A new species of the genus Blaptogonia from the Himalayas with four DNA markers (Coleoptera, Tenebrionidae, Blaptini)

Xiu-Min Li; Xing-Long Bai; Guo-Dong Ren

doi:10.3897/zookeys.773.24656

Abstract

A new species of the genus Blaptogonia Medvedev, 1998, B. zhentanga sp. n., is described from the southern Himalayas of China. Two fragments of mitochondrial protein-coding genes (COI, Cytb), one fragment of mitochondrial ribosomal RNA gene (16S), and one fragment of nuclear rRNA gene (28SD2) of the new species were obtained. A key to the known species of the genus is presented.

Keywords

biology, darkling beetles, DNA sequence, taxonomy, Tenebrioninae

Introduction

The tenebrionid genus Blaptogonia Medvedev, 1998 belongs to the subtribe Gnaptorinina Medvedev, 2001 of tribe Blaptini Leach, 1815 within the subfamily Tenebrioninae Latreille, 1802. To date, only four species have been described worldwide and are known to occur only in the southern Himalayas at 3000–4000 meters (Medvedev 2004).

The first species, Trigonoides costulata Fairmaire, 1901, was described from Sikkim, India. It is evident from the text that Trigonoides used by Fairmaire (1901) is an incorrect spelling for Tagonoides Fairmaire, 1886. The second species, Blaps subcarinata Blair, 1927, was described based on the specimens of the third expedition to Mt. Everest from Tibet, China. Subsequently, a new genus, Blaptyscelis, was established by Koch (in Pierre, 1961), along with the combinations Blaptyscelis costulata Fairmaire, 1901 and B. subcarinata Blair, 1927. Koch (1965) redefined the diagnostic characters of this genus, which were accepted by Medvedev (1998, 2004). The third species, Blaptyscelis zurstrasseni Kaszab, 1977 was described from Nepal. A contribution to the knowledge of the tribe Blaptini was subsequently made by Medvedev (1998) who established the replacement name Blaptogonia since Blaptyscelis Koch was originally proposed without a type species designation. Thus, the combinations Blaptogonia costulata Fairmaire, 1901, B. subcarinata Blair, 1927, and B. zurstrasseni Kaszab, 1977 were established, and Tagonoides costulata Fairmaire, 1901 was designated as the type species.

At the beginning of the 21st century, Blaptogonia yini Ren, Wang & Yu, 2000 was described from Tibet and placed in Blaptogonia because of the distinct elytral carinae, one of the typical characters of the genus, but was moved recently to the genus Blaps Fabricius, 1775 (Ren et al. 2016) on the basis of additional materials and structures of male genitalia. The fourth species, Blaptogonia tshernjachovskii Medvedev, 2004, was described from Nepal based on two female specimens. Medvedev (2004) also characterized the structures of the apical part of the male abdomen, as well as the ovipositor and genital tubes of the female, as diagnostic characters of the genus Blaptogonia.

In the present study, a new species of the tribe Blaptini, collected from southern Qomolangma Nature Reserve of Tibet, is described. In addition, two fragments of mitochondrial protein-coding genes (COI, Cytb), one fragment of mitochondrial ribosomal RNA gene (16S), and one fragment of nuclear rRNA gene (28SD2) of the new species were sequenced and uploaded to GenBank.

Materials and methods

Morphology

All specimens examined in this study were deposited in the Museum of Hebei University (MHBU), Baoding, China. Photographs of morphological structures were taken using a Leica M205A stereomicroscope with a Leica DFC550 camera and Leica application suite 4.6. The habitus photos were taken using a Canon EOS 5D Mark III camera connected to a Canon Macro lens MP-E 65 mm.

DNA extraction, PCR amplification, and sequencing

Total DNA was extracted from leg muscle tissue of a single adult specimen using EZNA® Insect DNA Kit (Omega Bio-tek, USA). Total DNA extract was stored at -20 °C. Two fragments of mitochondrial protein-coding genes (COI, Cytb), one fragment of mitochondrial ribosomal RNA gene (16S), and one fragment of nuclear rRNA gene (28SD2) were amplified using the primers of Table 1. The profile of the PCR amplification consisted of an initial denaturation step at 94 °C for 4 min, 35 cycles of denaturation at 94 °C for 1 min, annealing at 50–58 °C for 1 min, and extension at 72 °C for 1 min, and a final 8 min extension step at 72 °C. The PCR products were subsequently checked by 1% agarose gel electrophoresis and sequencing was performed at GENEWIZ Biotech Co., Ltd. (Suzhou, China) using the same primers as in the PCR.

Table 1.

Download as

CSV

XLSX

Primer sequences for PCR.

Locus	Primer (Forward /Reverse/ Internal)	Sequence (forward and reverse) 5’→3’	References
COI	F 2183	CAACATTTATTTTGATTTTTTGG	Folmer et al. 1994
COI	R 3014	TCCAATGCACTAATCTGCCATATTA	Folmer et al. 1994
Cytb	F revcb2h	TGAGGACAAATATCATTTTGAGGW	Simmons and Weller 2001
Cytb	R rebcbj	TCAGGTCGAGCTCCAATTCATGT	Simmons and Weller 2001
16S	F 13398	CGCCTGTTTATCAAAAACAT	Simon et al. 1994
16S	R 12887	CCGGTCTGAACTCAGATCAT	Simon et al. 1994
28SD2	F 3665	AGAGAGAGTTCAAGAGTACGTG	Belshaw and Quicke 1997
28SD2	R 4068	TTGGTCCGTGTTTCAAGACGGG	Belshaw and Quicke 1997

Results

Key to known species of the genus Blaptogonia

1	Surface of elytra between carinae without subcarinae (i.e. secondary carinae)	2
–	Surface of elytra between carinae with subcarinae	3
2	Both carinae on each elytron evanescent in the basal half and 2^nd carina not reaching humeral carina at the apex in male and female	B. zurstrasseni Kaszab, 1977
–	Both carinae on each elytron reaching the elytral base and fused with humeral carina at the apex in female	B. tshernjachovskii Medvedev, 2004
3	Elytral surface between carinae and subcarinae with fine granules; carinae higher than subcarinae; paramere arcuately concave, narrowing from basal 1/5 to apex	B. zhentanga sp. n.
–	Elytral surface between carinae and subcarinae without granules; carinae as high as subcarinae; paramere almost straight, Parameres narrowing from base to apex	4
4	Body and legs black; male elytra more oval, with a row of small punctures between 4^th and 5^th carinae, and between 5^th and humeral carinae	B. costulata Fairmaire, 1901
–	Head and elytra dark brown, pronotum and legs reddish brown; male elytra narrow, more parallel sided, without rows of punctures between carinae and subcarinae	B. subcarinata Blair, 1927

Genus Blaptogonia Medvedev, 1998

Blaptogonia Medvedev, 1998: 186; 2001: 95; 2004: 89; Löbl et al. 2008: 231; Ren et al. 2016: 332.

Type species

Tagonoides costulata Fairmaire, 1901.

Blaptogonia costulata (Fairmaire, 1901)

Trigonoides costulata Fairmaire, 1901: 267.

Blaptyscelis costulata : Koch in Pierre 1961: 213.

Blaptogonia costulata : Medvedev 1998: 186; 2001: 95; 2004: 89; Löbl et al. 2008: 231.

Distribution

India: Sikkim.

Blaptogonia subcarinata (Blair, 1927)

Blaps subcarinata Blair, 1927: 243.

Blaptyscelis subcarinata : Koch in Pierre 1961: 213.

Blaptogonia subcarinata : Medvedev 1998: 186; 2001: 95; 2004: 89; Löbl et al. 2008: 231; Ren et al. 2016: 332.

Distribution

China: Tibet (Yadong, also called Chomo).

Blaptogonia tshernjachovskii Medvedev, 2004

Blaptogonia tshernjachovskii Medvedev, 2004: 177; Löbl et al. 2008: 231.

Distribution

Nepal.

Blaptogonia zhentanga sp. n.

http://zoobank.org/4B416851-9F94-4EEB-B369-424908D08D54

Figs 1, 2, 3–4

Type material

Holotype: male (MHBU) (Fig. 3), CHINA: Xizang, Dinggyê County, Zhêntang Town, Power Station, 27°55.069'N, 87°28.171'E, Alt. 3418 m, 4.VIII.2014, Guo-Dong Ren, Xing-Long Bai & Jun-Sheng Shan leg. Paratypes: 54 males, 28 females (MHBU), same data as the holotype.

Diagnosis

This new species is closely related to Blaptogonia subcarinata Blair, 1927 but can be distinguished from the latter by the following character states: (1) elytral surface with fine granules and irregular and shallow fine punctures, whereas subcarinata has no granules and rows of punctures between carinae and subcarinae; (2) elytral carinae more elevated than the subcarinae, whereas the subcarinae are as high as the carinae in subcarinata; (3) parameres arcuately concave and narrowing from basal 1/5 to apex, whereas the parameres are nearly straight in subcarinata and narrowing from base to apex.

Etymology

Named after the type locality, Zhêntang.

Description

Head, palps, antennae, carinae, subcarinae, humeral carina, abdomen, tibiae, and tarsus black. Pronotum, elytra, femora, apical spurs, and claws reddish brown to brown. Shiny dorsally and ventrally, with sparse and short pubescence at apex on elytra.

Male (Figs 2a–g, 3). Labrum with sparse punctures and pale yellow setae. Anterior margin of clypeus straight, tilted at sides, surface with sparse fine punctures; frontoclypeal suture shallow. Anterior gena slightly extended before eyes, outer margins straight and converging toward base of clypeus, surface with moderately dense fine punctures; emargination of outer margins of head above antennal base widely obtuse-angular. Eyes transverse, weakly projecting and clearly wider than anterior gena. Posterior gena densely hairy, outer margins arcuately converging to neck. Surface of head with moderately dense punctures. Antennae (Fig. 1b) moderately long, with apical segment reaching beyond pronotal base, length (width) ratio of antennomeres 2 to 11 are 1.0(0.9): 1.0(0.3): 1.0(0.5): 1.0(0.5): 1.0(0.5): 1.0(0.5): 1.0(1.0): 1.0(0.8): 1.0(0.9): 1.0(0.7).

Figure 1.

Habitat and population of Blaptogonia zhentanga sp. n.

Pronotum (Fig. 2a) transverse, widest before middle, 1.3–1.5 times as wide as long, 1.6–1.8 times as wide as head. Ratio of pronotal width at anterior margin to its maximum and base 0.6: 1.0: 0.9. Anterior margin arcuate, bordered laterally by bead along entire length; posterior margin weakly arcuate, without bead. Anterior angles obtuse, rounded apically; posterior angles obtuse. Pronotal surface between lateral margins weakly convex, with moderately dense and shallow fine punctures on disc. Propleura with fine shallow wrinkles. Prosternal process with dense pale hairs.

Figure 2.

Characters of Blaptogonia zhentanga sp. n. a–g male: a pronotum b antenna c₁–c₃ pro-, meso, metatibia d₁–d₃ pro-, meso-, metatarsus e₁–e₃ aedeagus in dorsal, ventral, and lateral view fspiculum astraleg. abdominal sternite VIII h–i female: h Speculum ventrale in ventral view i₁–i₂ ovipositor in dorsal and ventral view.

Elytra elongate-oval, 1.4–1.6 times as long as wide, and 1.2–1.4 times as wide as pronotum. Each elytron between suture and humeral carina with two distinct carinae. In addition, surface of elytra between suture and 1^st carina, 1^st and 2^nd carina, 2^nd and humeral carina with lower subcarinae; subcarinae between 2^nd and humeral carina indistinct. The humeral carina, subcarinae and carinae reaching base of elytra; 1^st carina fused with humeral carina at apex, 2^nd carina and subcarinae indistinct at apex. Surface of suture, subcarinae, carinae, humeral carina, between suture and subcarinae, between subcarinae and carinae, between subcarinae and humeral carina with irregular sparse and shallow fine punctures, sparse fine granules, and shallow wrinkles; punctures and wrinkles indistinct at apex. Epipleura not reaching suture of elytral angle, outer margin visible in dorsal view only at humeri, sometimes at apices. Visible abdominal sternites covered with short pale recumbent setae, sparse and fine shallow punctures, and fine granules; 1^st to 3^rd ventrites with fine longitudinal wrinkles, 2^nd ventrite flattened in the middle, 4^th ventrite shallowly depressed at sides.

Legs (Fig. 2c, d) rather slender. Protibia (Fig. 2c₁) straight, inner apical spur longer than outer one; mesotibia (Fig. 2c₂) nearly straight; metatibia (Fig. 2c₃) straight, inner apical spur equal to or slightly longer than outer one. Ventral surface of protarsomere I (Fig. 2d₁) with hairy brush, mesotarsomere I (Fig. 2d₂) with hairy tuft. Length (width) ratio of pro-, meso- and metafemora 7.4(1.0): 2.5(1.0): 3.0(1.0), that of corresponding tibiae 3.4(1.0): 3.5(1.0): 4.3(1.0); that of metatarsomeres (Fig. 1d₃) 12.7(1.0): 7.3(1.0): 6.5(1.0): 13.8(1.0). Claws slender, longer than half the length of apical tarsomere.

Aedeagus (Fig. 2e–g): length 2.9 mm, width 0.8 mm. Parameres 0.9 mm long and 0.6 mm wide, arcuately concave, narrowing from basal 1/5 to apex (Fig. 2e₁, e₂), and curved to ventral side in lateral view (Fig. 2e₃).

Female (Figs 2h–i, 4). Body wider than in male. Antennae reaching pronotal base. Pronotum 1.4–1.5 times as wide as long, 1.6–1.8 times as wide as head. Elytra 1.3–1.5 times as long as wide, and 1.4–1.6 times as wide as pronotum. Second visible sternite not flattened in middle. Apical spur slender, sharp at apex; inner apical spur of protibia slightly longer than outer one. Ventral surface of tarsus without hairy tuft. Spiculum ventrale as in Fig. 1h. Ovipositor as in Fig. 1i.

Figures 3–4.

Habitus of Blaptogonia zhentanga sp. n. 3.male, holotype, 12.2 mm 4 female, paratype, 13.5 mm.

Measurements

Body length: male 11.9–13.8 mm, female 13.1–14.9 mm; width: male 5.3–6.0 mm, female 7.0–7.4 mm.

Distribution

China: Xizang.

Molecular characters

Two fragments of mitochondrial protein-coding genes (COI, Cytb), one fragment of mitochondrial ribosomal RNA gene (16S), and one fragment of nuclear rRNA gene (28SD2) are deposited in GenBank with the accession numbers MG946798, MG946797, MG946800, and MG946799, respectively, based on one male, China, Xizang, Dinggyê, Zhêntang, 4 August 2014, coll. Guo-dong Ren, Xing-long Bai & Jun-sheng Shan. The sequence is presented in Table 2.

Table 2.

Download as

CSV

XLSX

Sequence of Blaptogonia zhentanga sp. n.

GenBank accession No.	Locus	Sequence
MG946798	COI	TGCCATATTAGAATGATGACAGTATAGGGAGTTCAGAATATCTGTGTTCAGCAGGGGGAGTATTTTGTAATCATTCAATAGAGGAGGTTATATTAAGCGAGGTTAAGGATTTTCGTGATGAAGAAAATCTTTCTCATATAATGAAAATTAGGAATAATACTCCTACTAAAGATATTAGAGACCCAATTGAGGAAATAATATTTCATAGGGTGTAGGCATCAGGGTAATCTGAGTATCGTCGGGGTATTCCTCTTAATCCGAGAAAGTGTTGAGGAAAGAAGGTAAGGTTTACGCCCACGAATATTACAAAAAATTGAATTTTACACAGTTTTGCCCTTAAGGATAAACCTGTGAATAAAGGGAATCAATGTACTAATCCTCCTAGAATTGCAAATACAGCTCCTATAGATAATACGTAATGGAAATGGGCTACTACATAATAGGTATCATGTAATATAATATCAATGGAAGAGTTAGCTAGAATTACTCCTGTTAATCCTCCTACTGTAAATAAAAATACGAATCCTAATGCTCATAATATTGAGGGACTATAATTTAGTTGTGTTCCGTGGAGAGTGGCTAATCATCTGAAAATTTTAATTCCAGTAGGAACTGCAATAATTATTGTTGCTGAAGTGAAATATGCTCGAGTATCTACGTCTATTCCTACTGTAAATATGTGATGGGCTCATACCACAAATCCTAATAATCCAATTGCTATTATAGCATAAATTATTCCCAATGTTCCAAAGGCCTCTTTTTTACCTCTTTCTTGTCT
MG946797	Cytb	ATCATTTTGAGGTGCTACTGTAATTACAAACTTACTTTCAGCAATTCCATACCTAGGATCAACTATTGTACAATGATTATGAGGAGGGTTTGCAGTAGACAATGCAACACTTACTCGATTTTTTGCATTCCATTTCCTTCTTCCATTTATTGTAACAGCAATAGTTATAATCCATTTACTGTTTCCCACCAAACAGGATCTAATAATCCCCTAGGATTAAACAGTAATATTGACAAAATTCCATTTCACCCATACTTTTCCTTTAAAGACATTATAAGATTGATTATTACAATTATAGCTCTTGTAATACTATCTATTAATAGACCCTATCTACTAGGAGATCCAGACAACTTTACACCCGCAAACCCTCTATCAACCCCAATTCATATCCAGCCAGAATGATATTTCCTATTTGCTTATGCAATCTTACGTTCAATCCCTAATAAATTAGGAGGAGTAATTGCACTAGCAATATCAATTGCAATCCTTTATATTTTACCTCTATCTAATAAAAAAAAATTTGCAAGAAACTCATTTTACCCTATAAATAAAATCCTATTCTGAATTATATTAGTTACAGTGATTCTATTAACATGAATTGG
MG946799	28SD2	TTCAAGACGGGTCCTGAAAGTACCCAAAGCTATAGCGTCCGCAGATCGGCGTTTCAACGAGGTCCTGTTCGAGAACACCTCGGCCAACAGTCGCCCGGGGACGGGACCGGCACCAGGTCCGATCACCGTCGCGAGAAGCGCGCTTGCCGAAGGTCGAACGCTAACTGAATAGCGGCCCCGCGCCATCTGTATATCGTCGAGCGAGCCGACCGGGAAACACCGAGGGTTCGTCACGAACGCCGAAACGTCCGGACGAACTCCACCTCGGGCCTTAGGCCGACACCCAACGAATCGCGACGTCCTACAGGGGGAGAAGTGCACGCGTTCGACCGCAGTTCGGAGGACGAAAGGCGCGGACGACGCGTACGCCGTCCGTCGCACGACCATCCAGCGCCACGATCGAGACACGCTGAATCTCCCCTTTCGACCTTTCGGGTTTCTCAGGTTTACCCCTGAACGGTTTCACGTACTCTT
MG946800	16S	AAAAACATGTCTTTTTGTTTTATGATTTAAAGTCTGGCCTGCCCAATGATTAATTTTAAATGGCTGCAGTATTTTGACTGTACAAAGGTAGCATAATCATTAGTTTCTTAATTAGAAGCTGGAATGAATGGTTTGATGAAAAATTTACTGTCTCAATTCAATTGTTTTAGAATTTTATTTTTAAGTGAAAAAGCTTAAATTTTTTAGAAAGACGAGAAGACCCTATAGAGTTTTATATGTTTTTTATTATTTATTATATGGTTATAATATTTTTAATTTTAAAATTTATTTTGTTGGGGTGATGTGAAAATTTAAATAACTTTTCTTAATTTTAACACTAATTAGTGATTAAATGATCCTTTTTAGGATTAAAAGATTAAATTACCTTAGGGATAACAGCGTAATTTTTTTTGAAAGTTCTTATTGATAAAAAAGTTTGCGACCTCGATGTTGGATTAAAATTTATTTTTGGTGTAGAAGCTGGAAAATTTGGGTCTGTTCGACCCTTAAAATTTTACATGATCTG

Biology

Adults of the new species were found beneath stones in the shrubbery (Fig. 1), usually with more than ten individuals per stone. When threatened, they released quite foul smells and irritating liquids from their abdominal defensive glands. The smell persisted for a few days in the laboratory.

Blaptogonia zurstrasseni (Kaszab, 1977)

Blaptyscelis zurstrasseni Kaszab, 1977: 246.

Blaptogonia zurstrasseni : Medvedev,1998: 186; 2001: 95; 2004: 89; Löbl et al. 2008: 231.

Distribution

Nepal.

Acknowledgements

This study was supported financially by the National Natural Science Foundation of China (No. 31572309), the Ministry of Science and Technology of the People’s Republic of China (No. 2015FY210300), the Key Laboratory of Zoological Systematics and Application in Hebei Province (No. 14967611D), and Post-graduate’s Innovation Fund Project of Hebei Province (No. CXZZBS2017021).

References

Belshaw R, Quicke DLJ (1997) A molecular phylogeny of the Aphidiinae (Hymenoptera: Braconidae). Molecular Phylogenetics and Evolution 7(3): 281–293. https://doi.org/10.1006/mpev.1996.0400

Blair KG (1927) Heteromera of the third Mt. Everest expedition, 1924. The Annals and Magazine of Natural History (9)19: 241–255. https://doi.org/10.1080/00222932708633592

Fabricius JC (1775) Systema Entomologicae, Sistens Insectorum Classes, Ordines, Genera, Species, Adiectis Synonymis, Locis, Descriptionibus, Observationibus. Flensburgi et Lipsiae, Libraria Kortii, 832 pp.

Fairmaire L (1901) Descriptions de coléoptères des montagnes de Sikkim. Bulletin de la Société Entomologique de France 1901: 265–268.

Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.

Kaszab Z (1977) Tenebrionidae der Nepal-Expeditionen von Dr. J. Martens (1969–1974) (Insecta: Coleoptera). Senckenbergiana Biologica 57: 241–283.

Koch C (1965) Sur les types of Fairmaire des tribus Blaptini & Platyscelini conservés au Muséum de Paris (Coleoptera, Tenebrionidae). Annales de la Société Entomologique de France NS 1(1): 125–135.

Latreille PA (1802) Histoire naturelle, générale et particulière des crustacées et des insectes. Ouvrage faisant suite à l’histoire naturelle générale et particulière, composée par Leclerc de Buffon, et rédigée par C. S. Sonnini, membre de plusieurs sociétés savantes. Familles naturelles des genres. Tome troixième. F Dufart, Paris, 467 pp.

Leach WE (1815) Entomology. In: Brewster D (Ed.) The Edinburg Encyclopedia 9(1).Baldwin, Edinburg, 57–172.

Löbl I, Nabozhenko M, Merkl O (2008) Tribe Blaptini Leach, 1815. In: Löbl I, Smetana A (Eds) Catalogue of Palaearctic Coleoptera.Volume 5. Tenebrionoidea. Apollo Books, Stenstrup, 219–238.

Medvedev GS (1998) New species of tenebrionid beetles of the tribe Blaptini (Coleoptera, Tenebrionidae) from Hissaro-Darvaz Mountains and the Plateau of Tibet [in Russian]. Entomologicheskoe Obozrenie 77(3): 555–586.

Medvedev GS (2001) Evolution and system of darkling beetles of the tribe Blaptini (Coleoptera, Tenebrionidae). Meeting in memory of NA Cholodkovsky, ISS 53, St. Petersburg, 332 pp.

Medvedev GS (2004) New species of tenebrionids of the tribe Blaptini (Coleoptera, Tenebrionidae) from India, Nepal and China) [in Russian]. Entomologicheskoe Obozrenie 83(1): 163–189.

Pierre F (1961) Expédition francaise au Jannu (Népal Oriental). ColeopteraTenebrionidae. Bulletin de la SociétéEntomologique de France 66: 212–214.

Ren GD, Ba YB, Liu HY, Niu YP, Zhu XC, li Z, Shi AM (2016) Fauna Sinica. Insecta. Vol. 63. Coleoptera: Tenebrionidae (I). Science Press, Beijing, 532 pp.

Ren GD, Wang XP, Yu YZ (2000) Nine new records and one new species of the tribe Blaptini from China (Coleoptera: Tenebrionidae). Journal of Hebei University (Natural Science Edition) 20: 26–33.

Simmons RB, Weller SJ (2001) Utility and evolution of cytochrome b in insects. Molecular Phylogenetics and Evolution 20: 196–210. https://doi.org/10.1006/mpev.2001.0958

Simon C, Frati F, Bekenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87(6): 651–701. https://doi.org/10.1093/aesa/87.6.651