Filling the BINs of life: Report of an amphibian and reptile survey of the Tanintharyi (Tenasserim) Region of Myanmar, with DNA barcode data

Daniel G. Mulcahy; Justin L. Lee; Aryeh H. Miller; Mia Chand; Myint Kyaw Thura; George R. Zug

doi:10.3897/zookeys.757.24453

Research Article

Filling the BINs of life: Report of an amphibian and reptile survey of the Tanintharyi (Tenasserim) Region of Myanmar, with DNA barcode data

Daniel G. Mulcahy^‡, Justin L. Lee^§, Aryeh H. Miller^|, Mia Chand^¶, Myint Kyaw Thura^#, George R. Zug^‡

‡ National Museum of Natural History, Smithsonian Institution, Washington, DC, United States of America

§ University of Maryland, College Park Maryland, United States of America

| University of North Carolina, Asheville, United States of America

¶ College of William & Mary, Williamsburg, United States of America

# Myanmar Environment Sustainable Conservation, Yangon, Myanmar

Corresponding author: Daniel G. Mulcahy ( mulcahyd@si.edu )

Academic editor: Johannes Penner

This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation: Mulcahy DG, Lee JL, Miller AH, Chand M, Thura MK, Zug GR (2018) Filling the BINs of life: Report of an amphibian and reptile survey of the Tanintharyi (Tenasserim) Region of Myanmar, with DNA barcode data. ZooKeys 757: 85-152. https://doi.org/10.3897/zookeys.757.24453

ZooBank: urn:lsid:zoobank.org:pub:559E4F4F-7C35-4380-89D5-BA42A5D38004

Abstract

Despite threats of species extinctions, taxonomic crises, and technological advances in genomics and natural history database informatics, we are still distant from cataloguing all of the species of life on earth. Amphibians and reptiles are no exceptions; in fact new species are described nearly every day and many species face possible extinction. The number of described species continues to climb as new areas of the world are explored and as species complexes are examined more thoroughly. The use of DNA barcoding provides a mechanism for rapidly estimating the number of species at a given site and has the potential to record all of the species of life on Earth. Though DNA barcoding has its caveats, it can be useful to estimate the number of species in a more systematic and efficient manner, to be followed in combination with more traditional, morphology-based identifications and species descriptions. Herein, we report the results of a voucher-based herpetological expedition to the Tanintharyi (Tenasserim) Region of Myanmar, enhanced with DNA barcode data. Our main surveys took place in the currently proposed Tanintharyi National Park. We combine our results with photographs and observational data from the Chaung-nauk-pyan forest reserve. Additionally, we provide the first checklist of amphibians and reptiles of the region, with species based on the literature and museum. Amphibians, anurans in particular, are one of the most poorly known groups of vertebrates in terms of taxonomy and the number of known species, particularly in Southeast Asia. Our rapid-assessment program combined with DNA barcoding and use of Barcode Index Numbers (BINs) of voucher specimens reveals the depth of taxonomic diversity in the southern Tanintharyi herpetofauna even though only a third of the potential amphibians and reptiles were seen. A total of 51 putative species (one caecilian, 25 frogs, 13 lizards, 10 snakes, and two turtles) were detected, several of which represent potentially undescribed species. Several of these species were detected by DNA barcode data alone. Furthermore, five species were recorded for the first time in Myanmar, two amphibians (Ichthyophis cf. kohtaoensis and Chalcorana eschatia) and three snakes (Ahaetulla mycterizans, Boiga dendrophila, and Boiga drapiezii).

Keywords

Anura , biodiversity, Gymnophiona , Thai-Malay Peninsula, natural history, Southeast Asia, species diversity, Squamata , Testudines , Thailand

Introduction

Despite advances in technologies, warnings of taxonomic crises, and increased interest in taxonomy (Mallet and Willmott 2003, Tautz et al. 2003), scientists are still trying to provide an accurate measure of global biodiversity in terms of absolute numbers of extant species of life on Earth (e.g. Costello et al. 2013, Caley et al. 2014, Wilson 2017). Amphibians and reptiles are no exceptions to groups with accurate estimates of extant species because new species are described nearly every day and estimates suggest ca. 30% of amphibians (Stuart et al. 2004) and ca. 20% of reptiles (Böhm et al. 2013) may be threatened. The benefits of knowing and understanding global biodiversity are enormous and span fields of human interest from agriculture, pest management, disease control, natural products, conservation, and wildlife management. Many of the discrepancies in estimates are the result of non-statistical calculations (i.e. “simple best guesses”), statistical calculation that contain wide ranges of error (e.g. “+/- three million”), and estimates that do not build on one another, and overlap with previous analyses (Giller 2014). Furthermore, without careful comparisons of known material (voucher specimens), estimates of unknown species may contain significant overlap with currently recognized species (synonymies). Certainly, in this age of genomics and bioinformatics, we have the ability to accurately measure and record global species diversity with resources like the Encyclopedia of Life (EOL), Tree of Life projects (e.g. http://www.tolweb.org/tree/), the Barcode of Life Database (BOLD), GenBank, and taxonomic specific databases such as Amphibian Species of the World 6.0 (ASoW, Frost 2017) and the Reptile Database (Uetz et al. 2018). To confound matters, there have been recent requests to regulate and standardize practices in taxonomy (Garnett and Christidis 2017), which has stirred debate on the theoretical aspects of species and the practicality of regulating ‘taxonomic freedom’ (Raposo et al. 2017). While issues of regulating taxonomic actions remain unresolved, DNA barcoding (Hebert et al. 2003a) offers a standardized mechanism for measuring biodiversity at the species level and a database to manage it (BOLD). However, DNA taxonomy has many caveats and limitations, such as proposed thresholds of percent sequence divergence vary among groups, and it is less effective among recently diverged groups (Lipscomb et al. 2003; Tautz et al. 2003), and we are still a long way from obtaining a complete DNA barcode library of life of Earth. Currently, the BOLD database contains DNA barcodes for approximately 275,000 formally described species of fungi, plants, and animals (http://www.boldsystems.org/index.php, queried 11 February 2018), of the approximately 1.5 million catalogued (only ~18%), and of the ~7 million estimated (< 3%) species (Caley et al. 2014).

The use of DNA barcoding offers a starting point for recording the number of species of life on Earth (Hebert et al. 2003a, 2000b). The concept of a database containing representatives of every species with a common molecular marker, shared among all living organisms (though different for plants and animals) for comparison is attractive. Once a reference library is established, it provides researchers with resources of numerous possibilities, ranging from agriculture, ecological and environmental studies, biodiversity surveys, conservation, food and drug administration, and the prevention of wildlife trafficking. In animals, the DNA barcode is a portion of the mitochondrial DNA gene cytochrome oxidase subunit 1 (COI); different markers are used for plants (chloroplast DNA), fungi, etc. Furthermore, a system of Barcode Index Numbers (BINs) has been developed to assist in specimen identifications, by using several algorithms to compare COI data, combining sequences into operational taxonomic units (OTUs), which likely correspond to biological species (Ratnasingham and Hebert 2013). Investigators can quickly compare COI sequences in a database (BOLD) and rapidly determine whether their samples are unique, or similar to described, or even un-described species, thus eliminating or reducing the number of synonymies in species estimates. For example, if one identifies a species as “sp. A” and if they, or someone else identifies other individuals of the same species and refers to them as “sp. B,” this creates a synonymy. This is why it is important to compare newly acquired material with all available data, and to maintain current usage of place-holding names. For example, a researcher might identify a specimen to be the same species as “sp. A” of another study (e.g. Diechmann et al. 2017). By DNA barcoding newly discovered species, one can quickly verify its degree of difference via the BINs, only if other closely related species are also barcoded. The BINs are automatically generated if the sequences are deposited in BOLD, and new sequences will be placed in existing BINs if within ~2%, or new BINs will be created; discordant BINs (e.g. a single BIN with specimens bearing different names) are flagged and easily identified. However, there are several caveats to consider when evaluating whether a BIN represents a legitimate species, or whether a BIN is discordant because of disagreements on higher-level classification (e.g. constantly changing generic names). Additionally, some wide-ranging, genetically variable species may occupy multiple BINs. A point worth noting is that the BINs are not formally named (i.e., they do not bear species names), thus they provide an objective, standardized measure of comparison for evaluating species boundaries.

Presently, there are approximately 518,000 BINs, representing ~180,000 formally described animal species currently in BOLD. This indicates that there are currently only DNA barcodes for a fraction of formally described animal species (< 10%), and BINs for ~338,000 un-described animal species (granted legitimate species may occupy several BINs, thus reducing the estimated number of BINs of undescribed species). Contributions of DNA barcodes for known taxa (identified to species by traditional morphological characters – and complemented with molecular DNA data) are appreciated and can be provided in terms of “data release papers” (e.g. Zuniga et al. 2017). However, current researchers conducting biodiversity surveys, particularly of poorly known taxonomic groups, and groups also poorly represented by DNA barcode data, are left with the challenge of identifying cryptic species diversity using whatever molecular data is available (e.g. Stuart et al. 2006a). This identification must be done with some level of taxonomic expertise, where the specimens in hand are compared with species descriptions, and sequence data aligned with known reference material (e.g. GenBank). When multiple OTUs, or clades, are discovered among specimens identified with the same name, careful comparisons must be made to the original type descriptions, geographic distributions, and genetic data. As cryptic species are revealed, original descriptions of species and their geographic ranges must be modified to account for current taxonomic understanding. Nevertheless, there is a pressing need for biodiversity surveys in many parts of the world, and especially including groups in taxonomic disarray such as amphibians.

Here, we provide an example by incorporating DNA barcode data with biodiversity inventory survey data of amphibians and reptiles collected in a poorly known region of the world, the Tanintharyi Region of Myanmar (the ‘Tenasserim’). This includes one of the most poorly known vertebrate groups in terms of taxonomy – anurans in Southeast Asia. Prior to this study, there were only 1259 anuran species with DNA barcodes in BOLD for the approximately 7727 currently recognized species of anurans known globally (Frost 2017). Specifically, we set out to determine how many species occur at our study site. We surveyed a region within the proposed Tanintharyi National Park near the village of Yeybu (Fig. 1), conducting day and night surveys, collecting representative voucher specimens with tissue samples for genetic analyses. We used DNA barcoding in conjunction with traditional methods to assist in our specimen identifications, not to delimit species (Collins and Cruickshank 2013). In the process, we discovered what likely represent new, undescribed species, ‘species discovery’ (Collins and Cruickshank 2013). We recommend the use of additional data and analyses to formally evaluate, describe, and recognize potential species identified with the barcode data. Here, we combine our survey results with a shorter survey in an area to the south, near the village of Chaung-nauk-pyan (Fig. 1), consisting of reserve forest and a recently slash and burned area, where only photographs and other observations were made. Our results show how the use of DNA barcode data can augment and increase the accuracy of biodiversity inventory surveys and suggest caution should be taken when identifications are made solely on morphological identifications, particularly for some of the more cryptic species complexes of anurans in this region. We offer our protocol and results as a model for others working with groups in taxonomic disarray. Finally, we provide the first comprehensive checklist of amphibians and reptiles of the region (excluding marine species) based on our results, distinguished by DNA barcode verification versus observation only, and other expected species based on museum records and the literature.

Figure 1.

Map of Tanintharyi Region, Myanmar. The Tanintharyi Nature Reserve, north of Dawei, and the Lampi National Park, island northwest of Kawthoung, are officially designated as national parks in Myanmar. The other areas in Myanmar are proposed as national parks (Protected Areas) or being considered for future protection (Reserve Forests). The main survey reported here was conducted in the Yeybu area of the proposed Tanintharyi National Park (triangles: Forest 1–2 and Gardens sites). A shorter survey, with fewer people, was conducted in the Reserve Forest near the Chaung-nauk-pyan area (diamonds: Forest 3 and slash & burnt sites) and is also included in this report. Map provided by Grant M. Connette of the Smithsonian Conservation Biology Institute (SCBI).

Methods

The Tanintharyi

Tanintharyi is the southern-most political division of Myanmar, now formally known as the Tanintharyi Region. This region occupies about the southern two-thirds of the former colonial British administrative unit of Tenasserim; the northern portion is now Mon State. Biological surveys of Tanintharyi have been limited in postcolonial times owing to political disagreements and military activities. The last herpetofaunal summary of Tanintharyi is Theobald’s 1868 report. The Myanmar Herpetological Survey (MHS) was permitted access to southernmost Tanintharyi (Kawthaung area) in 2002 and again to north-central Tanintharyi (Dawei area) in 2009 and 2010. Since then political change has allowed broader access. The Tenasserim, or Tanintharyi, contains type localities for at least seven amphibian and seven reptile species. Some of these, referenced near “Moulmein” (= Mawlamyine) are in present-day Mon State, while others, referenced near Dawei, "Mergui" (= Myeik), and the “Valley of the Tenasserim” are in the Tanintharyi Region. Theobald (1868) provided the first and last report of the amphibians and reptiles of the Tenasserim. Other researchers have reported on the occurrence of individual species or sets of species but no single attempt has been made to review the herpetofauna of the entire region. We joined Fauna & Flora International’s biodiversity survey team in June 2014 to provide a preliminary assessment of the amphibian and reptile biodiversity survey in the proposed Tanintharyi National Park, of southern Myanmar. We realize that a rapid assessment survey would sample at best only a quarter to a third of the herpetofauna (Zug 2011) and only the species active in the early monsoon. The timing of this survey emphasizes amphibian species. The details of the sites are presented below in the survey itineraries. We supplement our morphological identifications with DNA barcoding. We provide COI data to build upon the taxonomic representation in BOLD and the Barcode Index Number system (BINs). We also include 16S data that can be directly compared with currently available published sequences in GenBank to provide better molecular identifications of our specimens. Many sequences in GenBank are incorrectly identified, which subsequently pollutes the database, especially so among Southeast Asian anurans. Tracking voucher specimen information can sometimes be difficult or nearly impossible if the information was not appropriately provided or was lost. Therefore, we attempt to exemplify how to efficiently review the taxonomy on a species-group basis, compare specimen morphology to species descriptions, genetic data with GenBank and BOLD records, evaluate those records, and how to interpret proper taxonomic nomenclatural assignments.

Lacking a recent review for the Tanintharyi, we relied on reptile and amphibian checklists and studies of Thailand (Nabhitabhata et al. 2004, Pauwels et al. 2002, Pauwels and Chan-ard 2006, Matsui et al. 2005a, Vogel et al. 2009, Grismer et al. 2010, Chan-ard and Makchai 2011, Ohler et al. 2011, Grismer et al. 2012, Sumontha et al. 2012, Grosjean et al. 2015a, Grismer et al. 2016, 2017, Wood et al. 2017, Pauwels et al. 2000, 2009), reports from other regions in Myanmar (Dowling and Jenner 1988, Zug et al. 2006a, b, 2007), and recent work in the Tanintharyi (e.g. Wilkinson et al. 2012, Connette et al. 2017, Mulcahy et al. 2017; Zug et al. 2017; Lee et al. 2018). An earlier report by Pauwels et al. (2002) for Phang-nga Province, Thailand, was south of the southern tip of Tanintharyi and below the Isthmus of Kra, which is useful for comparison of species that may cross the isthmus and occur in the southernmost Tanintharyi. We compiled a comprehensive species list of amphibians and reptiles documented in the Tanintharyi, either by our collections, observations, or specimens at the California Academy of Sciences (CAS). We also generated some DNA barcode data for specimens previously collected in Myanmar from the National Museum of Natural History, Smithsonian Institution (USNM) and CAS tissue collections. Some of the specimens we barcoded remain in the Myanmar Biodiversity Museum (MBM) in Hlawga National Park, north of Yangon. These specimens have yet to be catalogued at the MBM; therefore, we refer to them as MBM-Collector Number (e.g. MBM-JBS 19825). Comments on the occurrence and biological aspects of single species or groups of related species are included in the individual species accounts below. The Red List Status for each species was taken from www.iucnredlist.org on 9 March 2018.

Team members

The survey team for the proposed Tanintharyi National Park area comprised Myint Kyaw Thura (ENCA), Daniel G. Mulcahy (NMNH-SI)) and Thaw Zin, for the Reserve Forest area Myint Kyaw Thura and Thaw Zin.

Survey itineraries and sites

1) Proposed Tanintharyi National Park – Yeybu area (Fig. 1). The survey team traveled to Myeik (12.4359°N, 98.5941°E, 7 m ASL; all latitude and longitude coordinates were taken with WGS84 datum) on 4 June 2014, hired a 4wd vehicle and drove to Tegu, then hired a boat to Yeybu on 5 June. Yeybu village (12.3927°N, 99.1044°E) is about 168 km northeast of Myeik. The village is 500 m east of the Tanintharyi River. On 6 June, the team with porters and cooks walked in and established the first camp (“Forest 1”: 12.4345°N, 99.1442°E, 93 m ASL) alongside Yeybuchaung-ngal (ngal = stream). Our searching for amphibians and reptiles was conducted within a 500 m radius of the camp, principally along the creek and its smaller feeder streams owing to the absence of trails through the dense forest. The team moved upstream to a second camp (“Forest 2”: 12.4478°N, 99.1621°E, 116 m ASL) on 10 June. Exceptionally heavy monsoonal rain on 12 June and rapidly rising stream level forced the team’s return to the eastern edge of Yeybu village, where they used the cook’s house as the third camp (“Gardens”: 12.4039°N, 99.1312°E, 30m ASL) and searched for amphibians and reptiles in this area through the morning of 16 June, and then returned by boat to Tegu, whence by 4wd vehicle to Myeik. The first and second camps were within the evergreen forest. At both sites bamboo was a dominant feature of the vegetation and the canopy was closed, or nearly so. The third survey site was open agricultural land, principally of small gardens, orchards, and numerous small temporary ponds along the floodplain of the Tanintharyi River. Total survey time was 10 days, voucher specimens were taken.

2) Reserve forest – Chaung-nauk-pyan area (Fig. 1). A smaller survey team (over a shorter period) traveled by road from Myeik to the village of Chaung-nauk-pyan on 4 July 2014 and whence by foot the following day to a degraded evergreen forest site, approximately 4.25 km southwest of the village. Surveys at this site (“Forest 3”: 11.7574°N, 99.0730°E, 49m ASL) occurred from 5 July through the morning of 7 July when they shifted to a recently cleared secondary forest site (“Slash & burnt”: 11.7573°N, 99.0945°E, 67m ASL) and searched for amphibians and reptiles for the next 24 hours, returning to Chaung-nauk-pyan on the afternoon of 8 July and returned to Myeik on 10 July. Total survey time was four days. Captured frogs and reptiles were photographed and released at the site of capture.

Collections of amphibians and reptiles were made at four sites: hotel in Myeik (commensal); Yeybuchaung-ngal stream Camp 1 (Forest 1); Yeybuchaung stream Camp 2 (Forest 2); and vicinity of Yeybu village (Gardens). Only observations and photographs were taken at two sites: near the village of Chaung-nauk-pyan in a Reserve Forest (Forest 3) and nearby in a recently cleared site (Slash & burnt). Dates and latitude and longitude coordinates are identified above in the itinerary. The survey protocol was visual searching along Yeybuchang-ngal stream and its smaller side-branches. The stream was searched both during the day and at night (with flash-lights and head lamps). All amphibians were captured by hand; reptiles by hand, rubber-bands, sling-shots (catapults), and snake tongs for large or dangerous species. Transport of specimens from the field to the camp was done in plastic bags for amphibians and cloth bags for reptiles. Unique individuals were usually photographed. All specimens to be retained as vouchers were euthanized following IUCAC protocols, with a drop of 5% benzocaine on the head (amphibians) or into the oral cavity (reptiles). Genomic tissue samples (piece of liver and/or muscle) were taken from all specimens. The genomic samples were harvested prior to formalin preservation; each sample was place in individual 1.5 ml tube with salt-saturated ethylene-diamine-tetracetic acid/ Dimethyl sulfoxide (EDTA/DMSO) buffer for long-term storage and future genetic analyses modified from Seutin et al. (1991) with 25% DMSO instead of 20% (Mulcahy et al. 2016). Specimens were individually tagged with a unique field number and preserved in 10% formalin. Voucher specimens and tissues were deposited at the National Museum of Natural History, Smithsonian Institution (USNM) collection.

Molecular data

We attempted several rounds of PCR and sequencing for each specimen collected, with the exception of four Odorrana hosii Boulenger and three Ansonia thinthinae Wilkinson, Sellas, & Vindum. In addition to our samples from our expedition, we DNA barcoded 108 additional specimens of amphibians from previous USNM collections in Myanmar, mostly northern states, to verify if these were the same species that we collected in the Tanintharyi. Tissue of these specimens are from the USNM tissue collection and were initially collected into 95% EtOH and subsequently stored at -80 °C. Extractions of genomic DNA from all specimens were performed on an AutoGenprep 965 (2011 AutoGen, Inc.), using standard phenol manufacturer protocols. Genomic DNA was eluted in 100 µl of AutoGen R9 re-suspension buffer. Polymerase chain reactions (PCR) were conducted for the mtDNA large ribosomal subunit (rrnL: 16S) and cytochrome oxidase subunit I (COI) using the primers: 16Sar 5’ CGCCTGTTTATCAAAAACAT 3’ and 16Sbr 5’ CCGGTCTGAACTCAGATCACGT 3’ (Palumbi et al. 1991) and COI-ReptBCF 5’ TCAACAAACCAYAAAGAYATYGG 3’ and COI-ReptBCR 5’ TAAACTTCAGGGTGGCCRAARAATCA 3’ (Castañeda and de Queiroz 2011). For some specimens, we also sequenced either part of the ND2 gene using the primers L4437–H5934 (Macey et al. 1997) or 12S (12SI: 5’ TGCCAGCAGYCGCGGTTA 3’ and 12SIII 5’ AGAGYGRCGGGCGATGTGT 3’; Puillandre et al. 2009) in order to compare with sequences available for these, or closely related species in GenBank. The PCRs were performed in 96-well plates, in 10 µl reactions, following protocols “3.6 PCR Methods: Amplification” and “3.8 PCR Purifications: EXOSAP-IT” of Weigt et al. (2012), with annealing temperatures of 54 °C for 16S and 12S, 48 °C for COI, and 52 °C for ND2. Sequence reactions were performed in 96-well plates with the PCR primers using BigDye^® Terminator v3.1 Cycle Sequencing Kit’s in 0.25 × 10 µl reactions and run on an Automated ABI3730 Sequencer (2011 Life Technologies). Raw chromatograms were edited in Sequencher v5.1 (2012 Gene Codes Corp.), complementary strands were aligned, and COI was inspected for proper translation, alignments were done using the MUSCLE option in Sequencher. Neighbor-joining (NJ) trees were generated in PAUP* v4.0b10 (Swofford, 2002) for the 16S and COI data separately, and of the combined data. Scale bars at bottom of each tree represent uncorrected p-distances.

Specimen identification

Sequences for uncertain taxa were further assessed by multiple methods. First, we considered specimens placed in the same COI BINS (Ratnasingham and Hebert 2013) to represent the same species. Specimens placed in separate BINs from different geographic localities, which grouped together in the NJ trees, and that were indistinguishable based on morphology, were considered the same species with genetic variation associated with geography. Specimens that were placed in separate BINs that were either different morphologically or did not group together (i.e. grouped with other taxa) in the NJ trees, were considered different species. For specimens that we could not identify based on COIBINs, we created alignments with material from GenBank representing the same genera with as many species as possible. Neighbor-joining trees were estimated from these alignments at the family-level. This was mostly done for amphibians using 16S sequence data from GenBank. The 16S locus is known to evolve much slower than protein-encoding mitochondrial loci. Therefore, our assessments of specimen identification based on 16S data were done on a case-by-case basis, considering the geographic distance between specimens being compared and whether or not our specimens met the morphological description of the species they clustered with.

Results

Our compiled list of species documented in the Tanintharyi contains 46 amphibians and 110 reptiles, including one caecilian, 45 anurans, 100 squamates (42 lizards and 58 snakes), and 10 turtles (Table 1). Results from our surveys in the Tanintharyi represent total observations of 51 species, 43 species (24 amphibians and 19 reptiles) in the proposed Tanintharyi National Park area, and eight additional species (one amphibian and seven reptiles) in the lowland areas (Table 1). We produced COI DNA barcode data for 297 specimens (GenBank MG935416–MG935712) and 16S data for 292 specimens (GenBank MG935713–MG936004), representing 72 species (55 amphibians and 17 reptiles), including 25 amphibians and 17 reptiles observed in the Tanintharyi (Table 1) and an additional 30 species of amphibians from northern Myanmar from our reference material (Table 2). Eleven of the species barcoded from the northern Myanmar material were also discovered in the Tanintharyi. Our COI sequences were placed into 93 BINs, of which 18 already existed. The BIN results are only mentioned in the text below if sequences went into pre-existing BINs, or if specimens of the same species were placed in separate BINs. In total, we provide sequence data for 81 species of amphibians and reptiles (Fig. 2). We provide accounts for each species observed in the Tanintharyi below, with additional comments on the reference material from northern Myanmar. The following descriptions offer brief characterization of the specimens vouchered and examined; the general distributions contain condensed and abstracted geographic data derived from ASoW (Frost 2017) and the Reptile Database (Uetz et al. 2018); both accessed 20–21 January 2018. All species were recorded in the Yeybu area unless otherwise noted. Species only observed in the Forest Reserve (Chaung-nauk-pyan area) are noted in the Natural History Notes. See Table 1 for a complete list of species observed at each site.

Figure 2.

Combined (16S and COI) Neighbor-joining tree for all specimens sequenced in this study.

Figure 2.

Continued.

Figure 2.

Continued.

Table 1.

Download as

CSV

XLSX

The herpetofauna of southern Tanintharyi. Marine or estuarine species are excluded. Occurrence data is derived from the California Academy of Sciences (CAS) or our observations; only species identification for the Tanintharyi Proposed National Park (PNP) area and a few of the Reserve Forest (RF) species were confirmed by specimen examination and DNA barcode data. Abbreviations: D = Dawei area, K = Kawthaung area, M = Myeik, ? = have specimens but not identified to species and/or DNA barcoding needed to confirm identification; + species present; – species absent; √ DNA barcoded.

Order	Family – Subfamily/Species	CAS	PNP Area^‡	RF
ANURANS	Bufonidae
	Ansonia thinthinae	D	√	–
	Duttaphrynus melanostictus	DK	–	–
	Ingerophrynus parvus	DK	√	+
	Phrynoidis asper	DK	√	+
	Ceratobatrachidae
	Alcalus tasanae	K	–	–
	Dicroglossidae – Dicroglossinae
	Fejervarya sp. (hp2)	?	√	–
	Fejervarya sp. (hp3)	?	√	+
	Hoplobatrachus rugulosus	D	–	–
	Limnonectes blythii	DK	√	+
	Limnonectes doriae	DK	√	+
	Limnonectes hascheanus	DK	–	–
	Limnonectes kohchangae	D	–	–
	Limnonectes laticeps	K	–	–
	Limnonectes limborgi	D	√	–
	Limnonectes macrognathus	D	–	–
	Dicroglossidae – Occidozyginae
	Ingerana tenasserimensis	D	√	–
	Occidozyga lima	?	√	–
	Occidozyga martensii	DK	√	+
	Megophryidae
	Leptobrachium smithi	DK	–	–
	Megophrys sp.	D	–	–
	Microhylidae – Kalophryninae
	Kalophrynus interlineatus	D	–	–
	Microhylidae – Microhylinae
	Kaloula latidisca	D	√	–
	Kaloula pulchra	DK	–	M√
	Microhyla berdmorei	DK	–	–
	Microhyla butleri	?	√	–
	Microhyla heymonsi	DK	√	–
	Microhyla fissipes	?	√	+
	Microhyla pulchra	D	–	–
	Micryletta inornata	DK	–	–
	Ranidae
	Amolops marmoratus	D	–	–
	Amolops panhai	D	√	–
	Chalcorana eschatia	?	√	–
	Clinotarsus alticola	DK	–	–
ANURANS	Hydrophylax leptoglossa	D	–	–
	Hylarana erythraea	DK	√	–
	Odorrana hosii	K	√	–
	Odorrana livida	D	√	–
	Sylvirana malayana	?	√	–
	Sylvirana nigrovittata	DK	–	–
	Rhacophoridae – Rhacophorinae
	Chirixalus vittatus	D	–	–
	Nyctixalus pictus	K	–	–
	Polypedates mutus	?	√	–
	Polypedates leucomystax	DK	√	+
	Rhacophorus cyanopunctatus	D	–	–
	Rhacophorus verrucosus	D	–	–
	Theloderma phyrnoderma	D	–	–
CAECILIANS	Ichthyophiidae
CAECILIANS	Ichthyophis cf. kohtaoensis	DK	√	–
TESTUDINES	Geoemydidae
	Cyclemys dentate	D	–	–
	Testudinidae
	Indotestudo elongata	–	+	–
	Trionychidae – Trionychinae
	Dogania subplana	–	+	–
	Nilssonia formosa	D	–	–
SQUAMATES – LIZARDS	Agamidae
	Acanthosaura crucigera	DK	√	–
	Bronchocela burmana	K√	–	–
	Calotes emma	DK	√	+
	Calotes “versicolor”	DK	–	–
	Draco blanfordii	DK	√	–
	Draco maculatus	DK	–	–
	Draco taeniopterus	DK	–	+
	Gekkonidae
	Cyrtodactylus brevipalmatus	D	–	–
	Cyrtodactylus lenya	√	–	–
	Cyrtodactylus oldhami	DK	–	–
	Cyrtodactylus payarhtanensis	√	–	–
	Gehyra mutilata	DK	–	–
	Gekko gecko	DK	√	+
	Hemidactylus frenatus	DK	–	M√
	Hemidactylus garnotii	DK	√	–
	Hemidactylus karenorum	?	–	–
	Hemidactylus platyurus	K	–	–
	Hemidactylus tenkatei	K	–	M√
	Lacertidae
	Takydromus sexlineatus	–	√	–
	Scincidae
	Dasia olivacea	K√	–	–
	Eutropis longicauda	?	–	–
SQUAMATES – LIZARDS	Eutropis macularia	DK	√	–
	Eutropis multifasciata	DK	√	+
	Lipinia vittigera	DK	–	–
	Lygosoma bowringii	K	–	–
	Scincella reevesi	D	–	–
	Sphenomorphus maculatus	DK	√	+
	Tropidophorus robinsoni	DK	–	–
	Varanidae
	Varanus rudicollis	–	+	–
SQUAMATES – SNAKES	Acrochordidae
	Acrochordus granulatus	D	–	–
	Colubridae – Colubrinae
	Ahaetulla mycterizans	K	√	–
	Ahaetulla fronticincta	D	–	–
	Ahaetulla prasina	DK	–	+
	Boiga cyanea	DK	–	–
	Boiga dendrophila	–	√	–
	Boiga drapiezii	K	√	–
	Boiga multomaculata	D	–	–
	Boiga siamensis	D	–	–
	Coelognathus radiatus	M	–	–
	Dendrelaphis formosanus	K	–	–
	Dendrelaphis haasi	D	–	–
	Dendrelaphis pictus	D	–	+
	Dendrelaphis striatus	DK	–	+
	Dryocalamus subannulatus ^†	–	–	–
	Gonyosoma oxycephalum	D	–	–
	Lycodon aulicus	D	–	–
	Lycodon subcinctus	D	–	–
	Colubridae – Natricinae
	Rhabdophis chrysargos	DK	√	–
	Rhabdophis nigrocinctus	D	–	+
	Xenochrophis piscator	D	√	+
	Xenochrophis punctulatus	D	–	–
	Xenochrophis trianguligerus	DK	√	–
	Elapidae
	Bungarus sp.	K	–	–
	Calliophis maculiceps	D	–	–
	Hydrophis schistosus	D	–	–
	Naja kaouthia	–	–	+
	Homalopsidae
	Cantoria violacea	D	–	–
	Homalopsis semizonata	D	–	–
	Cerberus rynchops	D	–	–
	Fordonia leucobalia	D	–	–
	Lamprophiidae – Pseudaspidinae
	Psammodynastes pulverulentus	DK	–	–
SQUAMATES – SNAKES	Pareatidae
	Pareas carinatus	DK	–	–
	Pareas macularius	D	–	–
	Pareas margaritophorus	?	–	–
	Pythonidae
	Malayopython reticulatus	–	+	–
	Typhlopidae
	Indotyphlops braminus	D	–	–
	Uropeltidae
	Cylindrophis burmanus	K	–	–
	Viperidae – Crotalinae
	Trimeresurus purpureomaculatus	DK	–	–
	Trimeresurus stejnegeri	K	–	–
	Trimeresurus sp.^§	√	–	–
	Xenopeltidae
	Xenopeltis unicolor	D	–	–

^‡Most of the species observed in the proposed National Park were vouchered and barcoded. Four taxa (Dogania cartilaginea, Indotestudo elongata, Varanus rudicollis, and Malayopython reticulatus) were seen in possession of locals and only photos were taken. At the Reserve Forest sites, specimens were identified in field and released after being photographed.

^§See Mulcahy et al. (2017) for a taxonomic treatment of the Trimeresurus in the Tanintharyi.

^†See Lee et al. (2018).

Table 2.

Download as

CSV

XLSX

Additional species for which DNA barcodes were generated from the reference material from northern Myanmar. Asterisks indicate species also detected in the Tanintharyi Region.

Family	Species	State/Province
Ichthyophiidae	Ichthyophis multicolor	Ayeyawady
Bufonidae	Duttaphrynus melanostictus	Sagaing
Dicroglossidae	Fejervarya sp. (BFL2007)	Sagaing
	Fejervarya sp. (BFL2007)	Magway
	Fejervarya sp. A (DGM2018)	Sagaing
	Fejervarya sp. A (DGM2018)	Mandalay
	Fejervarya sp. (hp2)*	Yangon
	Fejervarya sp. (hp2)*	Bago
	Fejervarya sp. (hp3)*	Bago
	Hoplobatrachus litoralis	Yangon
	Hoplobatrachus litoralis	Bago
	Hoplobatrachus rugulosus	Sagaing
	Ingerana tenasserimensis*	Mon State
	Limnonectes doriae*	Yangon
		Bago
		Mon State
	Limnonectes limborgi*	Bago
	Limnonectes limborgi*	Mon State
Dicroglossidae	Limnonectes longchuanensis	Mandalay
	Occidozyga lima*	Mandalay
	Occidozyga lima*	Sagaing
	Occidozyga sp. A (DGM2018)	Yangon
	Occidozyga sp. B (DGM2018)	Yangon
	Occidozyga sp. C (DGM2018)	Bago
	Sphaerotheca breviceps	Sagaing
Megophryidae	Leptobrachium smithi	Mon State
Megophryidae	Leptolalax sp. A (DGM2018)	Mandalay
Microhylidae	Glyphoglossus molossus	Sagaing
	Kalophrynus anya	Sagaing
	Kaloula pulchra*	Yangon
		Bago
		Sagaing
		Mandalay
	Microhyla berdmorei	Yangon
	Microhyla berdmorei	Bago
	Microhyla fissipes*	Yangon
		Sagaing
		Bago
		Mandalay
		Magway
	Microhyla heymonsi*	Bago
	Microhyla heymonsi*	Mandalay
	Microhyla sp. A (DGM2018)	Sagaing
	Microhyla sp. B (DGM2018)	Magway
Ranidae	Amolops marmoratus	Mon State
	Humerana humeralis	Bago
	Hylarana erythraea*	Yangon
	Hylarana lateralis	Yangon
	Hylarana lateralis	Sagaing
	Hylarana sp. A	Sagaing
	Hylarana tytleri	Bago
	Odorrana cf. chloronota	Mandalay
	Odorrana livida*	Mon State
	Sylvirana nigrovittata	Mon State
	Sylvirana nigrovittata	Mandalay
	Sylvirana lacrima	Mandalay
Rhacophoridae	Chiromantis sp. A (DGM2018)	Sagaing
	Chiromantis doriae	Mandalay
	Polypedates teraiensis	Yangon
		Sagaing
		Bago
	Rhacophorus rhodopus	Mandalay

Caecilians

Ichthyophiidae – Asian caecilians (Suppl. material 1: Fig. 1)

Molecular Data

Our specimens are genetically similar to one another (99.6% identical) and, based on 16S data are placed in a clade with other I. parvus, though showing substantial genetic differences (91–94% identical) from GenBank material (AB746455 and AB530649–51). GenBank specimens are from Malaysia, suggesting either this may represent a species complex, or this represents a single species that shows high genetic diversity, possibly attributed to a low dispersal rate of a leaf-litter species.

Specimens examined

USNM 586867–868.

Red List status

LC.

Phrynoidis asper (Gravenhorst, 1829)

Asian Giant Toad Fig. 3A

Description

Three adult males 103.0, 104.3, 104.5 mm SVL, and juvenile 34.5 mm SVL.

Figure 3.

Myanmar and western and peninsular Thailand.

Molecular Data

We included other individuals from Yangon (USNM 587326–27, and CAS 248173), Bago (USNM 587093 and 587097), and Mon (USNM 587303 and 587306) states. These were placed into three COIBINs, one for the Yangon and Bago specimens (ADG3667), one for the Mon State specimens (ADG3666), and one for the Tanintharyi specimens (AAB2123). All of these specimens formed a 16S clade with a specimen from GenBank (GU934330) identified as L. doriae from Myanmar, Pegu (CAS 208425) and another specimen identified as “L. nitidus” from peninsular Thailand (Grosjean et al. 2015b; KR827897), a species known only from the Cameron Highlands and Fraser’s Hills, of Peninsular Malaysia. The type locality for L. doriae is northern Tenasserim, near Mawlamyine, between the Tanintharyi and northern individuals. We note that Grosjean et al. (2015b) did not report having any L. doriae in their study, a species that extends onto the Thai-Malay Peninsula. Therefore, we consider the Tanintharyi specimens, the CAS specimens, and the Grosjean et al. (2015b)L. nitidus to be L. doriae.

Specimens examined

USNM 586911–919, USNM 587326–27, USNM 587093, USNM 587097, USNM 587303, USNM 587306, CAS 248173.

Red List status

Limnonectes limborgi (Sclater, 1892)

Limborg’s Fanged Frog

Description

A single juvenile, 24.8 mm SVL.

Natural history notes

Found along forest stream.

General Distribution

Northwestern Myanmar and adjacent Thailand.

Molecular Data

We included two individuals, one each from Bago (USNM 587100) and Mon (USNM 587305) states. Each specimen was placed in its own COIBIN. These all form a single clade in our combined analysis (Fig. 2). These specimens all form a 16S clade with a large number of L. limborgi from GenBank (GU934334–36, GU934339–48, GU934353–55, and GU934357–65). Our Tanintharyi specimen (USNM 586920) is at the base of this L. limborgi clade, with a sequence in GenBank (AB981417) from Malaysia and the two are quite different from the rest of the clade that contains specimens from Malaysia and northern Myanmar. The type locality for L. limborgi is the “Tenasserim”, Myanmar. Thus, this clade likely represents multiple species that needs further investigation. Our Tanintharyi specimen represents the closest sampled to the type locality.

Specimens examined

USNM 586920, USNM 587100, USNM 587305

Red List status

Additional Limnonectes

We sequenced an additional specimen (MBM-USNM-FS 36471) from Mandalay Region and it was placed in a 16S clade with specimens representing a newly described species, L. longchuanensis, from China and northern (Kachin, Chin, and Sagaing) Myanmar (Suwannapoom et al. 2016).

NE.

Additional dicroglossids

We sequenced several other dicroglossids for comparison, including three specimens of Hoplobatrachus tigerinus from Yangon (USNM 587325, USNM 587404) and Bago (MBM-USNM-FS 35607). These were placed in a 16S clade with specimens from GenBank labeled as H. cf. tigerinus MS 2009 (AB530502 and AB543600) and MS 2011 (AB671173–81). These specimens are now considered to be H. litoralis, a recently described species from Cox’s Bazar district of Bangladesh (Hasan et al. 2012b), which extends the range of this species into Myanmar. Our 16S sequences range from 2.0–3.5% sequence divergence from the Bangladesh sequences, including one of the paratypes (AB671174). Two specimens of Hoplobatrachus rugulosus from Sagaing (USNM 520480, USNM 524038) were sequenced and placed in a 16S clade with other individuals in GenBank identified as H. rugulosus. We sequenced two individuals of Sphaerotheca breviceps from Sagaing (USNM 524020, USNM 537466) that were placed in a 16S clade with individuals in GenBank identified as S. breviceps.

Megophryidae

Though we did not encounter any megophryid frogs during our surveys, we sequenced one Leptobrachium smithi (USNM 572047) from Mon State and one Leptolalax (USNM 572048) from Mandalay. There are three species of Leptolalax known to occur in Myanmar (fide Frost 2017): L. lateralis, L. melanoleucus, and L. pelodytoides. The 16S data from our specimen is 90% similar to four species in GenBank (L. bourreti, L. fuliginosus, L. petrops, and L. tengchongensis), while it ranges from 85–89% similar to L. melanoleucus and L. pelodytoides. No L. lateralis genetic data are available for comparison; however, this species is known only from northern Myanmar, from Bhamò to Nagaland, northeastern India. We tentatively refer to our specimen as Leptolalax sp. A.

USNM 586970.

Red List status

LC.

Additional Sylvirana/Hylarana

We sequenced several other individuals from northern Myanmar identified as Sylvirana/Hylarana sp. We found several clades of “S. nigrovittata” in our 16S tree. We sequenced two individuals from Mon State (USNM 583176 and USNM 583178) and one from Mandalay (USNM 583174) that were identified as S. menglaensis and were placed in two COIBINs (Mon and Mandalay). The Mandalay specimen was placed in a BIN with nine other individuals, seven identified as H. menglaensis, and two as S. nigrovittata. The COI data placed these individuals in a clade with other S. menglaensis for which COI data were available, with the BINs forming clades, with other clades of specimens identified as S. menglaensis. These were all placed in a 16S clade containing other specimens identified as S. menglaensis in GenBank (KR827810–22, Grosjean et al. 2015b). Sheriden and Stuart (2018) placed S. menglaensis in synonymy with S. nigrovittata. We sequenced three additional specimens from Mandalay (USNM 583124, USNM 583126, and MBM-USNM-FS 36020). These specimens were placed in their own COIBIN and in a 16S clade, nearly identical to two individuals identified as Hylarana sp. C MS-2010 (AB543604–5, Hasan et al. 2012a) from Bangladesh, and two sequences in GenBank (KR264116–7), from the same series as ours (USNM 583124–5) identified as Sylvirana cf. nigrovittata (Oliver et al. 2015). Our sequences differ by two base-pairs from the ones in GenBank, including USNM 583124 (Oliver et al. 2015). We sequenced this specimen twice and provide the raw trace files in BOLD. There are many other 16S sequences in GenBank identified as Sylvirana nigrovittata elsewhere in the tree, but no other COI sequences to compare. Sheriden and Stuart (2018) described specimens of this clades as a new species S. lacrima, and our specimens fall out within this clade (not shown).

Rhacophoridae – Whipping Frogs (Suppl. material 1: Fig. 7)

Polypedates cf. leucomystax (Gravenhorst, 1829)

White-lipped Tree Frog

Description

Three immature females 61.7, 62.8, 69.7 mm, adult female 82.0, and two adult males 45.7, 45.8 mm SVL.

Natural history notes

Two species of Polypedates were found in a rural landscape during heavy rains. At the time of collection, all specimens (six adult males and ten females) were assumed to represent a single species and the location of individual specimens was not noted, though all were collected from the same flooded fields. The results from the barcode analysis revealed that two genetic lineages were present in the total Polypedates sample, and one of lineages was represented by only males and the other by only females. The males (45.3–50.2 mm SVL) have the vocal sacs open although there is no indication externally (i.e., stretched throat skin and pigmented) and the testes are enlarged. The majority (n = 9) of the females range from 60.7–70.0 mm SVL; their oviducts have only begun to enlarge and the follicles within the ovaries are small and presumably pre-vitellogenic or in early vitellogenesis; a single large female 82.0 mm SVL has mature oviducts and ovarian follicles are well yolked but not pigmented. All females have distinct dark brown longitudinal stripes (commonly broken) on the dorsum; stripes are absent or reduced on most of the males. Additionally, the lower lip of the females is black bordered and immaculate in the males. It is notable that without the barcode data, we would have interpreted the vouchers as a single species with distinctly smaller males and larger females. The reproductive data suggest that the smaller species breeds early in the monsoon and the larger one in the late monsoon or early dry season.

General Distribution

Widespread in South Asia, eastern India to southwestern China through Southeast Asia to the Greater Sunda Islands and Philippine Islands.

Molecular Data

Our specimens were placed in their own COIBIN, and were placed at the base of a large 16S clade of P. leucomystax, from GenBank (sensu Kuraishi et al. 2012). These specimens may represent a new species, closely related to P. leucomystax (see comments below). For now, we refer to them as P. cf. leucomystax.

Comments

Initially, the specimens collected were considered to represent a single species, but the DNA barcoding revealed two distinct lineages. The P. leucomystax complex of frogs remains contentious. Several recent studies have produced 16S (e.g. Kuraishi et al. 2012, Pan et al. 2013) and COI (Buddhachat and Suwannpoom 2018) sequence data, resolving some of the issues within this group. Our Tanintharyi frog loosely fits the morphological description of the P. leucomystax. Our clade was placed sister to the COIPolypedates cf. leucomystax clade of Buddhachat and Suwannpoom (2018; not shown) However, a detailed morphological comparison and additional sequence data are supporting our lineage represents a new species that occurs from northern Tanintharyi, and further to the north in Myanmar (Wilkinson, Mulcahy, Zug, in prep.).

Specimens examined

USNM 587003–7008

Red List status

Polypedates leucomystax is listed as LC.

Polypedates mutus (Smith, 1940) Burmese

Whipping Frog

Description

All individuals are immature; six females 59.9–66.6 mm, three males 45.3–50.3, and a sex indeterminate specimen 45.2 mm SVL (n=10).

Natural history notes

See preceding species account.

General Distribution

Tanintharyi Myanmar, Thailand, Yunnan and Guangxi, China.

Molecular Data

The second clade of our Polypedates, and an additional specimen from Mandalay (USNM 587059) were placed in a COIBIN with four individuals from Thailand identified as Polypedates sp. Our specimens were placed in a 16S clade with individuals identified as P. impresus (Pan et al. 2013) and Polypedates cf. mutus 2 of Kuraishi et al. (2012). Note, older specimens in GenBank in this clade are labeled as P. leucomystax, P. megacephalus, and P. sp. The very recently published paper examining Thailand species of Polypedates with COI data (Buddhachat and Suwannpoom 2018) identified five major clades in the P. leucomystax complex. Our specimens were placed in their “Northern A Polypedates sp.” clade (not shown). Our ongoing work (Wilkinson, Mulcahy, Zug, in prep.) suggests that this clade represents P. mutus senus stricto (the P. mutus 1 clade of Kuraishi et al. 2012).

Specimens examined

USNM 587009–018, USNM 587059.

Red List status

LC.

Additional rhacophorids

We sequenced three individuals initially identified as Polypedates teraiensis from Sagaing (USNM 524030), Yangon (USNM 587048), and Bago (587049). These were all placed in their own COIBIN and in a 16S clade with specimens from GenBank identified as P. teraiensis (AB530512–21) and two individuals (AB728167–8) labeled P. leucomystax, presumably misidentified. Additionally, we sequenced three additional specimens initially identified as Chiromantis spp. Two specimens (USNM 560923, USNM 560927) from Mandalay initially identified as C. hansenae, were placed in their own COIBIN and in a 16S clade with other individuals from GenBank identified as Chiromantis doriae. There is considerable genetic variation among the C. doriae specimens in GenBank, indicating that C. doriae as currently used is a species complex in need of revision. The third specimen (USNM 524023) from Sagaing was initially identified as C. nongkhorensis, but was placed at the base of the 16S clade containing C. nongkhorensis and C. doriae specimens from GenBank (Aowphol et al. 2013). This specimen may represent a new species; however, we treat it as Chiromantis sp. A for now.

Testudines

Testudinidae – tortoises

Indotestudo elongata (Blyth, 1853)

Elongate Tortoise Fig. 4A

Description

A shell of this species was seen in Yeybu village. Carapace length (straight) was approximately 22 cm; sex indeterminate owing to absence of a plastron. Nine distinct growth annuli were visible on the second right pleural scute.

Figure 4.

Selected turtles and lizards found during this study’s expedition. A Indotestudo elongata (USNM HerpImage 2896) B Dogania subplana (USNM HerpImage 2897) C Acanthosaura crucigera (USNM 587019) D Eutropis multifasciata (USNM 587035) E Takydromus sexlineatus (USNM 587034) F Calotes emma (USNM 587022). Photos A & C by Daniel G. Mulcahy, all others by Myint Kyaw Thura.

Natural history notes

The tortoise from which the shell was derived was presumably from the adjacent forest.

General Distribution

Widespread, Nepal, northern peninsular and Northeast India to Southeast Asia into northernmost West Malaysia.

Molecular Data

No molecular data available.

Specimens examined

The specimen was found in a camp and photo vouchered. USNM Herp Image 2896

Red List status

EN (Endangered); CITES Appendix II.

Trionychidae – softshell turtles

Dogania subplana (Saint Hilaire, 1809)

Hillstream Softshell Turtle Fig. 4B

Description

No measurements were taken.

Natural history notes

Uncertain origin, but presumably from the nearby river.

General Distribution

Myanmar and Thailand through Peninsular Malaysia, south to Sumatra, Java, and Borneo.

Molecular Data

No molecular data available.

Comments

This individual was seen in Yeybu village. No measurements were taken.

Specimens examined

USNM Herp Image 2897

Red List status

LR/LC (Low Risk/Least Concern; needs updating); CITES Appendix II.

Squamata - Lizards

Agamidae – spiny lizards (Suppl. material 1: Fig. 8)

Acanthosaura crucigera Boulenger, 1885

Masked Prickly-naped Lizard Fig. 4C

Description

Specimens examined

USNM 587024–026.

Red List status

NE.

Gekkonidae – geckos (Suppl. material 1: Figs 9–10)

Gekko gecko (Linnaeus, 1758)

Tokay Gecko

Description

Molecular Data

Two specimens initially thought to be H. frenatus were placed at the base of the H. frenatusCOI tree (see above), these were each placed in their own COIBIN. We then sequenced the ND2 locus (GenBank MG948675 and MG944816) for these individuals to align with the sequences from Kathriner et al. (2014). Our specimens were each placed in one of the H. tenkatei clades of Kathriner et al. (2014). See Suppl. material 1: Fig. 10 for the ND2 tree.

Comments

Kathriner et al. (2014) have demonstrated that the Be Burmese specimens of this taxon from Yangon and Tanintharyi associate genetically with H. tenkatei from Timor and other Sundan areas.

Specimens examined

USNM 587028–29.

Red List status

NE.

Lacertidae – grass lizards

Takydromus sexlineatus Daudin, 1802

Long-tailed Grass Lizard Fig. 4E

Description

Small adult female 48.2 mm SVL, 94 mm TailL tip regenerated; 10.8 mm HeadL; 44% TrunkL/SVL, 12% CrusL/SVL, 22% HeadL/SVL, 52% HeadW/HeadL, 38% HeadH/HeadL, 45% SnEye/HeadL, 29% SnW/HeadL.

There are no vouchers to confirm this field identification. Because these specimens were observed in the slash & burnt site versus the forest and lack vouchers, we tentatively accept the field identification.

Specimens examined

Field observation by Myint Kyaw Thura; captured for confirmation of identification and then released.

Red List status

Sphenomorphus maculatus (Blyth, 1853)

Asian Spotted Forest Skink

Description

Two adult males 49.9–54.7 mm SVL, 97–98 regenerated mm SVL; 11.5–12.2 mm HeadL; 45–48% TrunkL/SVL, 54–55% HindlL/SVL, 22–23% HeadL/SVL, 62–63% HeadW/HeadL, 44–46% HeadH/HeadL, 39–40% SnEye/HeadL, 33–34% EyeEar/HeadL.

Natural history notes

Seen and captured among forest leaf litter.

General Distribution

Widespread, Nepal to western China southward through Myanmar and Southeast Asia into Peninsular Malaysia.

Molecular Data

Our COI sequences are 7.1–7.5% divergent from specimens in BOLD from Vietnam (not publicly available). Our 16S sequences are 100% identical to a specimen in GenBank (AB028821) from Kaeng Krachan, Thailand (Honda et al. 2000b) and were placed with this individual and other S. maculatus in GenBank.

Specimens examined

USNM 587038–039.

Red List status

NE.

Varanidae – monitor lizards

Varanus rudicollis (Gray, 1845)

Rough-necked Monitor

Description

Sex unknown, 57.0 cm SVL, 70.0 cm TailL.

General Distribution

Southern Myanmar and Thailand through Malay Peninsula into Greater Sunda Islands.

Molecular Data

No molecular data available.

Comments

Captured by a villager (Yeybu); photographed; likely subadult or adult.

Specimens examined

USNM Herp Image 2891

Red List status

NE; CITES II.

Snakes

Pythonidae – pythons

Malayopython reticulatus (Schneider, 1801) Reticulated Python

Fig. 5A

Description

Female, maturity uncertain, 119 cm SVL, 18.5 cm TailL.

Figure 5.

Selected snakes found during this study’s expedition. A Malayopython reticulatus (USNM HerpImage 2892) B Ahaetulla mycterizans (USNM 587040) C Dendrelaphis pictus (USNM HerpImage 2893) D Boiga dendrophila (USNM 587041) E Xenochrophis trianguligerus (USNM 587045) F Rhabdophis chrysargos (USNM 587044) G Rhabdophis nigrocinctus (USNM HerpImage 2894) H Naja kaouthia (USNM HerpImage 2895). Photos A–B, D–F by Daniel G. Mulcahy, C, H–I by Myint Kyaw Thura.

Natural history notes

The specimen was collected in a fisherman’s net, in the stream, near Camp 1.

General Distribution

Widespread, Bangladesh through Southeast Asia to Philippines and the Maluku Islands.

Molecular Data

No molecular data available.

Comments

We note that the genus name Broghammerus is not nomenclaturally available for the Reticulated Python, because it was promulgated in a herpetological blog, which did not and does not meet the International Nomenclatural Code’s criteria for the valid establishment of formal taxonomic names. A recent study (Reynolds et al. 2014) has proposed the name Malayopython for the clade containing the M. reticulatus and M. timoriensis.

Specimens examined

Specimen remained in FFI field office in Yangon, but it was subsequently destroyed.

Specimens examined

USNM Herp Image 2892

Red List status

NE; CITES II.

Field observation by Myint Kyaw Thura; captured for confirmation of identification, photographed and then released.

Specimens examined

USNM Herp Image 2893

Red List status

NE.

Earlier country-wide herpetofaunal surveys of Myanmar indicate that X. trianguligerus occurs only in Tanintharyi.

Specimens examined

USNM 587045.

Red List status

LC.

Elapidae – cobras and kraits

Naja kaouthia (Lesson, 1831)

Monocled Cobra (Fig. 5H)

Description

Juvenile, not sexed or measured; field identification.

Natural history notes

Found in human-disturbed habitats. Field observation at Forest 3 site by Myint Kyaw Thura; photographed for confirmation of identification and then released.

General Distribution

Widespread, Nepal and northern peninsular India to Southeast Asia and southern China.

Molecular Data

No molecular data available.

Specimens examined

USNM Herp Image 2895

Red List status

LC; CITES II.

Discussion

DNA Barcode data

The DNA barcode data greatly improved our estimate of species numbers in the Tanintharyi, within anurans in particular, similar to another recent study using DNA barcode data for estimating species diversity (Diechmann et al. 2017). The placement of sequences from individual specimens of the same genus into multiple COIBINs indicated it was likely that multiple species were collected. For instance, collections at the edge of the forest and on the Tanintharyi River floodplain, at the eastern edge of Yebu Village, yielded multiple anuran specimens identified initially as four morphospecies in four genera (Polypedates, Microhyla, Fejervarya, and Occidozyga). However, DNA barcoding and comparisons with our northern Myanmar reference material revealed each genus was likely represented by two to three species. We determined this based on the fact that at least one of the Tanintharyi clades (within each genus) grouped with specimens from the north, rather than with the other clades (of the respective genus) in the Tanintharyi. This increased our total number of species from four to ten. We note that the short sequence data from DNA barcode data, while useful for determining relationships among closely related groups, such as these cases of populations within genera, falls short at resolving higher-level relationships. For instance, even our combined dataset (COI + 16S) fails to recover several families as monophyletic, such as Microhylidae and Dicroglossidae, and even fails to recover some genera as monophyletic, such as Xenochrophis (Fig. 2). Whereas analyses with more complete taxonomic sampling, more loci, and more robust analyses recover these families as monophyletic (e.g. de Sá et al. 2012).

The DNA barcode data allowed us to identify several cryptic species of anurans in multiple genera and families, including Rhacophoridae: Polypedates – two species in the Tanintharyi, and a third in the north; Microhylidae: Microhyla – three species in the Tanintharyi, all of those and a three more species in the north; Dicroglossidae: Fejervarya – two species in the Tanintharyi, and two in the north; and Occidozyga – three species in the Tanintharyi, one of the same and three additional species in the north. Likewise, we were able to determine the number of species present at the forest sites based on the COI barcode data, in the family Dicroglossidae: Limnonectes – three species in the Tanintharyi, two of the same and a fourth in the north; the family Microhylidae: Kaloula – two species in the Tanintharyi, one also occurring in the north; Ranidae: Hylarana – one species in the Tanintharyi and the north, and three additional species in the north; Odorrana – two species in the Tanintharyi, one of these and a third in the north. Because a comprehensive COI barcode library is lacking for southeast Asian anurans, we relied on 16S sequence data as a supplemental barcode marker to help identify specimens to species based on comparisons with known material published in GenBank. The inclusion of the 16S data allowed us to compare our specimens with published material in GenBank, and enabled us to identify several specimens to named species (e.g. Limnonectes blythii, L. doriae, L. limborgi, and L. longchuanensis, Microhyla berdmorei, M. butleri, M. fissipes, and M. heymonsi), including several recently described species (Hoplobatrachus litoralis, Kaloula latidisca), and some recently identified, but not formally described, species such as Fejervarya sp. ‘hp2–3’ (Kotaki et al. 2010), Fejervarya sp. BFL 2007 (Islam et al. 2008, Hasan et al. 2012a), and Sylvirana sp. C ‘MS-2010’ (Hasan et al. 2012a), as well as some of our own new discoveries (Fejervarya sp. A, Occidozyga spp. A–D, Leptolalax sp. A, Microhyla spp. A–B, and Chiromantis sp. A). The use of the DNA barcode database (BOLD) allows us to “BIN” these un-named species, such that researchers conducting future expeditions can compare their specimens to ours to determine if they are the same un-named species, “known unknowns”, or yet newly discovered un-named species “unknown unknowns” (Collins and Cruickshank 2014). Traditional, morphological species descriptions need to follow in order to properly assess the biodiversity of this region. However, this process can be slow, requires taxonomic expertise, and is less supported by many academic institutions. Given the high rate of putative cryptic species, particularly among anuran genera, we issue caution when using morphological identifications alone, as in the Reserve Forest areas presented in this study. The fact remains that guide books of the region (SE Asia) that attempt to include morphological identifications contain overlapping character descriptions (e.g. Grismer 2011), or lack identifications altogether (e.g. Koch 2012). Once more robust taxonomic treatments of each group are conducted, more reliable morphological diagnoses may become available.

A recent study suggests that species delimitations based solely on mtDNA may be misleading, and over-estimating species in biodiversity studies (Chan et al. 2017). We maintain that our method, preliminary as it is because it acts as a triage assessment, is still a valid method in rapid biodiversity surveys for a number of reasons. First of all, it may be better to over-estimate species diversity in rapid biodiversity surveys, rather than under-estimating in order to secure proper protection of the area. Secondly, this method may be valid because estimates made using this method may be correct and documenting the accurate number of species. Thirdly, even if species numbers are over-estimated, recognizing several lineages (or operational taxonomic units, OTUs) at a minimum recognizes the genetic diversity in a lineage (if they are later determined to represent the same species), and is thus beneficial from a conservation-genetics point of view. And fourthly, rapid assessments identifying potential cryptic species can direct future research to taxonomic groups in need of further investigation. It is largely for this reason that we recommend the use of place-holder names, such as “sp. A” until more in-depth investigations can be conducted, including additional taxonomic and geographic sampling, and additional markers (e.g. nuclear). In reality, the forests may disappear before such in-depth analyses can be conducted, as each group (e.g. genus) may require essentially a dissertation chapter’s-worth of work (e.g. Chan et al. 2017), and for the number of groups covered in this report, for example, may take over a decade to complete, by which time the forests could be gone (Connette et al. 2017).

Important absences and presences in the Tenasserim

Our brief surveys are inadequate to address the presence or absence of all potential members of the southern Tanintharyi herpetofauna. Studies of the herpetofauna of the Myanmar Central Dry Zone at the Chatthin Wildlife Sanctuary (Zug et al. 1998, Zug 2011) had a team of four regular members with the assistance of the entire Sanctuary staff. Even with all these eyes and hands and with weekly transect surveys and monthly drift-fence trapping, 40–41 weeks were required to record 90% of the Chatthin herpetofauna, and previously undocumented species were still being discovered in the third and final year of that survey. We especially note that nine species of turtles have been recorded on the Thailand side of the Tanintharyi mountain range. Crocodilians were not expected owing to shallowness of the streams in the immediate area of the survey.

At this stage of our inventory of the Tanintharyi proposed National Park and its environs, we wish to emphasize the discovery of taxa previously undocumented for Myanmar. Surprisingly these undocumented taxa include only two amphibians (Ichthyophis cf. kohtaoensis and Chalcorana eschatia) and three species of snakes (Ahaetulla mycterizans, Boiga dendrophila, and Boiga drapiezii; see Lee et al. 2015). None of these taxa were reported from Phetchaburi Province, the Thailand province immediately east of our survey site. They all represent species whose primary distribution is south of the Isthmus of Kra; the two Boiga were reported in Pauwels et al. (2000) survey of Phang-Nga Province, Thailand.

Some recently described taxa were also detected in Myanmar based on our study, including the likely occurrence of Kaloula latidisca, a species recently described from Peninsular Malaysia (Chan et al. 2014). As we included the reference material from more northern Myanmar, we identified species that have not been previously detected in Myanmar. This includes the dicroglossid Hoplobatrachus litoralis, a recently described species from Cox’s Bazar district of Bangladesh (Hasan et al. 2012b), which now includes two specimens from the Yangon area and one from Mon State, extending the range of this species from Bangladesh to south-central Myanmar. In total, the formally threatened species according to the IUCN Red List encountered include two anurans (Ansonia thinthinae, Limnonectes blythii), and the following represent CITES II species: two turtles (Indotestudo elongata), a lizard (Varanus rudiocolis), and two snakes (Naja kaouthia and Malayopython reticulatus).

Conclusion

The use of DNA barcoding allowed us to determine how many species were present at the site of our biodiversity inventory survey. The inclusion of the supplementary marker 16S allowed us to assign several individuals to named species for which 16S data were available for comparison (whereas the COI reference library is less complete), and to identify others as previously identified, undescribed species. The use of the DNA barcode database (BOLD) allows us to “BIN” these un-named species, such that researchers conducting future expeditions can compare their specimens to ours to determine if they are the same un-named species. Biodiversity research needs more “boots on the ground,” because an incomplete taxonomy hinders our ability to protect biodiversity and guide conservation (Wilson 2017). As we proceed to fill the “BINs of life,” we will eventually be able to record and catalogue all species of life on Earth. We encourage researchers to continue to add to these databases, and most importantly, to update existing records as our knowledge increases.

Acknowledgements

The herpetofaunal surveys were proposed and directed by Flora & Fauna International–Myanmar Programme (FFI). In country funding was provided by this organization; travel to and from Myanmar was supported by the National Museum of Natural History, Smithsonian Institution (NMNH-SI) Grand Challenges Consortia Award (to Melissa Songer). Laboratory expensed were provided by NMNH-SI Global Genome Initiative (GGI). All of the laboratory and/or computer work were conducted in and with the support of the L.A.B. facilities of the NMNH. We thank the NMNH-SI Internship program for hosting authors JLL and AHM to collect measurements of many of the amphibian and reptile voucher specimens, and the NMNH-SI Youth Engagement through Science (YES!) Program for hosting M. Chand for DNA barcoding the specimens. We appreciate and thank the director and staff of the Nature and Wildlife Conservation Division, Forestry and Environmental Conservation Ministry, for permission to conduct the survey and to allow the export specimens to permit accurate identification. Thaw Zin provided exceptional assistance in the collection and preparation of voucher specimens. The cook, U Win, allowed us to share his home and access to the garden habitats thereabout at camp 3. We thank Zin Win Htun (Nature and Wildlife Conservation Division, The Republic of the Union of Myanmar) for his escort service into the proposed park area, and Aung Lin (FFI), for his guidance and logistical support. We also thank Frank Momberg and Mark Grindley (FFI), for organizing the survey, arranging for the various government authorizations that allowed the survey team to concentrate on the survey and to allow study of specimens at the NMNH-SI for accurate identification of the vouchers. We thank Grant M. Connette (SCBI) for providing the map for Figure 1. We thank L.L. Grismer, T. Nguyen, and O.S.G. Pauwels for constructive comments and corrections on the manuscript. JLL thanks D. Lee and P. Lee for their constant support. GRZ’s research into the biology and evolution of Asian herpetofauna has received support from numerous sources: The Smithsonian Scholarly Studies Program, and NMNH-Research Opportunities Fund, Biodiversity. Additionally, GRZ’s home institution, the Smithsonian Institution and the NMNH, have provided him with decades of research support through its many bureaus, offices, branches, and especially from its collections management staff. GRZ thanks P. Zug for her continuing support in data collection and entry.

References

Aowphol A, Rujirawan A, Taksintum W, Arsirapot S, McLeod DS (2013) Re-evaluating the taxonomic status of Chiromantis in Thailand using multiple lines of evidence (Amphibia: Anura: Rhacophoridae). Zootaxa 3702: 101–123. http://dx.doi.org/10.11646/zootaxa.3702.2.1

Barley AJ, Datta‐Roy A, Karanth KP, Brown RM (2015) Sun skink diversification across the Indian–Southeast Asian biogeographical interface. Journal of Biogeography 42: 292–304. https://doi.org/10.1111/jbi.12397

Biju SD, Garg S, Mahony S, Wijayathilaka N, Senevirathne G, Meegaskumbura M (2014) DNA barcoding, phylogeny and systematics of Golden-backed frogs (Hylarana, Ranidae) of the Western Ghats-Sri Lanka biodiversity hotspot, with the description of seven new species. Contributions to Zoology 83: 269–335.

Blackburn DC, Siler CD, Diesmos AC, McGuire JA, Cannatella DC, Brown RM (2013) An adaptive radiation of frogs in a southeast Asian island archipelago. Evolution 67: 2631–2646. https://doi.org/10.1111/evo.12145

Blyth E (1853) Notices and descriptions of various reptiles, new or little-known. Part I. J. Asiatic Society of Bengal 22: 639–655.

Boie F (1827) Bemerkungen über Merrem’s Versuch eines Systems der Amphibien, 1. Lieferung: Ophidier. Isis van Oken 20: 508–566.

Böhm M, Collen B, Baillie JEM, Bowles P, Chanson J et al. (2013) The conservation status of the world’s reptiles. Biological Conservation 157: 372–385. https://doi.org/10.1016/j.biocon.2012.07.015

Boulenger GA (1884) Descriptions of new species of reptiles and batrachians in the British Museum. Part. II. Annals and Magazine of Natural History, Series 5, 13: 396–398. https://doi.org/10.1080/00222938409459259

Boulenger GA (1885) Catalogue of the Lizards in the British Museum I. Geckonidae, Eublepharidae, Uroplatidae, Pygopodidae, Agamidae. London, 450 pp.

Boulenger GA (1887) An account of the reptiles and batrachians obtained in Tenasserim by M.L. Fea of the Genoa Civic Museum. Annali del Museo Civico di Storia Naturale di Genova. Serie 2, 5: 474–486.

Boulenger GA (1891) On new or little-known Indian and Malayan reptiles and batrachians. Annals and Magazine of Natural History, Series 6, 8: 288–292. https://doi.org/10.1080/00222939109460437

Boulenger GA (1900) Descriptions of new batrachians and reptiles from the Larut Hills, Perak. Annals and Magazine of Natural History, Series 7, 6: 186–193. https://doi.org/10.1080/00222930008678356

Boulenger GA (1920) A monograph of the South Asian, Papuan, Melanesian and Australian frogs of the genus Rana. Records of the Indian Museum 20: 1–226. https://doi.org/10.5962/bhl.title.12471

Blyth E (1856) Report for October Meeting, 1855. Journal of the Asiatic Society of Bengal 24: 711–723.

Caley MJ, Fisher R, Mengersen K (2014) Global species richness estimates have not converged. Trends in Ecology & Evolution 29: 187–188. https://doi.org/10.1016/j.tree.2014.02.002

Castañeda MdR, de Queiroz K (2011) Phylogenetic relationships of the Dactyloa clade of Anolis lizards based on nuclear and mitochondrial DNA sequence data. Molecular phylogenetics and evolution.61: 784–800. https://doi.org/10.1016/j.ympev.2011.07.004

Chan KO, Blackburn DC, Murphy RW, Stuart BL, Emmett DA, Ho CT, Brown RM (2013) A new species of narrow-mouthed frog of the genus Kaloula from eastern Indochina. Herpetologica 69: 329–341. https://doi.org/10.1655/HERPETOLOGICA-D-12-00094

Chan KO, Grismer LL, Brown RM (2014) Reappraisal of the Javanese Bullfrog complex, Kaloula baleata (Müller, 1836) (Amphibia: Anura: Microhylidae), reveals a new species from Peninsular Malaysia. Zootaxa 3900: 569–580. http://dx.doi.org/10.11646/zootaxa.3900.4.7

Chan KO, Alexander AM, Grismer LL, Su Y-C, Grismer JL, Quah ESH, Brown RM (2017) Species delimitation with gene flow: A methodological comparison and population genomics approach to elucidate cryptic species boundaries in Malaysian Torrent Frogs. Molecular Ecology 2017: 5435–5450. https://doi.org/10.1111/mec.14296

Chan-ard T, Makchai S (2011) A new insular species of Cyrtodactylus Gray, 1827 (Squamata, Gekkonidae), from the Surin Islands, Phang-nga Province, southern Thailand. The Thailand Natural History Museum Journal 5: 7–15.

Collins RA, Cruickshank RH (2013) The seven deadly sins of DNA barcoding. Molecular Ecology Resources 13: 969–975. https://doi.org/10.1016/j.tree.2014.02.002

Collins RA, Cruickshank RH (2014) Known knowns, known unknowns, unknown unknowns, and unknown knowns in DNA barcoding: A comment on Dowton et al. Systematic Biology 63: 1005–1009. https://doi.org/10.1093/sysbio/syu060

Connette GM, Oswald P, Thura MK, Connette KJL, Grindley ME, Songer M, Zug GR, Mulcahy DG (2017) Rapid forest clearing in a Myanmar proposed national park threatens two newly discovered species of geckos (Gekkonidae: Cyrtodactylus). PLOS ONE 12: e0174432. https://doi.org/10.1371/journal.pone.0174432

Costello MJ, May RM, Stork NE (2013) Can we name Earth’s species before they go extinct? Science 339: 413–416. https://doi.org/10.1126/science.1230318

Daudin FM (1802) Histoire Naturelle, générale et particulièredes reptiles, ouvrage faisant suite, à l’histoire naturelle, générale et particulière composée par Le clerc de Buffon, et rédigée par Sonnini CS, vol. 3. F. Dufart, Paris.

de Sá RO, Streicher JW, Sekonyela R, Forlani MC, Loader SP, Greenbaum E, Richards S, Haddad CFB (2012) Molecular phylogeny of microhylid frogs (Anura: Microhylidae) with emphasis on relationships among New World genera. BMC Evolutionary Biology 12: 241. http://www.biomedcentral.com/1471-2148/12/241

Dever JA, Fuiten AM, Konu Ö, Wilkinson JA (2012) Cryptic torrent frogs of Myanmar: An examination of the Amolops marmoratus species complex with the resurrection of Amolops afghanus and the identification of a new species. Copeia 2012: 57–76. https://dx.doi.org/10.1643/CH-10-180

Diechmann J, Mulcahy DG, Vanthomme H, Tobi E, Wynn AH, Zimkus BM, McDiarmid RW (2017) How many species and under what names? Using DNA barcoding and GenBank data for West Central African amphibian conservation. PLOS ONE 12: e0187283. https://doi.org/10.1371/journal. pone.0187283

Dowling HG, Jenner JV (1988) Snakes of Burma: Checklist of reported species and bibliography. Smithsonian Herpetological Information Service 76: 1–19. https://doi.org/10.5479/si.23317515.76.1

Dubois A (1992) Notes sur la classification des Ranidae (Amphibiens anoures). Bulletin Mensuel de la Société Linnéenne de Lyon 61: 305–352. https://doi.org/10.3406/linly.1992.11011

Duméril AMC, Bibron G (1836) Erpetologie Générale ou Histoire Naturelle Complète des Reptiles. Vol. 3. Librairie Encyclopédique Roret, Paris, 528 pp.

Frost DR (2017) Amphibian species of the world: An online reference. Version 6.0 (Oct. 2017). American Museum of Natural History, New York, USA. http://research.amnh.org/herpetology/amphibia/index.html

Garnett ST, Christidis L (2017) Taxonomy anarchy hampers conservation. Nature 546: 25–27. https://www.nature.com/news/taxonomy-anarchy-hampers-conservation-1.22064 https://doi.org/10.1038/546025a

Geoffroy SH (1809) Mémoire sur les tortues molles. Nouveau Bulletin des Sciences, Société Philomathique de Paris 22: 363–367.

Giller G (2014) Are we any closer to knowing how many species there are on Earth? Scientific American April 8: 2014. https://www.scientificamerican.com/article/are-we-any-closer-to-knowing-how-many-species-there-are-on-earth/

Gmelin JF (1789) Caroli a Linné Systema naturae. Tomus 1 Pars III. Leipzig, 1033–1516.

Gravenhorst JLC (1829) Deliciae Musei Zoologici Vratislaviensis. Fasciculus primus. Chelonios et Batrachia. Leopold Voss, Leipzig.

Gray JE (1831) Description of two new genera of frogs discovered by John Reeves, Esq. in China. Zoological Miscellany, Part 1: 38.

Gray JE (1845) Catalogue of the specimens of lizards in the collection of the British Museum. Trustees of the British Museum/Edward Newman, London, 289 pp.

Gray JE (1853) Descriptions of some undescribed species of reptiles collected by Dr. Joseph Hooker in the Khassia Mountains, East Bengal, and Sikkim Himalaya. Annals and Magazine of Natural History 12: 386–392. https://doi.org/10.1080/03745485709495063

Grismer LL (2011) Amphibians and Reptiles of the Seribuat Archipelago (Peninsular Malaysia): A field guide. Edition Chimaira, Frankfurt am Main, 239 pp.

Grismer LL, Sumontha M, Cota M, Grismer JL, Wood Jr. PL, Pauwels OSG, Kunya K (2010) A revision and redescription of the rock geckoCnemaspis siamensis (Taylor 1925) (Squamata: Gekkonidae) from Peninsular Thailand with descriptions of seven new species. Zootaxa 2576: 1–55. www.mapress.com/zootaxa/2010/f/z02576p055f.pdf

Grismer LL, Wood Jr. PL, Quah ESH, Anuar S, Muin MA, Sumontha M, Ahmad N, Bauer AM, Wangkulangkul S, Grismer JL, Pauwels OSG (2012) A phylogeny and taxonomy of the Thai-Malay Peninsula Bent-toed geckos of the Cyrtodactylus pulchellus complex (Squamata: Gekkonidae): combined morphological and molecular analyses with descriptions of seven new species. Zootaxa 3520: 1–55. http://www.mapress.com/j/zt/article/view/14344

Grismer LL, Wood Jr. PL, Aowphol A, Cota M, Murdoch ML, Aguilar C, Grismer MS (2016) Taxonomy, phylogeny, and distribution of Bronchocela rayaensis (Squamata: Agamidae) on the Thai-Malay Peninsula. Zootaxa 4092: 414–420. http://www.mapress.com/j/zt/article/view/zootaxa.4092.3.6

Grismer LL, Wood Jr. PL, Aowphol A, Cota M, Grismer MS, Murdoch ML, Aguilar C, Grismer JL (2017) Out of Borneo again and again: biogeography of the Stream Toad genus Ansonia Stoliczka (Anura: Bufonidae) and the discovery of the first limestone cave dwelling species. Biological Journal of the Linnean Society 120: 371–395. https://doi.org/10.1111/bij.12886

Grosjean S, Bordoloi S, Chuaynkern Y, Chakravarty P, Ohler A (2015a) When young are more conspicuous than adults: a new ranid species (Anura: Ranidae) revealed by its tadpole. Zootaxa 4058: 471–498. http://dx.doi.org/10.11646/zootaxa.4058.4.2

Grosjean S, Ohler A, Chuaynkern Y, Cruaud C, Hassanin A (2015b) Improving biodiversity assessment of anuran amphibians using DNA barcoding of tadpoles. Case studies from Southeast Asia. Comptes Rendus Biologies 338: 351–361. http://dx.doi.org/10.1016/j.crvi.2015.03.015

Hasan M, Islam MM, Khan MMR, Alam MS, Kurabayashi A, Igawa T, Kuaramoto M, Sumida M (2012a) Cryptic anuran biodiversity in Bangladesh revealed by mitochondrial 16S rRNA gene sequences. Zoological Science 29: 162–172. http://dx.doi.org/10.2108/zsj.29.162

Hasan M, Mitsuru M, Islam MM, Alam MS, Khan MMR, Sumida M (2012b) A new species of Hoplobatrachus (Anura, Dicroglossidae) from the coastal belt of Bangladesh. Zootaxa 3312: 45–48. http://www.mapress.com/zootaxa/2012/f/z03312p058f.pdf

Hebert PDN, Cywinska A, Ball SL, DeWaard JR (2003a) Biological identifications through DNA barcodes. Proceedings of the Royal Society B Biological Sciences 270: 313–21. https://doi.org/10.1098/rspb.2002.2218

Hebert PDN, Ratnasingham S, DeWaard JR (2003b) Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society B Biological Sciences (Suppl.) 270: S96–S99. https://doi.org/10.1098/rsbl.2003.0025

Honda M, Ota H, Kobayashi M, Nabhitabhata J, Yong HS, Hikida T (1999) Phylogenetic relationships of the flying lizards, genus Draco (Reptilia, Agamidae). Zoological Science 16: 535–549. http://dx.doi.org/10.2108/zsj.16.535

Honda M, Ota H, Kobayashi M, Nabhitabhata J, Yong HS, Sengoku S, Hikida T (2000a) Phylogenetic relationships of the family Agamidae (Reptilia: Iguania) inferred from mitochondrial DNA sequences. Zoological Science 17: 527–537. http://dx.doi.org/10.2108/0289-0003(2000)17[527:PROTFA]2.0.CO;2

Honda M, Ota H, Kobayashi M, Nabhitabhata J, Yong HS, Hikida T (2000b) Phylogenetic relationships, character evolution, and biogeography of the subfamily Lygosominae (Reptilia: Scincidae) inferred from mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 15: 452–461. https://doi.org/10.1006/mpev.1999.0767

Howlader MSA, Nair A, Merilä J (2016) A New Species of Frog (Anura: Dicroglossidae) Discovered from the Mega City of Dhaka. PLOS ONE 11: e0149597. https://doi.org/10.1371/journal.pone.0149597

Inger RF, Stuart BL, Iskandar DT (2009) Systematics of a widespread southeast Asian frog, Rana chalconota (Amphibia: Anura: Ranidae). Zoological Journal of the Linnean Society 155: 123–147. Https://doi.org/10.1111/j.1096-3642.2008.00440.x

Islam MM, Kurose N, Khan MMR, Nishizawa T, Kuramoto M, Alam MS, Hasan M, Kurniawan N, Nishioka M, Sumida M (2008) Genetic divergence and reproductive isolation in the genus Fejervarya (Amphibia: Anura) from Bangladesh inferred from morphological observation, crossing experiments, and molecular analyses. Zoological Science 25: 1084–1105. http://dx.doi.org/10.2108/zsj.25.1084

Kathriner A, O’Shea M, Kaiser H (2014) Re-examination of Hemidactylus tenkatei van Lidth de Jeude, 1895: populations from Timor provide insight into the taxonomy of the H. brookii Gray, 1845 complex (Squamata: Gekkonidae). Zootaxa 3887: 583–599. http://dx.doi.org/10.11646/Zootaxa.3887.5.5

Koch A (2012) Discovery, Diversity, and Distribution of the Amphibians and Reptiles of Sulawesi and its Offshore Islands. Edition Chimaira, Frankfurt am Main, 374 pp.

Kotaki M, Kurabayashi A, Matsui M, Kuramoto M, Djong TH, Sumida M (2010) Molecular phylogeny of the diversified frogs of genus Fejervarya (Anura: Dicroglossidae). Zoological Science 27: 386–395. http://dx.doi.org/10.2108/zsj.27.386.s1

Kuhl H (1820) Beiträge zur Zoologie und vergleichenden Anatomie. Hermannsche Buchhandlung, Frankfurt, 152 pp.

Kuraishi N, Matsui M, Hamidy A, Belabut DM, Ahmad N, Panha S, Sudin A, Yong HS, Jiang J-P, Ota H, Thong HT, Nishikawa K (2012) Phylogenetic and taxonomic relationships of the Polypedates leucomystax complex (Amphibia). Zoologica Scripta 42: 54–70. https://doi.org/10.1111/j.1463-6409.2012.00562.x

Lee JL, Myint Kyaw Thura, Mulcahy DG, Zug GR (2015) Three colubrid snakes new to Myanmar. Herpetology Notes 8: 217–220. https://www.biotaxa.org/hn/article/view/7805

Lee JL, Miller AH, Connette GM, Oo K Swe, Zug GR, Mulcahy DG (2018) First record of the Malaysian Bridle Snake, Dryocalamus subannulatus (Duméril, Bibron & Duméril, 1854), in Myanmar (Reptilia, Serpentes, Colubridae). Check List 14: 341–345. https://doi.org/10.15560/14.2.341

Lesson RP (1831) Catalogue des Reptiles qui font partie d’une Collection zoologique recueille dans l’Inde continentale ou en Afrique, et apportée en France par M. Lamare-Piquot. Bulletin des Sciences Naturelles et de Géologie, Paris 25: 119–123.

Lidth de Jeude TW van (1895) Reptiles from Timor and the neighbouring islands. Notes from the Leyden Museum 16: 119–127.

Linnaeus C (1758) Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Laurentii Salvii, Holmiæ, 824 pp.

Lipscomb D, Platnick N, Wheeler Q (2003) The intellectual content of taxonomy: a comment on DNA taxonomy. Trends in Ecology and Evolution 18: 65–66. http://dx.doi.org/10.1016/S0169-5347(02)00060-5

Macey JR, Larson A, Ananjeva NB, Fang Z, Papenfuss TJ (1997) Two novel gene orders and the role of light-strand replication in rearrangement of the vertebrate mitochondrial genome. Molecular Biology and Evolution 14: 91–104. https://doi.org/10.1093/oxfordjournals.molbev.a025706

Mallet J, Willmott K (2003) Taxonomy: renaissance or Tower of Babel? Trends in Ecology and Evolution 18: 57–59. https://doi.org/10.1016/S0169-5347(02)00061-7

Matsui M, Khonsue W, Nabhitabhata J (2005a) A new Ansonia from the Isthmus of Kra, Thailand (Amphibia, Anura, Bufonidae). Zoological Science 22: 809–814. https://doi.org/10.2108/zsj.22.809

Matsui M, Shimada T, Ota H, Tanaka-Ueno T (2005b) Multiple invasions of the Ryukyu Archipelago by Oriental frogs of the subgenus Odorrana with phylogenetic reassessment of the related subgenera of the genus Rana. Molecular Phylogenetics and Evolution 37: 733–742. https://doi.org/10.1016/j.ympev.2005.04.030

Matsui M, Nabhitabhata J (2006) A new species of Amolops from Thailand (Amphibia, Anura, Ranidae). Zoological Science Tokyo 23: 727–732. https://doi.org/10.2108/zsj.23.727

Matsui M, Shimada T, Liu WZ, Maryati M, Khonsue W, Orlov N (2006) Phylogenetic relationships of Oriental torrent frogs in the genus Amolops and its allies (Amphibia, Anura, Ranidae). Molecular Phylogenetics and Evolution 38: 659–666. https://doi.org/10.1016/j.ympev.2005.11.019

Matsui M, Hamidy A, Belabut DM, Ahmad N, Panha S, Sudin A, Khonsue W, Oh H-S, Jiang J-P, Nishikawa K (2011) Systematic relationships of Oriental tiny frogs of the family Microhylidae (Amphibia, Anura) as revealed by mtDNA genealogy. Molecular Phylogenetics and Evolution 61: 167–176. https://doi.org/10.1016/j.ympev.2011.05.015

McMahan C, Zug GR (2007) Burmese Hemidactylus (Reptilia, Squamata, Gekkonidae): geographic variation in the morphology of Hemidactylus bowringii in Myanmar and Yunnan, China. Proceedings of the California Academy of Sciences 58: 485–509.

Mulcahy DG, Macdonald III KS, Brady SG, Meyer C, Barker K, Coddington JC (2016) Greater than X kb: A quantitative assessment of preservation conditions on genomic DNA quality, and a proposed standard for genome-quality DNA. PeerJ 4: e2528. https://doi.org/10.7717/peerj.2528

Mulcahy DG, Lee JL, Miller AH, Zug GR (2017) Troublesome Trimes: Potential cryptic speciation of the Trimeresurus (Popeia) popeiorum complex (Serpentes: Crotalidae) around the Isthmus of Kra (Myanmar and Thailand). Zootaxa 4347: 301–315. https://doi.org/10.11646/zootaxa.4347.2.6

Nabhitabhata J, Chan-ard T, Chuaynkern Y (2004) Checklist of Amphibians and Reptiles in Thailand. Office of Environmental Policy and Planning, Bangkok, Thailand. [Print date 2000]

Nishikawa K, Matsui M, Yong HS, Ahmad N, Yambun P, Belabut D, Sudin A, Hamidy A, Nikolai O, Ota H, Yoshikawa N, Tominaga A, Shimada T (2012) Molecular phylogeny and biogeography of Asia (Amphibia, Gymnophiona, Ichthyophiidae), with special reference to high cryptic species diversity in Sundaland. Molecular Phylogenetics and Evolution 63: 714–723. https://doi.10.1016/j.ympev.2012.02.017

Ohler A, Wollenberg KC, Grosjean S, Hendrix R, Vences M, Ziegler T, Dubois A (2011) Sorting out Laos: description of new species and additional taxonomic data on megophryid frogs from northern Indochina (genus Leptolalax, Megophryidae, Anura). Zootaxa 3147: 1–83. http://www.mapress.com/zootaxa/2011/2/zt03147p083.pdf

Oliver LA, Prendini E, Kraus F, Raxworthy CJ (2015) Systematics and biogeography of the Hylarana frog (Anura: Ranidae) radiation across tropical Australasia, Southeast Asia, and Africa. Molecular Phylogenetics and Evolution 90: 176–192. http://dx.doi.org/10.1016/j.ympev.2015.05.001

Palumbi S, Martin A, Romano S, McMillan WO, Stice L, Grabowski G (1991) The Simple Fool’s Guide to PCR, Version 2.0. Privately published, USA.

Pan SL, Dang NX, Wang JS, Zheng YT, Rao DQ, Li JT (2013) Molecular Phylogeny Supports the Validity of Polypedates impresus Yang 2008. Asian Herpetological Research 4: 124–133. www.ahr-journal.com/OA/pdfdow.aspx?Sid=20130006 https://doi.org/10.3724/SP.J.1245.2013.00124

Pauwels OSG, Chan-ard T (2006) Reptiles of Kaeng Krachan National Park, Western Thailand. Natural History Bulletin of the Siam Society 54: 89–108.

Pauwels OSG, Laohawat O-A, David P, Bour R, Dangsee P, Puangjit C, Chimsunchart C (2000) Herpetological investigations in Peninsular Thailand, with a list of reptile species and notes on their biology. Dumerilia 4: 123–154.

Pauwels OSG, Laohawat O-A, Naaktae W, Puangjit C, Wisutharom T, Chimsunchart C, David P (2002) Reptile and amphibian diversity in Phang-nga Province, southern Thailand. The Natural History Journal of Chulalongkorn University 2: 25–30.

Pauwels OSG, Chan-ard T, Wanchai P, Kheowyoo B, Bauer AM (2009) Reptile diversity of Phetchaburi province, western Thailand: an update. Hamadryad 34: 9–21.

Peters WCH (1867) Herpetologische Notizen. Monatsberichte der Königlichen Preussische Akademie des Wissenschaften zu Berlin 1867: 13–37.

Puillandres N, Strong EE, Bouchet P, Boisselier MC, Couloux A, Samadi S (2009) Identifying gastropod spawn from DNA barcodes: possible but not yet practicable. Molecular Ecology Resources Sep 9: 1311–21https://doi.org/10.1111/j.1755-0998.2009.02576.x

Raposa MA, Stopiglia R, Brito GRR, Bockmann FA, Kirwan GM, Gayon J, Dubois A (2017) What really hampers taxonomy and conservation? A riposte to Garnett and Christidis (2017). Zootaxa 4317: 179–184. https://doi.org/10.11646/zootaxa.4317.1.10

Ratnasingham S, Hebert PDN (2013) A DNA-Based Registry for All Animal Species: The Barcode Index Number (BIN) System. PLOS ONE 8: e66213. https://doi.org/10.1371/journal.pone.0066213

Reynolds RG, Miemiller ML, Revell LJ (2014) Toward a Tree-of-Life for the boas and pythons: multilocus species-level phylogeny with unprecedented taxon sampling. Molecular Phylogenetics and Evolution 71: 204–213. http://dx.doi.org/10.1016/j.ympev.2013.11.011

Schlegel H (1837) Abbildungen neuer oder unvollständig bekannter Amphibien, nach der Natur oder dem Leben entworfen, herausgegeben und mit einem erläuternden Texte begleitet. Part 1. Arnz & Co, Düsseldorf.

Schneider JG (1799) Historiae Amphibiorum narturalis et literariae. Fasciculus primus, continens Ranas. Calamitas, Bufones, Salamandras et Hydros. Frommanni, Jena, 266. https://doi.org/10.5962/bhl.title.78757

Schneider JG (1801) Historiae Amphibiorum naturalis et literariae. Fasciculus secundus continens Crocodilos, Scincos, Chamaesauras, Boas. Pseudoboas, Elapes, Angues. Amphisbaenas et Caecilias. Frommanni, Jena, 374 pp

Sclater WL (1892) On some specimens of frogs in the Indian Museum, Calcutta with description of several new species. Proceedings of the Zoological Society of London 1892: 341–348.

Seutin G, White BN, Boag PT (1991) Preservation of avian blood and tissue samples for DNA analyses. Canadian Journal of Zoology 69: 82–90. https://doi.org/10.1139/z91-013

Sheridan JA, Bickford D, Su KF-Y (2010) An examination of call and genetic variation in three wide-ranging Southeast Asian anuran species. Raffles Bulletin of Zoology 58: 369–379. http://scholarbank.nus.edu.sg/handle/10635/100064

Sheridan JA, Stuart BL (2018) Hidden species diversity in Sylvirana nigrovittata (Amphibia: Ranidae) highlights the importance of taxonomic revisions in biodiversity conservation. PLOS One 13(3): e0192766. https://doi.org/10.1371/journal.pone.0192766

Smith MA (1940) The amphibians and reptiles obtained by Mr. Ronald Kaulback in Upper Burma. Records of the Indian Museum 42: 465–486.

Stuart BL, Inger RF, Voris HK (2006a) High levels of cryptic species diversity revealed by sympatric lineages of Southeast Asian forest frogs. Biology Letters 2006: 470–474. https://doi.org/10.1098/rsbl.2006.0505

Stuart BL, Chuaynkern T, Chan-ard T, Inger RF (2006b) Three species of frogs and a new tadpole from eastern Thailand. Fieldiana Zoology 1543: 1–10. http://dx.doi.org/10.3158/0015-0754(2006)187[1:TNSOFA]2.0.CO;2

Stuart SN, Chanson JS, Cox NA, Young BE, Rodrigues ASL, Fischman DL, Waller RW (2004) Status and trends of amphibian declines and extinctions worldwide. Science 306: 1783–1786. https://doi.org/10.1126/science.1103538

Sumida M, Kotaki M, Islam MM, Djong TH, Igawa T, Kondo Y, Matsui M, De Silva A, Khonsue W, Nishioka M (2007) Evolutionary relationships and reproductive isolating mechanisms in the Rice Frog (Fejervarya limnocharis) species complex from Sri Lanka, Thailand, Taiwan and Japan, inferred from mtDNA gene sequences, allozymes, and crossing experiments. Zoological Science 24: 547–562. https://doi.org/10.2108/zsj.24.547

Sumontha M, Pauwels OSG, Kunya K, Limlikhitaksorn C, Ruksue S, Taokratok A, Ansermet M, Chanhome L (2012) A new species of Parachute Gecko (Squamata: Gekkonidae: genus Ptychozoon) from Kaeng Krachan National Park, western Thailand. Zootaxa 3513: 68–78. http://www.mapress.com/zootaxa/2012/f/z03513p078f.pdf

Sumontha M, Pauwels OSG, Panitvong N, Kunya K, Grismer LL (2015) A new lowland forest Bent-toed Gecko (Squamata: Gekkonidae: Cyrtodactylus) from Ranong Province, peninsular Thailand. Zootaxa 3911: 106–118. https://doi.org/10.11646/zootaxa.3911.1.6.

Suwannapoom C, Yuan Z-Y, Chen J-M, Hou M, Zhao H-P, Want L-W, Nguyen TS, Nguyen TQ, Murphy RW, Sullivan J, McLeod DS, Che J (2016) Taxonomic revision of the Chinese Limnonectes (Anura, Dicroglossidae) with the description of a new species from China and Myanmar. Zootaxa 4093: 181–200. ttp://dx.doi.org/10.11646/zootaxa.4093.2.2

Swofford DL (2002) PAUP* Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts.

Tautz D, Arctander P, Minelli A, Thomas RH, Vogler AP (2003) A plea for DNA taxonomy. Trends in Ecology and Evolution 18: 70–74. https://doi.org/10.1016/S0169-5347(02)00041-1

Theobald W (1868) Catalogue of the reptiles of British Birma, embracing the Provinces of Pegu, Martaban, and Tenasserim; with descriptions of new or little-known species. Journal of the Linnean Society, Zoology 4: 4–67. https://doi.org/10.1111/j.1096-3642.1868.tb02007.x

Tonione MA, Reeder N, Moritz CC (2011) High Genetic Diversity Despite the Potential for Stepping-Stone Colonizations in an Invasive Species of Gecko on Moorea, French Polynesia PLOS ONE 6: e26874. https://doi.org/10.1371/journal.pone.0026874

Uetz P, Freed P, Hošek J (2018) The Reptile Database, http://www.reptile-database.org [Accessed 31 January 2018]

Vogel G, David P, Pauwels OSG, Sumontha M, Norval G, Hendrix R, Vu NT, Ziegler T (2009) A revision of Lycodon ruhstrati (Fischer 1886) auctorum (SquamataColubridae), with the description of a new species from Thailand and a new subspecies from the Asian mainland. Tropical Zoology 22: 131–182.

Vogel G, David P (2012) A revision of the species group Xenochrophis piscator (Schneider, 1799) (Squamata: Natricidae). Zootaxa 3473: 1–60.

Vogt T (1911) Beitrag zur Amphibien-fauna der Insel Formosa. Sitzungsberichte der Gesellschaft Naturforschender Freunde zu Berlin 1911: 179–184.

Weigt LA, Driskell AC, Baldwin CC, Ormos A (2012) DNA Barcoding Fishes. In: Kress WJ, Erickson DL (Eds) DNA Barcodes: Methods and Protocols, Humana Press, New York, 109–126. https://doi.org/10.1007/978-1-61779-591-6_6

Wilson EO (2017) Biodiversity research requires more boots on the ground. Nature Ecology & Evolution 1: 1590–1591. https://doi.org/10.1038/s41559-017-0360-y

Wijayathilaka N, Garg S, Senevirathne G, Karunarathna N, Biju SD, Meegaskumbura M (2016) A new species of Microhyla (Anura: Microhylidae) from Sri Lanka: an integrative taxonomic approach. Zootaxa 4066: 331–342. http://doi.org/10.11646/zootaxa.4066.3.9

Wilkinson JA, Sellas AB, Vindum JV (2012) A new species of Ansonia (Anura: Bufonidae) from northern Tanintharyi Division, Myanmar. Zootaxa 3163: 54–68. http://www.mapress.com/zootaxa/2012/f/z03163p068f.pdf

Wilkinson M, Presswell B, Sherratt E, Papadopoulou A, Gower DJ (2014) A new species of striped Ichthyophis Fitzinger, 1826 (Amphibia: Gymnophiona: Ichthyophiidae) from Myanmar. Zootaxa 3785: 45–58. http://dx.doi.org/10.11646/zootaxa.3785.1.4

Wogan GOU, Vindum JV, Wilkinson JA, Koo MS, Slowinski JB, Win H et al. (2008) New country records and range extensions for Myanmar amphibians and reptiles. Hamadryad 33: 83–96.

Wogan GOU, Stuart BL, Iskandar DT, McGuire JA (2016) Deep genetic structure and ecological divergence in a widespread human commensal toad. Biology Letters 12: 20150807. http://dx.doi.org/10.1098/rsbl.2015.0807

Wood PL, Grismer LL, Aowphol A, Aguilar CA, Cota M, Grismer MS, Murdoch ML, Sites Jr. JW (2017) Three new karst-dwelling Cnemaspis Strauch, 1887 (Squamata; Gekkonidae) from Peninsular Thailand and the phylogenetic placement of C. punctatonuchalis and C. vandeventeri. PeerJ 5: e2884. https://doi.org/10.7717/peerj.2884

Zug GR (2011) Tropical Asian Dry-Forest Amphibians & Reptiles: A Regional Comparison of Ecological Communities. In: McShea WJ, Davies SJ, Bhumpakphan N (Eds) The Ecology and Conservation of Seasonally Dry Forest in Asia.Smithsonian Institution Scholarly Press, Washington DC, 275–303.

Zug GR (2015) Morphology and systematics of Kalophrynus interlineatus-pleurostigma populations (Anura: Microhylidae: Kalophryninae) and a taxonomy of the genus Kalophrynus Tschudi, Asian Sticky Frogs. Proceedings of the California Academy of Sciences 62: 135–190.

Zug GR, Blackburn III JL, Sai Wunna Kyi (2006a) Checkered Keelbacks (Xenochrophis – Reptilia, Serpentes, Natricidae) at the Moyingye Wetland Bird Sanctuary, Myanmar. Hamadryad 30: 157–166.

Zug GR, Brown H, Schulte J, Vindum JV (2006b) Systematics of the garden lizards, Calotes versicolor group (Reptilia, Squamata, Agamidae), in Myanmar: central dry zone populations. Proceedings of the California Academy of Sciences 57: 35–68.

Zug GR, Mulcahy DG, Vindum JV (2017) Resurrection of Bronchocela burmana Blanford, 1878 for the Green Crested Lizard (Squamata, Agamidae) of southern Myanmar. ZooKeys 657: 141. https://doi.org/10.3897/zookeys.657.11600.

Zug GR, Vindum JV, Koo M (2007) Burmese Hemidactylus (Reptilia, Squamata, Gekkonidae): taxonomic notes on tropical Asian Hemidactylus. Proceedings of the California Academy of Sciences 58: 387–405.

Zug GR, Win H, Thin T, Min TZ, Lhon WZ, Kyaw K (1998) Herpetofauna of the Chatthin Wildlife Sanctuary, north-central Myanmar, with preliminary observations on their natural history. Hamadryad 23: 111–120.

Zuniga JD, Gostel MR, Mulcahy DG, Barker K, Funk VA, Coddington JC (2017) Data Release: DNA Barcodes of Plant Species Collected for the Global Genome Initiative Gardens Project, National Museum of Natural History, Smithsonian Institution. PhytoKeys 88: 119–122. https://doi.org/10.3897/phytokeys.88.14607

Supplementary material

Supplementary material 1

12S and 16S neighbor-joining trees

Mulcahy DG, Lee JL, Miller AH, Chand M, Thura MK, Zug GR

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (12.69 MB)