh chilled seawater (4 °C). Osedax worms were carefully removed from the bones under an on-board microscope just after the bone retrieval.

Figure 1.

Sampling location of Osedax braziliensis sp. n. Solid star indicates the sampling location where a whale carcass was discovered at a depth of 4,204 m.

Figure 2.

Whale skeleton discovered at a depth of 4,204 m in the South Atlantic Ocean. A Sunken whale skeleton of the Atlantic minke whale (Balaenoptera bonaerensis). Seven vertebrae are visible in this field of view. Osedax braziliensis sp. n. had colonised the first two bones on the right B Close-up view of a vertebra colonized by O. braziliensis sp. n. Galatheid crabs (Munidopsis spp.), amphipods (Stephonyx sp.), and gastropods (Rubyspira sp.) were also seen on and around the bones.

Treatment for electron microscopic observation

Whole bodies of Osedax worms (n = 21) were fixed with 2.5% glutaraldehyde in filtered seawater for 24 h and preserved in filtered seawater with 10 mM sodium azide at 4 °C. Samples were then washed in filtered seawater and fixed with 2% osmium tetroxide in filtered seawater for 2 h at 4 °C. For scanning electron microscopic observation, each sample was rinsed with distilled water and incubated with 1% aqueous tannic acid (pH 6.8) for 1 h for conductive staining. These samples were again washed with distilled water and treated with 1% aqueous osmium tetroxide for 1 h. The worms were dehydrated in a graded ethanol series and critical point-dried using a JCPD-5 critical point dryer (JEOL, Akishima, Japan). The samples were coated with osmium using a POC-3 osmium plasma coater (MEIWAFOSIS Co., Osaka, Japan). The coated tissues were then observed using a JSM-6700F field-emission scanning electron microscope (JEOL) at an acceleration voltage of 5 kV.

DNA preparation

DNA was extracted from the root tissues of nine the Osedax worms. To reduce surface contaminants, each tissue sample was thoroughly washed in autoclaved and filtered (0.22 µm) seawater. DNA extraction from tissue samples was conducted separately using the DNeasy Tissue Kit (Qiagen Japan, Tokyo, Japan), following the instruction provided by the manufacturer.

Polymerase chain reaction (PCR) amplification, cloning, and sequencing

PCR amplifications were conducted using an Ex Taq PCR kit (TaKaRa, Kyoto, Japan) for three different molecular markers: cytochrome c oxidase subunit I (COI), 16S rRNA (16S), and 18S rRNA (18S). Two oligonucleotide primers (0.2 µM each) and <1 µg of DNA template were added to the reaction mixtures. Thermal cycling was performed as follows: denaturing at 96 °C for 20 s, annealing at 55 °C for 45 s, and extension at 72 °C for 2 min for a total of 35 cycles. The oligonucleotide primer sequences used for the PCR amplification are shown in Table 1. The molecular sizes of the PCR products were confirmed with 1.2% Agarose S (Nippon Gene, Toyama, Japan) gel electrophoresis. The PCR products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA). The DNA sequencing reaction was performed using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). Specific primers for each gene were used in sequencing reactions according to the manufacturer’s recommended procedure (Table 1). Sequencing was performed using an ABI PRISM 3100 genetic analyser (Applied Biosystems).

Table 1.

Download as

CSV

XLSX

List of primers used for PCR and sequencing.

Primer	Target gene	Sequence (5'–3')	Application	Reference
P_CO1f	COI	TCMACTAATCAYAARGAYATTGGNAC	PCR, Sequencing	Nelson and Fisher (2000)
P_CO1r	COI	CCDCCTAGWCCTARRAARTGTTGNGG	PCR, Sequencing	Nelson and Fisher (2000)
Euk_42F	18S rRNA	CTCAARGAYTAAGCCATGCA	PCR, Sequencing	Takishita et al. (2007)
Euk_1520R	18S rRNA	CYGCAGGTTCACCTAC	PCR, Sequencing	Takishita et al. (2007)
Euk_555F	18S rRNA	AGTCTGGTGCCAGCAGCCGC	Sequencing (internal)	Takishita et al. (2007)
Euk_555R	18S rRNA	GCGGCTGCTGGCACCAGACT	Sequencing (internal) (Complement of Euk_555F)	Modified from Takishita et al. (2007)
Euk_1269R	18S rRNA	AAGAACGGCCATGCACCAC	Sequencing (internal)	Takishita et al. (2007)
16SarL	16S rRNA	CGCCTGTTTAACAAAAACAT	PCR, Sequencing	Palumbi et al. (2000)
16SbrH	16S rRNA	CCGGTCTGAACTCAGATCACGT	PCR, Sequencing	Palumbi et al. (2000)

Phylogenetic analysis

Partial sequences of the COI, 16S, and 18S genes were analysed using the gapped-BLAST search algorithm (Altschul et al. 1997, Benson et al. 2000) to estimate the degree of similarity to other related sequences. Additional sequences of siboglinids for phylogenetic analyses were obtained from the non-redundant nucleotide sequence database of the DNA Data Bank of Japan (Kodama et al. 2018) (Table 2). Sequences were aligned using CLUSTAL X (Larkin et al. 2007), followed by automatic editing of the resulting alignments using the GBLOCKS program for all the genetic markers under the options allowing smaller final blocks, gap positions within the final blocks, and less strict flanking positions (Castresana 2000, Talavera and Castresana 2007). The alignments (34 OTUs / 3,112 bp in total) are available upon request from the corresponding author. The maximum likelihood (ML) analysis was performed using the RAxML-VI-HPC program (Stamatakis 2006). Evolutionary models for each marker (GTR + γ) were separately estimated using KAKUSAN4 software (Tanabe 2007). The ML bootstrap analyses (1,000 replicates, -f option) were constructed as in the model and using the settings described earlier in this section.

Table 2.

Download as

CSV

XLSX

List of operational taxonomic units included in the phylogenetic analysis, together with accession numbers in DDBJ.

Taxon	COI	16S rRNA	18S rRNA
Lamellibrachia columna	DQ996645	FJ347646	FJ347679
Riftia pachyptila	KJ789166	KP119573	KP119591
Sclerolinum brattstromi	KJ789167	FJ347645	FJ347680
Osedax antarcticus	KF444422	KF444418	KF444420
Osedax braziliensis sp. n.	LC381421	LC381422	LC381424
Osedax bryani	JX280610	KP119580	KP119593
Osedax crouchi	KJ598038	KJ598032	KJ598035
Osedax deceptionensis	KT860545	KF444419	KF444421
Osedax docricketts	FJ347626	FJ347650	FJ347688
Osedax frankpressi	FJ347607	FJ347658	FJ347682
Osedax jabba	FJ347638	FJ347647	FJ347693
Osedax japonicus	FM998111	LC381423	FM995535
Osedax knutei	FJ347635	FJ347648	FJ347692
Osedax lehmani	EU223323	FJ347660	FJ347689
Osedax lonnyi	FJ347643	FJ347651	FJ347695
Osedax mucofloris	KJ806976	N.A.	AY941263
Osedax nordenskjoeldi	KJ598033	KJ598033	KJ598036
Osedax packardorum	FJ347629	FJ347661	FJ347690
Osedax priapus	KP119564	KP119575	KP119594
Osedax randyi	FJ347615	FJ347659	FJ347684
Osedax rogersi	KJ598040	KJ598034	KJ598037
Osedax roseus	FJ347609	FJ347657	FJ347683
Osedax rubiplumus	EU852488	FJ347656	FJ347681
Osedax ryderi	KP119563	KP119574	KP119597
Osedax sigridae	FJ347642	FJ347655	FJ347694
Osedax talkovici	FJ347621	FJ347654	FJ347685
Osedax tiburon	FJ347624	FJ347653	FJ347687
Osedax ventana	EU236218	FJ347652	FJ347686
Osedax westernflyer	FM998110	FJ347649	FJ347691
Osedax sp. 'MB16'	JX280612	KP119581	KP119592
Osedax sp. 'mediterranea'	KT860548	KT860551	KT860550
Osedax sp. 'sagami3'	FM998081	N.A.	FM995537
Osedax sp. 'sagami4'	FM998082	N.A.	FM995541
Osedax sp. 'sagami5'	FM998083	N.A.	FM995539

COI genetic distance

Minimum genetic distances based on Kimura 2 parameters (K2P) model were calculated between Osedax species using MEGA7 software (Kumar et al. 2016). These distances were calculated using the COI alignment used in the phylogenetic analyses without gaps.

Systematics

Family Siboglinidae Caullery, 1914

Genus Osedax Rouse, Goffredi & Vrijenhoek, 2004

Osedax braziliensis sp. n.

http://zoobank.org/7AD6CE45-4585-42C6-BB5E-22587BB2307F

Figures 3, 4 New Japanese name: Burajiru-honekuihanamushi

Osedax sp. nov.: Sumida et al. 2016: 1–6, figs 3–4, Table 1. Osedax: Alfaro-Lucas et al. 2017: 1–9, fig. 2B.

Type material

Holotype: NMST-Pol H-685, trunk 14 mm long, 2 mm wide, female, 4,203 m depth, 26 April 2013, collected by YF, DDBJ No. LC381421, LC381422, LC381424. Paratypes (14 specimens): NSMT-Pol P-686–690 and JAMSTEC-1130038806, 1130039105, 1130039113, 1130039116, 1130039146, 1130039163, 11 specimens, female, 24 and 26 April 2013, collected by YF, DDBJ No. LC381777, LC381766, LC381767, LC381768, LC381769, LC381771; JAMSTEC-1130057454, 1130057457, 1130057458, 3 specimens, male, 26 April 2013, collected by YF.

Type locality

São Paulo Ridge, Brazil, 4,204 m depth.

Diagnosis

Trunk length long. Gelatinous hemispherical tube encases trunk and base of palps. Yellow bump or patch present (absent in some specimens). Pinnules on inner margin of palps. Root lobulated without branching.

Description

Genetic data (COI, 16S, and 18S) deposited in DDBJ (LC106303, LC381421, LC381422, LC381424, and LC381765–LC381787). Trunk length up to 22 mm, width at collar 0.5 mm, reddish purple while alive and whitish after fixation (Fig. 3A–C); gelatinous hemispherical tube encases trunk and base of palps, 1–2 mm thick, contains eggs and dwarf males (Fig. 3A, C). Prostomium whitish while alive, present at top of trunk. Yellow bump or patch present behind prostomium: this yellow bump or patch size varies among individuals, biggest bump reaches top of trunk, and is absent in some specimens (Fig. 3D–F). Crown consists of four palps; palps about 1.5 mm length, red colour while alive with two whitish stripes on the inner side, fused for about 30% of length; pinnules on inner margin of palps, about 50–250 µm, 7–8 pinnules in transverse rows (Figs 3A, C, 4B, C). Oviduct free to base, adjoined to the trunk at opposite side of prostomium region, reaching up to 20–30% of palp length (Fig. 4C). Ovisac whitish; trunk–ovisac junction about 15% of trunk length, light green while alive (Fig. 3B). Root lobulated without branching, yellow greenish while alive and whitish after fixation; intracellular symbiotic bacteria in root tissue (Fig. 3B). Eggs about 150 µm diameter (n = 20), whitish while alive (Fig. 3B).

Figure 3.

Photographs of unfixed Osedax braziliensis sp. n. A Palps (pa), trunk (tr) and a gelatinous hemispherical tube (tu)B lateral view of palps (pa), trunk (tr), ovary (o), and root (r)C ventral view of palps (pa) with pinnules (pi) and trunk (tr). Dwarf males (m) inhabit a gelatinous tube (tu), and D ventro-lateral view of an individual possessing a yellow bump (b) present behind prostomium E Ventral view of holotype (NMST-Pol H-685) possessing a yellow patch (pt)F Ventral view of an individual without yellow bump.

Dwarf male about 250 µm in length (n = 20), fusiform, whitish while alive, prostomium and pygidium rounded, no appendage organs; posterior hooks present, two pairs (5–7 hooks per bundle) arranged in three rows (Figs 3C, 4D).

Figure 4.

Scanning electron micrographs of Osedax braziliensis sp. n. A Ventro-lateral view of bump (b)B lateral view of palps (pa) with pinnules (pi), and C dorsal view of palps (pa) and oviduct (od)D Dwarf male taken from the tube of a female.

Etymology

This species is named after the type locality, Brazil. This name is an adjective used as a substantive in the genitive case.

Distribution

Only known from a whale carcass of the type locality. São Paulo Ridge, off Brazilian coast, 4,204 m depth.

Phylogenetic analysis

The final lengths of the aligned sequences were 1,004 bp (COI), 486 bp (16S), and 1,604 bp (18S). The phylogenetic position of O. braziliensis sp. n. determined from our ML analysis recovered, with total support, a distinct species from that of all other Osedax species reported (Fig. 5). The six Osedax clades proposed by Rouse et al. (2018) were recovered. The phylogenetic analysis showed that O. braziliensis sp. n. falls into Clade IV, and is a sister species of O. frankpressi known from Monterey Bay at depths between 1,820 m and 2,898 m (Fig. 5).

Figure 5.

Phylogenetic placement of Osedax braziliensis sp. n. based on nucleotide sequences on the concatenated COI, 16S, and 18S markers, using maximum likelihood. Scale bar represents 0.1 nucleotide substitutions per sequence position. Only bootstrap values greater than 50 are shown for each branch. Osedax braziliensis sp. n. is boxed.

Remarks

This species resembles Osedax frankpressi in the pinnules distributed only at the inner margin of palps, lobulated root structure without branching, gelatinous hemispherical tube, and dwarf males (Rouse et al. 2004). However, it can be discriminated from O. frankpressi by the presence of the yellow bump or patch behind the prostomium, trunk length, and genetic data. In O. braziliensis sp. n., the yellow bump or patch was present in some specimens including holotype, and the trunk length is long (6–22 mm), whereas in O. frankpressi, the bump or patch is absent in all specimens, and the trunk length is shorter (4.5 mm). COI genetic distances between O. braziliensis sp. n. and O. frankpressi are 0.111–0.117, which are greater than intraspecific values in O. braziliensis sp. n. (0.001–0.006). Genetic distances between O. braziliensis and the rest of the Osedax taxa for the COI ranged from 0.117 to 0.236 (Table 3).

Table 3.

Download as

CSV

XLSX

COI divergence values (Kimura 2 parameters) between Osedax species and OTUs.

	OTU	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18	19	20	21	22	23	24	25	26	27	28	29	30	31	32	33	34
1	Osedax frankpressi
2	Osedax sp. ‘sagami8’	0.230
3	Osedax tiburon	0.206	0.188
4	Osedax sp. ‘sagami7’	0.207	0.221	0.241
5	Osedax knutei	0.238	0.167	0.231	0.230
6	Osedax sp. ‘sagami4’	0.193	0.214	0.214	0.162	0.212
7	Osedax mucofloris	0.198	0.224	0.209	0.204	0.190	0.214
8	Osedax antarcticus	0.209	0.209	0.218	0.235	0.211	0.201	0.255
9	Osedax talkovici	0.225	0.219	0.234	0.244	0.214	0.220	0.220	0.267
10	Osedax randyi	0.207	0.219	0.244	0.006	0.233	0.165	0.209	0.231	0.238
11	Osedax crouchi	0.209	0.213	0.180	0.178	0.196	0.177	0.203	0.205	0.221	0.180
12	Osedax sp. ‘MB16’	0.207	0.230	0.253	0.057	0.219	0.178	0.212	0.240	0.236	0.059	0.175
13	Osedax sigridae	0.192	0.198	0.190	0.214	0.207	0.207	0.230	0.212	0.215	0.208	0.188	0.217
14	Osedax lehmani	0.193	0.229	0.211	0.178	0.223	0.175	0.178	0.264	0.202	0.175	0.200	0.175	0.195
15	Osedax ventana	0.193	0.187	0.165	0.217	0.196	0.208	0.225	0.221	0.220	0.222	0.155	0.222	0.207	0.228
16	Osedax roseus	0.172	0.209	0.201	0.209	0.230	0.168	0.206	0.196	0.226	0.201	0.222	0.211	0.201	0.191	0.203
17	Osedax lonnyi	0.230	0.187	0.236	0.206	0.204	0.185	0.227	0.168	0.233	0.208	0.188	0.200	0.209	0.222	0.201	0.195
18	Osedax braziliensis sp. n.	0.117	0.203	0.203	0.184	0.211	0.217	0.196	0.193	0.236	0.183	0.206	0.190	0.187	0.217	0.198	0.170	0.214
19	Osedax rubiplumus	0.190	0.211	0.222	0.195	0.230	0.161	0.230	0.206	0.224	0.203	0.183	0.203	0.203	0.190	0.228	0.185	0.193	0.211
20	Osedax rogersi	0.230	0.187	0.236	0.206	0.204	0.185	0.227	0.168	0.233	0.208	0.188	0.200	0.209	0.222	0.201	0.195	0.000	0.214	0.193
21	Osedax sp. ‘mediterranea’	0.214	0.241	0.212	0.206	0.264	0.217	0.241	0.259	0.203	0.201	0.227	0.190	0.155	0.206	0.230	0.192	0.238	0.199	0.241	0.238
22	Osedax packardorum	0.201	0.216	0.208	0.185	0.237	0.170	0.181	0.258	0.191	0.177	0.219	0.199	0.201	0.082	0.219	0.196	0.227	0.219	0.196	0.227	0.196
23	Osedax bryani	0.209	0.213	0.180	0.178	0.196	0.177	0.203	0.205	0.221	0.180	0.000	0.175	0.188	0.200	0.155	0.222	0.188	0.206	0.183	0.188	0.227	0.219
24	Osedax nordenskjoeldi	0.203	0.190	0.002	0.244	0.230	0.217	0.209	0.218	0.237	0.246	0.177	0.255	0.188	0.214	0.163	0.204	0.238	0.201	0.220	0.238	0.214	0.211	0.177
25	Osedax westernflyer	0.233	0.004	0.188	0.221	0.170	0.211	0.224	0.212	0.222	0.219	0.216	0.230	0.200	0.229	0.193	0.206	0.193	0.205	0.211	0.193	0.244	0.216	0.216	0.190
26	Osedax ryderi	0.209	0.213	0.180	0.178	0.196	0.177	0.203	0.205	0.221	0.180	0.000	0.175	0.188	0.200	0.155	0.222	0.188	0.206	0.183	0.188	0.227	0.219	0.000	0.177	0.216
27	Osedax sp. ‘sagami6’	0.193	0.175	0.185	0.238	0.152	0.219	0.203	0.203	0.225	0.233	0.175	0.224	0.221	0.236	0.153	0.222	0.178	0.198	0.220	0.178	0.233	0.224	0.175	0.183	0.177	0.175
28	Osedax jabba	0.228	0.172	0.222	0.203	0.206	0.251	0.195	0.238	0.228	0.209	0.216	0.228	0.222	0.241	0.188	0.220	0.213	0.208	0.243	0.213	0.227	0.227	0.216	0.219	0.172	0.216	0.206
29	Osedax docricketts	0.198	0.172	0.183	0.236	0.157	0.219	0.206	0.206	0.225	0.230	0.170	0.227	0.218	0.233	0.148	0.222	0.176	0.201	0.220	0.176	0.236	0.222	0.170	0.180	0.175	0.170	0.008	0.203
30	Osedax priapus	0.217	0.191	0.186	0.206	0.210	0.180	0.230	0.211	0.231	0.209	0.160	0.195	0.155	0.195	0.183	0.198	0.178	0.211	0.219	0.178	0.175	0.227	0.160	0.184	0.196	0.160	0.191	0.198	0.188
31	Osedax sp. ‘sagami5’	0.193	0.214	0.207	0.222	0.204	0.206	0.212	0.228	0.226	0.222	0.198	0.224	0.122	0.203	0.209	0.217	0.219	0.203	0.198	0.219	0.183	0.214	0.198	0.204	0.217	0.198	0.212	0.214	0.207	0.180
32	Osedax sp. ‘sagami3’	0.196	0.206	0.242	0.209	0.219	0.181	0.217	0.220	0.186	0.201	0.206	0.209	0.211	0.194	0.234	0.187	0.224	0.199	0.176	0.224	0.214	0.202	0.206	0.242	0.209	0.206	0.229	0.238	0.229	0.241	0.225
33	Osedax japonicus	0.201	0.238	0.220	0.175	0.236	0.172	0.173	0.216	0.204	0.172	0.188	0.165	0.206	0.149	0.206	0.185	0.211	0.188	0.203	0.211	0.206	0.141	0.188	0.223	0.238	0.188	0.213	0.213	0.211	0.201	0.200	0.212
34	Osedax deceptionensis	0.214	0.230	0.236	0.273	0.235	0.271	0.246	0.234	0.221	0.273	0.242	0.270	0.209	0.233	0.236	0.241	0.236	0.211	0.250	0.236	0.239	0.233	0.242	0.236	0.236	0.242	0.243	0.261	0.240	0.240	0.248	0.251	0.230

Acknowledgements

We thank all the participants of the Iatá-Piúna Expedition, the captain and crew of the R/V Yokosuka, and the operation team of HOV Shinkai 6500 for organising the cruise and conducting the diving research and sampling. We also thank Mr Katsuyuki Uematsu (Marine Work Japan, Ltd.) for SEM observations and Ayaka Takayama and Yoshimi Umezu (JAMSTEC) for research assistance. PYGS benefitted from a BIOTA FAPESP Grant number 2011/50185-1. We would additionally like to thank Editage (www.editage.jp) for English language editing.

References

Alfaro-Lucas JM, Shimabukuro M, Ferreira GD, Kitazato H, Fujiwara Y, Sumida PYG (2017) Bone-eating Osedax worms (Annelida: Siboglinidae) regulate biodiversity of deep-sea whale-fall communities. Deep-Sea Research Part II: Topical Studies in Oceanography 146: 4–12. https://doi.org/10.1016/j.dsr2.2017.04.011

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: 3389–3402. https://doi.org/10.1093/nar/25.17.3389

Amon DJ, Wiklund H, Dahlgren TG, Copley JT, Smith CR, Jamieson AJ, Glover AG (2014) Molecular taxonomy of Osedax (Annelida: Siboglinidae) in the Southern Ocean. Zoologica Scripta 43: 1–13. https://doi.org/10.1111/zsc.12057

Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Rapp BA, Wheeler DL (2000) GenBank. Nucleic Acids Research 28: 15–18. https://doi.org/10.1093/nar/28.1.15

Braby CE, Rouse GW, Johnson SB, Jones WJ, Vrijenhoek RC (2007) Bathymetric and temporal variation among Osedax boneworms and associated megafauna on whale-falls in Monterey Bay, California. Deep-Sea Research Part I: Oceanographic Research Papers 54: 1773–1791. https://doi.org/10.1016/j.dsr.2007.05.014

Castresana J (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution 17: 540–552. https://doi.org/10.1093/oxfordjournals.molbev.a026334

Fujikura K, Fujiwara Y, Kawato M (2006) A new species of Osedax (Annelida: Siboglinidae) associated with whale carcasses off Kyushu, Japan. Zoological Science 23: 733–740. https://doi.org/10.2108/zsj.23.733

Fujiwara Y, Kawato M, Yamamoto T, Yamanaka T, Sato-Okoshi W, Noda C, Tsuchida S, Komai T, Cubelio SS, Sasaki T, Jacobsen K, Kubokawa K, Fujikura K, Maruyama T, Furushima Y, Okoshi K, Miyake H, Miyazaki M, Nogi Y, Yatabe A, Okutani T (2007) Three-year investigations into sperm whale-fall ecosystems in Japan. Marine Ecology 28: 219–232. https://doi.org/10.1111/j.1439-0485.2007.00150.x

Glover AG, Kallstrom B, Smith CR, Dahlgren TG (2005) World-wide whale worms? A new species of Osedax from the shallow north Atlantic. Proceedings of the Royal Society of London Series B 272: 2587–2592. https://doi.org/10.1098/rspb.2005.3275

Glover AG, Wiklund H, Taboada S, Avila C, Cristobo J, Smith CR, Kemp KM, Jamieson AJ, Dahlgren TG (2013) Bone-eating worms from the Antarctic: the contrasting fate of whale and wood remains on the Southern Ocean seafloor. Proceedings of the Royal Society of London Series B Biological Sciences 280: 20131390. https://doi.org/10.1098/rspb.2013.1390

Goffredi SK, Johnson SB, Vrijenhoek RC (2007) Genetic diversity and potential function of microbial symbionts associated with newly discovered species of Osedax polychaete worms. Applied and Environmental Microbiology 73: 2314–2323. https://doi.org/10.1128/AEM.01986-06

Goffredi SK, Yi H, Zhang Q, Klann JE, Struve IA, Vrijenhoek RC, Brown CT (2014) Genomic versatility and functional variation between two dominant heterotrophic symbionts of deep-sea Osedax worms. The ISME Journal 8: 908–924. https://doi.org/10.1038/ismej.2013.201

Kodama Y, Mashima J, Kosuge T, Kaminuma E, Ogasawara O, Okubo K, Nakamura Y, Takagi T (2018) DNA Data Bank of Japan: 30th anniversary. Nucleic Acids Research 46: D30–D35. https://doi.org/10.1093/nar/gkx926

Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution 33: 1870–1874. https://doi.org/10.1093/molbev/msw054

Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948. https://doi.org/10.1093/bioinformatics/btm404

Miyamoto N, Yoshida MA, Koga H, Fujiwara Y (2017) Genetic mechanisms of bone digestion and nutrient absorption in the bone-eating worm Osedax japonicus inferred from transcriptome and gene expression analyses. BMC Evolutionary Biology 17: 17. https://doi.org/10.1186/s12862-016-0844-4

Nelson K, Fisher CR (2000) Absence of cospeciation in deep-sea vestimentiferan tube worms and their bacterial endosymbionts. Symbiosis 28: 1–15. https://doi.org/10.1094/189112711X.001

Palumbi S, Martin A, Romano S, McMillan WO, Stice L, Grabowski G (2000) The simple fool’s guide to PCR. Department of Zoology and Kewalo Marine Laboratory, University of Hawaii, Honolulu, Hawaii, 45 pp.

Rouse GW, Goffredi SK, Johnson SB, Vrijenhoek RC (2018) An inordinate fondness for Osedax (Siboglinidae: Annelida): Fourteen new species of bone worms from California. Zootaxa 4377: 451. https://doi.org/10.11646/zootaxa.4377.4.1

Rouse GW, Goffredi SK, Vrijenhoek RC (2004) Osedax: bone-eating marine worms with dwarf males. Science 305: 668–671. https://doi.org/10.1126/science.1098650

Rouse GW, Wilson NG, Worsaae K, Vrijenhoek RC (2015) A dwarf male reversal in bone-eating worms. Current Biology 25: 236–241. https://doi.org/10.1016/j.cub.2014.11.032

Rouse GW, Worsaae K, Johnson SB, Jones WJ, Vrijenhoek RC (2008) Acquisition of dwarf male “Harems” by recently settled females of Osedax roseus n. sp. (Siboglinidae; Annelida). Biological Bulletin 214: 67–82. https://doi.org/10.2307/25066661

Shimabukuro M, Rizzo AE, Alfaro-Lucas JM, Fujiwara Y, Sumida PYG (2017a) Sphaerodoropsis kitazatoi, a new species and the first record of Sphaerodoridae (Annelida: Phyllodocida) in SW Atlantic abyssal sediments around a whale carcass. Deep-Sea Research Part II: Topical Studies in Oceanography 146: 18–26. https://doi.org/10.1016/j.dsr2.2017.04.003

Shimabukuro M, Santos CSG, Alfaro-Lucas JM, Fujiwara Y, Sumida PYG (2017b) A new eyeless species of Neanthes (Annelida: Nereididae) associated with a whale-fall community from the deep Southwest Atlantic Ocean. Deep-Sea Research Part II: Topical Studies in Oceanography 146: 27–34. https://doi.org/10.1016/j.dsr2.2017.10.013

Silva CF, Shimabukuro M, Alfaro-Lucas JM, Fujiwara Y, Sumida PYG, Amaral ACZ (2015) A new Capitella polychaete worm (Annelida: Capitellidae) living inside whale bones in the abyssal South Atlantic. Deep-Sea Research Part I: Oceanographic Research Papers 108: 23–31. https://doi.org/10.1016/j.dsr.2015.12.004

Smith CR, Baco AR (2003) Ecology of whale falls at the deep-sea floor. In: Gibson RN, Atkinson RJA (Eds) Oceanography and Marine Biology.Taylor & Francis Inc., New York, 311–354.

Smith CR, Glover AG, Treude T, Higgs ND, Amon DJ (2015) Whale-fall ecosystems: recent insights into ecology, paleoecology, and evolution. Annual Review of Marine Science 7: 571–596. https://doi.org/10.1146/annurev-marine-010213–135144

Smith CR, Kukert H, Wheatcroft RA, Jumars PA, Deming JW (1989) Vent fauna on whale remains. Nature 341: 27–28. https://doi.org/10.1038/341027a0

Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688–2690. https://doi.org/10.1093/bioinformatics/btl446

Sumida PY, Alfaro-Lucas JM, Shimabukuro M, Kitazato H, Perez JA, Soares-Gomes A, Toyofuku T, Lima AO, Ara K, Fujiwara Y (2016) Deep-sea whale fall fauna from the Atlantic resembles that of the Pacific Ocean. Scientific Reports 6: 22139. https://doi.org/10.1038/srep22139

Taboada S, Riesgo A, Bas M, Arnedo MA, Cristobo J, Rouse GW, Avila C (2015) Bone-eating worms spread: Insights into shallow-water Osedax (Annelida, Siboglinidae) from Antarctic, Subantarctic, and Mediterranean waters. PLoS ONE 10: e0140341. https://doi.org/10.1371/journal.pone.0140341

Takishita K, Yubuki N, Kakizoe N, Inagaki Y, Maruyama T (2007) Diversity of microbial eukaryotes in sediment at a deep-sea methane cold seep: surveys of ribosomal DNA libraries from raw sediment samples and two enrichment cultures. Extremophiles 11: 563–576. https://doi.org/10.1007/s00792-007-0068-z

Talavera G, Castresana J (2007) Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Systematic Biology 56: 564–577. https://doi.org/10.1080/10635150701472164

Tanabe AS (2007) Kakusan: a computer program to automate the selection of a nucleotide substitution model and the configuration of a mixed model on multilocus data. Molecular Ecology Notes 7: 962–964. https://doi.org/10.1111/j.1471-8286.2007.01807.x

Tresguerres M, Katz S, Rouse GW (2013) How to get into bones: proton pump and carbonic anhydrase in Osedax boneworms. Proceedings of the Royal Society B Biological Sciences 280: 20130625. https://doi.org/10.1098/rspb.2013.0625

Vrijenhoek RC, Johnson SB, Rouse GC (2008) Bone-eating Osedax females and their ‘harems’ of dwarf males are recruited from a common larval pool. Molecular Ecology 17: 4535–4544. https://doi.org/10.1111/j.1365-294X.2008.03937.x

Vrijenhoek RC, Johnson SB, Rouse GW (2009) A remarkable diversity of bone-eating worms (Osedax; Siboglinidae; Annelida). BMC Biology 7: 74. https://doi.org/10.1186/1741-7007-7-74