Research Article
Print
Research Article
The complete mitochondrial DNA sequence of the pantropical earthworm Pontoscolex corethrurus (Rhinodrilidae, Clitellata): Mitogenome characterization and phylogenetic positioning
expand article infoAna C. Conrado, Hugo Arruda§, David W.G. Stanton|, Samuel W. James, Peter Kille|, George Brown#, Elodie Silva¤, Lise Dupont«, Shabnam Taheri«, Andrew J. Morgan|, Nelson Simões§, Armindo Rodrigues§, Rafael Montiel», Luis Cunha|¤
‡ Universidade Federal do Paraná, Paraná, Brazil
§ Universidade dos Açores, Ponta Delgada, Portugal
| Cardiff University, Cardiff, United Kingdom
¶ Maharishi University of Management, Fairfield, United States of America
# Embrapa Florestas, Colombo, Brazil
¤ Empresa Brasileira de Pesquisa Agropecuária, Colombo, Brazil
« Université Paris Est Créteil, Paris, France
» Instituto Politécnico Nacional, Irapuato, Mexico
† Deceased author
Open Access

Abstract

Pontoscolex corethrurus (Müller, 1857) plays an important role in tropical soil ecosystems and has been widely used as an animal model for a large variety of ecological studies in particular due to its common presence and generally high abundance in human-disturbed tropical soils. In this study we describe the complete mitochondrial genome of the peregrine earthworm P. corethrurus. This is the first record of a mitochondrial genome within the Rhinodrilidae family. Its mitochondrial genome is 14 835 bp in length containing 37 genes (13 protein-coding genes (PCG) 2 rRNA genes and 22 tRNA genes). It has the same gene content and structure as in other sequenced earthworms but unusual among invertebrates it hasseveral overlapping open reading frames. All genes are encoded on the same strand. Most of the PCGs use ATG as the start codon except for ND3 which uses GTG as the start codon. The A+T content of the mitochondrial genome is 59.9% (31.8% A 28.1% T 14.6% G and 25.6% for C). The annotated genome sequence has been deposited in GenBank under the accession number KT988053.

Keywords

Pontoscolex corethrurus , mitochondria, mitochondrial genome, Rhinodrilidae , earthworm, Azores, peregrine species

Introduction

Excluding a few aquatic taxa, earthworms (Annelida: Clitellata) are mostly terrestrial and include ca. 5,500 species (Blakemore et al. 2006). Believed to have originated in the Guyana Shield (Righi 1984), the earthworm Pontoscolex corethrurus (Müller, 1857) is a globally distributed species found in most tropical regions. It mainly occurs in human-disturbed areas and can be used as an indicator of ecosystem disturbance (Brown et al. 2006), and is commonly used in ecotoxicological studies (e.g. Buch et al. 2011; Buch et al. 2013; Da Silva et al. 2016). The species formerly belonged in the Glossoscolecidae family, but was recently allocated to the Rhinodrilidae family by James (2012), following the phylogeny of James and Davidson (2012). It is also the most well-known earthworm species in the humid tropics, frequently used in ecological and agronomic studies (Bhattacharjee and Chaudhuri 2002; Buch et al. 2013; Chapuis-Lardy et al. 2010; Dupont et al. 2012; Hamoui 1991; Marichal et al. 2010). Being a geophagous endogeic species, P. corethrurus shows high plasticity regarding its tolerance to soil physicochemical characteristics, including variable moisture, high temperatures, exceptionally high carbon dioxide and low oxygen levels, and is capable of inhabiting nutrient-poor soils (Cunha et al. 2014; Hamoui 1991; Lavelle et al. 1987), as well as rotten logs (Buch et al. 2011).

Molecular data have become increasingly important in recent years. In animals, the mitochondrial DNA (mtDNA) typically contains 37 genes, encoding 13 proteins for the enzymes required for oxidative phosphorylation, the two ribosomal RNA units (rRNA), and 22 transfer RNAs (tRNAs) necessary for the translation of the proteins encoded by mtDNA (Anderson et al. 1981; Boore 1999; Zhao et al. 2015). Remarkable progress has been made over the past several years in the field of the molecular systematics of annelids. Compared with individual genes, the mitochondrial genome is still a promising tool for inferring phylogenetic relationships due to its high content of information, and has been applied in some phylogenetic studies involving earthworms (Zhang et al. 2015; Zhang et al. 2016b).

In this study, we sequenced the complete mtDNA sequence of P. corethrurus for the first time and analyzed its structure. Additionally, we conducted phylogenetic analyses based on the mitochondrial sequence data available elsewhere with the purpose of investigating the phylogenetic position of P. corethrurus within Clitellata. The information reported in this article will facilitate further investigations of phylogenetic relationships of different Annelida species.

Material and methods

Sample collection and DNA extraction

A group of clitellate (adult) P. corethrurus was collected in São Miguel Island (Azores, Portugal) inside pineapple greenhouses (Locality: Fajã de Baixo, 37°45'12.2"N, 25°38'21.3"W) during January 2015. Animals were euthanized in 10% ethanol and preserved in 96% ethanol for later work. A piece of body wall tissue was used for genomic DNA extraction using standard phenol/chloroform (Sambrook and Russell 2001) procedure followed by ethanol precipitation and kept at 4°C for subsequent use.

Mitochondrial DNA amplification

The complete P. corethrurus mitogenome was amplified using seven sets of primers (Table 1) designed based on sequences retrieved from a previous study (Cunha et al. 2014).

Table 1.

Details of the primers used to amplify the mitochondrial DNA of P. corethrurus.

Primer code Orientation Annealing position (bp) Nucleotide sequence (5’-3’) Melting Temperature (°C)
FP_1 Forward 2154..2175 CTCTACTATGTACCCAGGAGTG 57.46
RP_1 Reverse 2758..2775 GCGGCCAAGATAAAGCAC 57.67
RP_2 Reverse 3740..3762 TAGAGGCGGTAAGGAGAAAGTAT 58.61
RP_3 Reverse 5691..5708 CAGAGGCGAGGTAAATTC 53.85
RP_4 Reverse 6356..6373 TGTTCAGGGCTAGGATTG 54.99
FP_5 Forward 7983..8004 ACTAGTGTCACTTACAACAACC 57.16
RP_5 Reverse 8649..8670 TGATAAGGGGGAAAGTCTGATC 56.84
FP_6 Forward 8766..8787 AGTAGCCGCTATAATAGTCCTT 57.91
RP_6 Reverse 10328..10349 TGATTTGGGGTCAGAGCCGTAG 61.59
FP_7 Forward 10459..10478 AAAGCTTGGCGGTGCTTCAC 63.23
RP_7 Reverse 11242..11263 CCTAGTGTGTGTCAGGACGCTT 64.75

Long PCR targets were amplified using different combinations of the primer sets, and initially sequenced with the same forward or reverse primers. Subsequent primer walking method was used to close the sequencing gaps. To ensure the accuracy of the sequence, every two contiguous segments overlapped by at least 80 bp. PCRs were performed using ~40 ng of DNA and 0.4 μM forward and reverse primers, 0.2 mM dNTP mix and 1.25 U Platinum HiFi DNA polymerase buffered with 1X Mg-free buffer (Thermofisher Scientific, UK). PCR amplification buffer was supplemented with MgCl2 to achieve a final concentration of 1.75 mM in a total volume of 25 μl reaction mixture. The reaction was denatured at 95°C for 3 min, cycled 35 times at 95°C for 30 s, 30 s at the required primer annealing temperature and 72°C for 1 min per 1000 bp depending on target fragment length. Negative controls were included in all PCR amplifications to confirm the absence of contaminants. Before sequencing, PCR cleanups were performed using Exo-SAP-IT (Amersham Pharmacia, UK) reagents. Exonuclease 1 (0.25 μl) and Shrimp Alkaline Phosphatase (0.5 μl) were mixed with the PCR product (10 μl) and incubated at 37°C for 45 min followed by 80°C for 15 min. DNA was sequenced using ABI PRISM® BigDye v3.1 Terminator Sequencing technology (Applied Biosystems, USA) on an ABI PRISM® 3100 DNA automated Sequencer.

Sequence editing and analysis

Sequence trace files were corrected and aligned with the MEGA v.7 (Kumar et al. 2016). The sequence overlap and mitogenome assembly were performed using CLC main workbench v.6 (Qiagen). The annotation of the 13 protein-coding genes and two rRNA genes were determined using the MITOS v.2 web server (Bernt et al. 2013) and manually curated using other published annelid mitogenomes as shown in Table 2, whereas the tRNA genes were identified using the program tRNAscan-SE 1.21 (Lowe and Eddy 1997). The annotated genome sequence was deposited in GenBank under accession number KT988053.

Phylogenetic analyses

To clarify the phylogenetic position of P. corethrurus within the Clitellata, the complete mitogenome sequences of eight representative Clitellata species (Table 2) were incorporated together with the presently obtained P. corethrurus mitogenome sequence for phylogenetic analysis. Phylogenetic analyses were based on 13 protein-coding genes and the two rRNA units, which were aligned separately using MEGA v.7 (Kumar et al. 2016) with minor manual adjustments and then concatenated. The possible bias of substitution saturation at each codon position of protein-coding genes and two rRNA genes was investigated using DAMBE v.4.5.57 (Xia and Xie 2001) and MEGA v. 7 (Kumar et al. 2016).

Table 2.

Representative Clitellata species included in this study for comparison.

Species Family Length (bp) GenBank accession number
Pontoscolex corethrurus Rhinodrilidae 14,835 Present study
Tonoscolex birmanicus Megascolecidae 15,170 KF425518
Amynthas gracilis Megascolecidae 15,161 NC_027258
Duplodicodrilus schmardae Megascolecidae 15,156 NC_029867
Metaphire guillemi Megascolecidae 15,174 NC_029869
Perionyx excavatus Megascolecidae 15,083 NC_009631
Lumbricus terrestris Lumbricidae 14,998 NC_001673
Drawida japonica Moniligastridae 14,648 NC_028050
Hirudo nipponia Hirudinidae 14,414 NC_023776

Two different methods, Bayesian inference (BI) and maximum likelihood (ML) were used to construct the phylogenetic tree. Bayesian analyses were undertaken with MrBayes v.3.1.2 (Ronquist and Huelsenbeck 2003) under the best-fit model of nucleotide evolution selected in MrModeltest v.2.3 (Nylander 2004), using the Assignment Index Criterion (AIC). Analyses were run for 1,000,000 generations, and sampled every 100 generations to assess convergence. Trees that produced non-stationary log-likelihood values were discarded as part of a burn-in procedure and combined the remaining trees that resulted in convergent log-likelihood scores from both independent searches. These trees were used to construct a consensus tree.

Maximum likelihood analysis (ML) was performed with MEGA v.7 (Kumar et al. 2016). Initial tree(s) for the heuristic search were obtained automatically by applying Neighbour-Joining and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach and then selecting the topology with superior log likelihood value. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, alpha parameter = 0.9143)). The rate variation model allowed for some sites to be evolutionarily invariable ([+I], 17.7596% sites). The analysis involved nine mitogenome sequences (Table 2). All positions containing gaps and missing data were eliminated. The bootstrap consensus tree inferred from 1000 replicates was taken to represent the evolutionary history of the taxa analysed (Felsenstein 1985).

Results and discussion

Mitochondrial genomic structure

The mitochondrial genome of P. corethrurus was determined to be 14 835 bp in length, comprising 13 protein-coding genes (PCGs), 22 transfer RNAs (tRNAs), two ribosomal RNAs (rRNAs), and one putative control region with a length of 318 bp (Figure 1).

Figure 1. 

The mitochondrial genome of Pontoscolex corethrurus (Müller, 1857). Gene order and positions are shown, including the putative control region. IUPAC single letter codes are used to identify transfer RNA. The L1, L2, S1, and S2 transfer RNAs are differentiated on the basis of their anti-codons TAG, TAA, TCT, and TGA, respectively.

The mitochondrial genome structure is detailed in Table 3. Gene order and orientation are similar to the previous earthworm mitochondrial genomes (Boore and Brown 1995; Zhang et al. 2015) but slightly smaller and more condensed (with several intergenic overlaps, see Table 3). The gene organization is similar to other earthworm species (e.g. Lumbricus terrestris: Boore and Brown 1995).

Table 3.

Organisation and structure of the P. corethrurus mitochondrial genome.

Gene Direction From To Size (bp) Start Stop Anti-codon Intergenic bases (bp)
COX1 + 1 1540 1540 ATG T-- 0
tRNA-Asn + 1541 1602 62 GTT 0
COX2 + 1603 2289 687 ATG TAG -1
tRNA-Asp + 2289 2351 63 GTC 2
ATP8 + 2354 2513 160 ATG T-- 0
tRNA-Tyr + 2514 2576 63 GTA -1
tRNA-Gly + 2576 2638 63 TCC 3
COX3 + 2642 3419 778 ATG T-- 0
tRNA-Gln + 3420 3488 69 TTG 0
ND6 + 3489 3954 466 ATG T-- 0
Cytb + 3955 5094 1140 ATG TAA -2
tRNA-Trp + 5092 5154 63 TCA 1
ATP6 + 5156 5851 696 ATG TAA -2
tRNA-Arg + 5850 5910 61 TCG 0
Putative Control Region + 5911 6228 318
tRNA-His + 6229 6288 60 GTG 0
ND5 + 6289 8010 1722 ATG TAA 3
tRNA-Phe + 8014 8073 60 GAA 4
tRNA-Glu + 8078 8141 64 TTC 0
tRNA-Pro + 8142 8204 63 TGG 4
tRNA-Thr + 8209 8272 64 TGT 0
ND4L + 8273 8569 297 ATG TAA -7
ND4 + 8563 9921 1359 ATG TAA -2
tRNA-Cys + 9920 9986 67 GCA 1
tRNA-Met + 9988 10050 63 CAT -1
s-rRNA + 10050 10838 789 -7
tRNA-Val + 10832 10894 63 TAC -2
l-rRNA + 10893 12104 1212 0
tRNA-Leu 1 + 12105 12166 62 TAG 2
tRNA-Ala + 12169 12230 62 TGC 1
tRNA-Ser 2 + 12232 12293 62 TGA 1
tRNA-Leu 2 + 12295 12360 66 TAA 0
ND1 + 12361 13290 930 ATG TAG -1
tRNA-lle + 13290 13354 65 GAT 0
tRNA-Lys + 13355 13417 63 TTT 0
ND3 + 13418 13770 353 GTG TA- -1
tRNA-Ser 1 + 13770 13832 63 TCT 0
ND2 + 13833 14835 1003 ATG T-- 0

The nucleotide composition is asymmetric (31.9% A, 27.9% T, 14.9% G, and 25.3% for C) with an overall A+T content of 59.9%. One remarkable trait of metazoan mitogenomes is the strand-specific bias in nucleotide composition (Hassanin et al. 2005; Reyes et al. 1998). Such bias is measured as G/C-skew (G%-C%)/(G%+C%) and A/T-skew (A%-T%)/(A%+T%), respectively (Perna and Kocher 1995). The overall GC- and AT-skews of the H-strand of P. corethrurus mitogenome were -0.258 and 0.066, respectively, indicating a compositional bias associated with an excess of C over G nucleotides and a slight excess of A over T nucleotides on the H-strand.

Protein-coding genes

The P. corethrurus genome contained the expected 13 protein-coding genes with a total of 11,131 bp in size, accounting for 75.03% of the whole mitogenome. Most of the PCGs are initiated with ATG codons, except for ND3 gene, which uses GTG as the initiation codon. Six PCGs (COX1, ATP8, COX3, ND6, ND3, and ND2) are terminated with an incomplete codon T or TA, which could be completed to TAA by polyadenylation post-transcriptionally (Ojala et al. 1981). COX2 and ND1 use TAG as a termination codon.

Nucleotide composition and codon usage frequencies were calculated from a concatenated sequence of all protein-coding genes on the H-strand. The base composition of protein-coding genes revealed a negative bias for A (14.4%), especially at second codon positions (12.9%, Table 4). For all protein genes, T was the most frequent nucleotide at the first and third positions whereas G was most frequent at the second position.

Table 4.

Base composition for protein-coding, tRNA, and rRNA genes of P. corethrurus mitogenome.

Gene/Region Base composition (%) A+T (%) Size (bp)
T C A G
COX1 27.4 26.7 27.9 18.1 55.3 1,540
COX2 25.8 24.3 34.9 15.0 60.7 687
ATP8 24.4 26.9 36.9 11.9 61.3 160
COX3 27.3 27.5 25.7 19.5 53.0 778
ND6 28.3 26.0 30.3 15.5 58.6 466
Cytb 28.0 27.1 29.7 15.3 57.6 1,140
ATP6 29.6 29.2 30.6 10.6 60.2 696
ND5 27.7 26.7 31.7 13.9 59.4 1,722
ND4L 25.9 28.3 33.0 12.8 58.9 297
ND4 27.5 27.5 32.3 12.7 59.8 1,359
ND1 28.4 25.8 29.8 16.0 58.2 930
ND3 32.6 26.1 27.2 14.2 59.8 353
ND2 30.0 28.2 30.7 11.1 60.7 1,003
Protein Coding
1st 30.2 25.4 17.4 27.0 47.6 3,710
2st 24.9 27.6 12.9 34.6 37.8 3,710
3st 36.1 27.9 13.8 22.3 49.8 3,710
Total 30.4 27.0 14.7 28.0 45.1 11,131
tRNA 30.5 17.6 34.9 17.0 65.5 1,391
rRNA 24.1 22.0 37.6 16.3 61.7 2,001
Putative Control Region 31.5 18.9 36.2 13.5 67.6 318
Overall 28.1 25.6 31.8 14.6 59.9 14,835

Ribosomal and transfer RNA genes

Like other mitochondrial genomes (Inoue et al. 2000; Zardoya et al. 1995), twenty-two tRNA genes were identified (Supplementary figure 1). The tRNA genes were scattered throughout the mitochondrial genome and ranged in size from 60 to 67 bp (Table 3). The P. corethrurus mitogenome also contained a small subunit of rRNA and a large subunit of rRNA, which were 789 bp and 1212 bp in length, respectively. As in other Clitellata genomes, these genes were located between the tRNAMet and tRNAVal genes and between tRNAVal and tRNALeu genes, respectively (Zhang et al. 2016b).

Non-coding regions

As shown in Table 3, there are 22 intergenic spacer regions, ranging in size from -7 to 4 bp observed in P. corethrurus.

As in most Clitellata, the major non-coding region in P. corethrurus mitochondrial genome was located between tRNA-Arg and tRNA-His. It was determined to be 318 bp in length, less than other reported Clitellata species (Zhang et al. 2016a), and it had a base composition that was rich in A and T (A+T=67.6%).

Phylogenetic analyses within the Clitellata

The phylogenetic trees (the 50% majority-rule consensus tree is shown in Figure 2) were highly consistent regardless of the analytic method used, and were statistically supported by high posterior probability and intermediate bootstrap values. This phylogenetic analysis represented the first investigation of P. corethrurus relationships within the Clitellata based on the complete mitogenome. As indicated by the tree, different species from the same family clustered together (Megascolecidae: M. guillemi, D. schmardae, A. gracilis, P. excavatus and T. birmanicus), and the species from Lumbricidae and the P. corethrurus formed a monophyletic group. The species D. japonica belongs to the Moniligastridae, the sister group to Crassiclitellata (earthworms), which explains its phylogenetic position. The Moniligastridae are not Crassiclitellata because they have a single cell layer in the clitellum.

Figure 2. 

Phylogenetic relationships among phylum Annelida based on the combined 13,416 bp nucleotide positions. Total alignment length is greater than the combined P. corethrurus protein coding and rRNA sequence lengths due to overlapping protein coding sequences that are subsequently concatenated, and indel regions in the alignment. The posterior probability value of BI analyses and bootstrap support values of ML analyses (in the order: BI, ML) are indicated near the branches.

Conclusion

For the first time, the sequencing, annotation and analysis of the mitochondrial genome of a member of Rhinodrilidae was completed. The mitogenome of P. corethrurus was found to be 14,835 bp in length and showed a similar composition in size, low GC content and gene order to earthworm mitogenomes already available. The complete mitogenome reported here is expected to allow for further studies of the P. corethrurus phylogeny and for analyses on the taxonomic status of the family Rhinodrilidae.

Declaration of interest section

The authors report no conflicts of interest and are responsible for the content and writing of the paper.

Acknowledgments

We thank Jose Talavera for the taxonomic identification of the studied specimen. This study was financially supported by the Portuguese Government (FCT project PTDC/AAC-AMB/ 115713/2009). Luis Cunha was supported by an EU Marie Curie fellowship - MSCA-IF-2014-GF-660378. George Brown, Elodie da Silva acknowledge fellowship support by CNPq. Ana Caroline Conrado was supported by a scholarship funded by CAPES. Sam James was supported by USA NSF award DEB-1136604. Dave Stanton was supported by a NERC grant (NE/M017656/1).

References

  • Anderson S, Bankier AT, Barrell BG, De Bruijn M, Coulson AR, Drouin J, Eperon I, Nierlich D, Roe BA, Sanger F (1981) Sequence and organization of the human mitochondrial genome. Nature, 290: 457–465. https://doi.org/10.1038/290457a0
  • Bernt M, Donath A, Jühling F, Externbrink F, Florentz C, Fritzsch G, Pütz J, Middendorf M, Stadler PF (2013) MITOS: Improved de novo metazoan mitochondrial genome annotation. Molecular Phylogenetics and Evolution 69: 313–319. https://doi.org/10.1016/j.ympev.2012.08.023
  • Bhattacharjee G, Chaudhuri P (2002) Cocoon production, morphology, hatching pattern and fecundity in seven tropical earthworm species—a laboratory-based investigation. Journal of Biosciences 27: 283–294. https://doi.org/10.1007/BF02704917
  • Blakemore R, Ito M, Kaneko N (2006) Alien earthworms in the Asia/Pacific region with a checklist of species and the first records of Eukerria saltensis (Oligochaeta: Ocnerodrilidae) and Eiseniella tetraedra (Lumbricidae) from Japan, and Pontoscolex corethrurus (Glossoscolecidae) from Okinawa. Assessment and Control of Biological Invasion Risks: 173–181.
  • Boore JL, Brown WM (1995) Complete sequence of the mitochondrial DNA of the annelid worm Lumbricus terrestris. Genetics 141: 305–319.
  • Brown GG, James SW, Pasini A, Nunes DH, Benito NP, Martins PT, Sautter KD (2006) Exotic, peregrine, and invasive earthworms in Brazil: diversity, distribution, and effects on soils and plants. Caribbean Journal of Science 42: 339.
  • Buch AC, Brown GG, Niva CC, Sautter KD, Sousa JP (2013) Toxicity of three pesticides commonly used in Brazil to Pontoscolex corethrurus (Müller, 1857) and Eisenia andrei (Bouché, 1972). Applied Soil Ecology 69: 32–38. https://doi.org/10.1016/j.apsoil.2012.12.011
  • Chapuis-Lardy L, Brauman A, Bernard L, Pablo A-L, Toucet J, Mano M, Weber L, Brunet D, Razafimbelo T, Chotte J-L (2010) Effect of the endogeic earthworm Pontoscolex corethrurus on the microbial structure and activity related to CO2 and N2O fluxes from a tropical soil (Madagascar). Applied Soil Ecology 45: 201–208. https://doi.org/10.1016/j.apsoil.2010.04.006
  • Cunha L, Montiel R, Novo M, Orozco-terWengel P, Rodrigues A, Morgan AJ, Kille P (2014) Living on a volcano’s edge: genetic isolation of an extremophile terrestrial metazoan. Heredity 112: 132–142. https://doi.org/10.1038/hdy.2013.84
  • Da Silva E, Nahmani J, Lapied E, Alphonse V, Garnier-Zarli E, Bousserrhine N (2016) Toxicity of mercury to the earthworm Pontoscolex corethrurus in a tropical soil of French Guiana. Applied Soil Ecology 104: 79–84. https://doi.org/10.1016/j.apsoil.2015.11.018
  • Dupont L, Decaëns T, Lapied E, Chassany V, Marichal R, Dubs F, Maillot M, Roy V (2012) Genetic signature of accidental transfer of the peregrine earthworm Pontoscolex corethrurus (Clitellata, Glossoscolecidae) in French Guiana. European Journal of Soil Science 53: 70–75. https://doi.org/10.1016/j.ejsobi.2012.09.001
  • Hamoui V (1991) Life-cycle and growth of Pontoscolex corethrurus (Müller, 1857)(Oligochaeta, Glossoscolecidae) in the laboratory. Revue D’écologie Et de Biologie du Sol 28: 469–478.
  • Hassanin A, Léger N, Deutsch J (2005) Evidence for multiple reversals of asymmetric mutational constraints during the evolution of the mitochondrial genome of Metazoa, and consequences for phylogenetic inferences. Systematic Biology 54: 277–298. https://doi.org/10.1080/10635150590947843
  • James SW (2012) Re-erection of Rhinodrilidae Benham, 1890, a senior synonym of Pontoscolecidae James, 2012 (Annelida: Clitellata). Zootaxa 3540: 67–68.
  • James SW, Davidson SK (2012) Molecular phylogeny of earthworms (Annelida: Crassiclitellata) based on 28S, 18S and 16S gene sequences. Invertebrate Systematics 26: 213–229. https://doi.org/10.1071/IS11012
  • Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, msw054. https://doi.org/10.1093/molbev/msw054
  • Lavelle P, Barois I, Cruz I, Fragoso C, Hernandez A, Pineda A, Rangel P (1987) Adaptive strategies of Pontoscolex corethrurus (Glossoscolecidae, Oligochaeta), a peregrine geophagous earthworm of the humid tropics. Biology and Fertility of Soils 5: 188–194. https://doi.org/10.1007/BF00256899
  • Lowe TM, Eddy SR (1997) tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Research 25: 955–964. https://doi.org/10.1093/nar/25.5.0955
  • Marichal R, Martinez AF, Praxedes C, Ruiz D, Carvajal AF, Oszwald J, del Pilar Hurtado M, Brown GG, Grimaldi M, Desjardins T (2010) Invasion of Pontoscolex corethrurus (Glossoscolecidae, Oligochaeta) in landscapes of the Amazonian deforestation arc. Applied Soil Ecology 46: 443–449. https://doi.org/10.1016/j.apsoil.2010.09.001
  • Nylander J (2004) MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University 2.
  • Perna NT, Kocher TD (1995) Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. Journal of Molecular Evolution 41: 353–358. https://doi.org/10.1007/BF01215182
  • Xia X, Xie Z (2001) DAMBE: software package for data analysis in molecular biology and evolution. Journal of Heredity 92: 371–373.
  • Zardoya R, Garrido-Pertierra A, Bautista JM (1995) The complete nucleotide sequence of the mitochondrial DNA genome of the rainbow trout, Oncorhynchus mykiss. Journal of Molecular Evolution: 942–951. https://doi.org/10.1007/BF00173174
  • Zhang L, Jiang J, Dong Y, Qiu J (2015) Complete mitochondrial genome of four pheretimoid earthworms (Clitellata: Oligochaeta) and their phylogenetic reconstruction. Gene 574: 308–316. https://doi.org/10.1016/j.gene.2015.08.020
  • Zhang L, Jiang J, Dong Y, Qiu J (2016a) Complete mitochondrial genome of an Amynthas earthworm, Amynthas aspergillus (Oligochaeta: Megascolecidae). Mitochodrial DNA Part A 27: 1876–1877.
  • Zhang L, Sechi P, Yuan M, Jiang J, Dong Y, Qiu J (2016b) Fifteen new earthworm mitogenomes shed new light on phylogeny within the Pheretima complex. Scientific Reports: 6. https://doi.org/10.1038/srep20096
  • Zhao L, Gao T, Lu W (2015) Complete mitochondrial DNA sequence of the endangered fish (Bahaba taipingensis): Mitogenome characterization and phylogenetic implications. ZooKeys 546: 181–195. https://doi.org/10.3897/zookeys.546.5964

Supplementary material

Supplementary material 1 

Inferred secondary structure of 22 tRNA genes in the mitochondrial DNA of the pantropical earthworm Pontoscolex corethrurus (Rhinodrilidae, Clitellata).

Ana C. Conrado, Hugo Arruda, David W.G. Stanton, Samuel W. James, Peter Kille, George Brown, Elodie Silva, Lise Dupont, Shabnam Taheri, Andrew J. Morgan, Nelson Simões, Armindo Rodrigues, Rafael Montiel8, Luis Cunha

Data type: molecular data

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (1.66 MB)
login to comment