Research Article
Print
Research Article
A new species of Diglyphus Walker (Hymenoptera, Eulophidae) from China, with morphological characterizations and molecular analysis
expand article infoWei-Jie Wan‡, Su-Jie Du‡, Christer Hansson§|, Wan-Xue Liu‡
‡ Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing, China
§ Natural History Museum, London, United Kingdom
| Lund University, Lund, Sweden

Corresponding author: Wan-Xue Liu ( liuwanxue@caas.cn )

Academic editor: Zachary Lahey
© 2023 Wei-Jie Wan, Su-Jie Du, Christer Hansson, Wan-Xue Liu.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Wan W-J, Du S-J, Hansson C, Liu W-X (2023) A new species of Diglyphus Walker (Hymenoptera, Eulophidae) from China, with morphological characterizations and molecular analysis. ZooKeys 1148: 65-78. https://doi.org/10.3897/zookeys.1148.98853
ZooBank: urn:lsid:zoobank.org:pub:526E2D0A-EFBE-49D8-9C90-83978808D3BA
Open Access

Abstract

Diglyphus Walker, 1844 (Hymenoptera: Eulophidae) is an economically important genus including species acting as biocontrol agents against agromyzid leafminer pests. A new species of Diglyphus, Diglyphus difasciatus Liu, Hansson & Wan, sp. nov., was discovered during the identification of agromyzid leafminers and their associated parasitoid wasps collected from 2016 to 2022 in China, based on morphological characteristics and molecular analyses of COI, ITS2 and 28S genes. Diglyphus difasciatus is similar to D. bimaculatus Zhu, LaSalle & Huang, distinguished by two interconnected infuscate vertical bands on the fore wing and the color of the scape. Molecular data support D. difasciatus and D. bimaculatus as two different species. The mean genetic distances between D. difasciatus and D. bimaculatus were 11.33%, 8.62%, and 0.18%, based on the COI, ITS2, and 28S genes, respectively.

Keywords

28S, Agromyzidae, biology, COI, ITS2, occurrence, parasitic wasp, phylogeny, taxonomy

Introduction

The genus Diglyphus (Hymenoptera: Eulophidae) was described by Walker (1844). Many taxonomists worldwide have summarized the typical Diglyphus morphological characteristics and introduced new Diglyphus species (Gordh and Hendrickson 1979; Zhu et al. 2000; Yefremova 2007; Hansson and Navone 2017). Diglyphus currently includes 41 species, and 17 of these are recorded from China (Gordh and Hendrickson 1979; Gauthier et al. 2000; Zhu et al. 2000; Liu et al. 2013; Hansson and Navone 2017; Ye et al. 2018; Noyes 2019).

Diglyphus is an economically important genus containing species that attack Agromyzidae (Diptera) leafminers and occasionally Lepidoptera pests (Gelechiidae, Gracillariidae, Lyonetiidae, and Nepticulidae) (Zhu et al. 2000; Yefremova et al. 2011; Hansson and Navone 2017; Noyes 2019). Agromyzidae leafminers such as Chromatomyia horticola (Goureau) and Liriomyza spp. are pests of vegetables and ornamental plants worldwide (Bader et al. 2006; Kaspi and Parrella 2006; Foba et al. 2016; Rajender and Sharma 2016).

Identification of Diglyphus species mainly depends on morphological data. However, combining analyses of the morphology with molecular data for species identification is essential owing to the morphological similarities among species (Bernardo et al. 2008; Gebiola et al. 2012; Hansson and Navone 2017; Ye et al. 2018). The cytochrome c oxidase I (COI) gene of the mitochondrial DNA and internal transcribed spacer II (ITS2) ribosomal DNA genes have previously been applied to enhance species identification (Hebert et al. 2003; Bernardo et al. 2008; Gebiola et al. 2009; Gebiola et al. 2012; Gebiola et al. 2015; Du et al. 2021). Although 28S ribosomal DNA (28S) has mostly used for phylogenetic studies at the genus level and above, it has also been used for species identification (Gauthier et al. 2000; Gebiola et al. 2009; Burks et al. 2011; Gebiola et al. 2015).

For this project we collected Diglyphus material from 33 sites in China during 2016 to 2022 (Fig. 11). The specimens were reared mainly from the agromyzid Chromatomyia horticola (Table 1). An undescribed species of Diglyphus, D. difasciatus Liu, Hansson & Wan, was discovered during the identification of the reared material. Altogether we recovered 125 female and 153 male specimens of D. difasciatus (Table 1).

Table 1.
Download as
CSV
XLSX

Collecting information of Diglyphus difasciatus sp. nov. specimens.

Specimens Sampling locality GPS coordinates Host plants Host Sampling date
5♀, 2♂ (4♀) Longnan, Gansu 33°23'58"N, 104°49'39"E Sonchus oleraceus C. horticola 2019.05
1♀ Baiyin, Gansu 36°32'4"N, 104°10'21"E Phaseolus vulgaris L. sativae 2018.09
7♀, 1♂ Chifeng, Inner Mongolia 42°02'50"N, 120°23'25"E Phaseolus vulgaris Unknown 2018.08
1♂ Guyuan, Ningxia 36°01'31"N, 106°12'41"E Raphanus sativus C. horticola and L. huidobrensis 2018.09
1♂ Guyuan, Ningxia 36°01'31"N, 106°12'41"E Sonchus oleraceus C. horticola 2018.09
1♀ (1♀) Gonghe, Qinghai 36°16'35"N, 100°34'13"E Sonchus oleraceus C. horticola 2018.07
1♀ (1♀) Baoji, Shaanxi 34°19'41"N, 107°13'56"E Chrysanthemum morifolium Unknown 2019.05
1♂ Baoji, Shaanxi 34°19'41"N, 107°13'56"E Glebionis coronaria Unknown 2019.05
1♀, 1♂ Yantai, Shandong 37°17'26"N, 121°33'46"E Sonchus oleraceus Unknown 2017.05
1♀ Rizhao, Shandong 35°17'29"N, 119°11'37"E Phaseolus vulgaris L. sativae 2018.10
1♂ (1♂) Linyi, Shandong 35°50'11"N, 118°28'56"E Brassica napus C. horticola 2019.05
2♀, 4♂ (1♂) Xinzhou, Shanxi 39°11'23"N, 113°15'14"E Lepidium apetalum C. horticola 2017.06
1♀ Xinzhou, Shanxi 39°11'23"N, 113°15'14"E Alcea rosea C. horticola 2017.06
1♀, 3♂ Xinzhou, Shanxi 39°11'23"N, 113°15'14"E Brassicaceae sp. C. horticola and L. bryoniae 2017.06
3♂ (2♂) Linfen, Shanxi 36°04'30"N, 111°30'5"E Pisum sativum C. horticola and L. trifolii 2017.06
1♀, 2♂ Xinzhou, Shanxi 39°11'23"N, 113°15'14"E Lepidium apetalum C. horticola 2017.06
3♂ Xinzhou, Shanxi 39°11'36"N, 113°16'27"E Sonchus oleraceus C. horticola 2017.07
1♀ Xinzhou, Shanxi 39°11'36"N, 113°16'27"E Cirsium arvense var. integrifolium C. horticola and L. bryoniae 2017.07
1♂ Xinzhou, Shanxi 39°11'36"N, 113°16'27"E Sonchus oleraceus Unknown 2017.07
6♀, 3♂ (3♀) Xinzhou, Shanxi 39°11'36"N, 113°16'27"E Asteraceae sp. Unknown 2017.07
2♀, 2♂ Xinzhou, Shanxi 39°11'12"N, 113°14'30"E Lepidium apetalum C. horticola 2018.05
2♀, 2♂ (1♀, 1♂) Changzhi, Shanxi 36°11'8"N, 113°04'22"E Cirsium japonicum C. horticola 2018.05
1♀ Changzhi, Shanxi 36°11'8"N, 113°04'22"E Taraxacum mongolicum C. horticola 2018.05
2♀, 2♂ (1♀, 1♂) Yangquan, Shanxi 38°05'37"N, 113°22'45"E Alcea rosea C. horticola 2018.05
3♂ Xinzhou, Shanxi 39°10'33"N, 113°17'35"E Asteraceae sp. C. horticola 2018.05
3♀ (2♀) Xinzhou, Shanxi 39°10'33"N, 113°17'35"E Asteraceae sp. C. horticola and L. sativae 2018.09
3♀, 5♂ (2♀, 1♂) Jincheng, Shanxi 35°29'33"N, 112°54'16"E Lepidium apetalum C. horticola 2019.05
6♀, 12♂ (2♀, 3♂) Jincheng, Shanxi 35°29'33"N, 112°54'16"E Crepidiastrum sonchifolium C. horticola 2019.05
5♀, 3♂ (2♀, 1♂) Jincheng, Shanxi 35°29'33"N, 112°54'16"E Ixeris polycephala C. horticola 2019.05
2♀, 2♂ (1♂) Beijing 40°01'22"N, 116°17'9"E Glebionis coronaria C. horticola 2016.05
4♀, 23♂ (1♀,1♂) Beijing 40°39'35"N, 117°13'55"E Raphanus sativus C. horticola, L. bryoniae and L. sativae 2016.06
5♀, 3♂ (2♀, 1♂) Beijing 40°39'35"N, 117°13'55"E Pisum sativum C. horticola 2016.06
2♀ Beijing 40°08'41"N, 116°45'36"E Glebionis coronaria C. horticola 2017.05
1♂ (1♂) Beijing 40°08'41"N, 116°45'36"E Glebionis coronaria C. horticola 2017.05
2♂ Beijing 39°36'18"N, 116°18'57"E Ixeris polycephala C. horticola and L. bryoniae 2017.05
1♂ Beijing 40°01'17"N, 116°17'15"E Phaseolus vulgaris C. horticola 2017.08
5♀, 6♂ Beijing 40°01'34"N, 116°16'51"E Crepidiastrum sonchifolium C. horticola 2018.05
1♂ (1♂) Beijing 40°16'21"N, 116°13'30"E Lactuca sativa var. asparagina C. horticola 2018.05
4♀ (2♀) Beijing 39°52'32"N, 116°11'21"E Ixeris polycephala C. horticola 2019.05
5♀ (3♀) Beijing 39°36'18"N, 116°18'57"E Hemisteptia lyrata C. horticola and L. sativae 2019.05
8♀, 14♂ (3♀, 3♂) Beijing 40°01'23"N, 116°17'9"E Crepidiastrum sonchifolium C. horticola 2019.05
4♀, 2♂ (2♀, 1♂) Beijing 40°01'23"N, 116°17'9"E Ixeris polycephala C. horticola and L. bryoniae 2019.05
1♂ Beijing 40°11'28"N, 116°28'0"E Luffa aegyptiaca Unknown 2019.08
2♀ (1♀) Shijiazhuang, Hebei 37°51'27"N, 114°32'12"E Ixeris polycephala C. horticola 2017.05
3♀, 1♂ (2♀) Shijiazhuang, Hebei 38°16'48"N, 114°41'59"E Asteraceae sp. C. horticola 2017.05
1♀ (1♀) Shijiazhuang, Hebei 40°45'38"N, 114°51'32"E Lepidium apetalum Unknown 2018.06
3♀, 5♂ Shijiazhuang, Hebei 41°09'11"N, 114°03'40"E Sonchus oleraceus C. horticola 2018.07
8♀, 10♂ Shijiazhuang, Hebei 41°09'11"N, 114°03'40"E Pisum sativum C. horticola 2018.07
1♀ (1♀) Shijiazhuang, Hebei 41°09'11"N, 114°03'40"E Lactuca sativa var. asparagina C. horticola 2018.07
6♀, 7♂ Shijiazhuang, Hebei 41°14'30"N, 114°09'25"E Lactuca sativa C. horticola and L. bryoniae 2018.08
5♀, 14♂ (3♀, 4♂) Zhangjiakou, Hebei 41°14'30"N, 114°09'25"E Lactuca sativa C. horticola 2018.08
1♀ (1♀) Zhangjiakou, Hebei 41°24'30"N, 114°09'8"E Taraxacum mongolicum C. horticola 2019.07
2♂ (2♂) Zhangjiakou, Hebei 41°24'30"N, 114°09'8"E Pisum sativum C. horticola 2019.07
1♀ Zhangjiakou, Hebei 41°24'30"N, 114°09'8"E Asteraceae sp. C. horticola 2019.08
2♀, 2♂ Zhangjiakou, Hebei 41°09'11"N, 114°03'40"E Lactuca sativa and Brassica rapa var. glabra C. horticola 2022.08

Note: The number and sex of molecular identification specimens were in brackets.

Materials and methods

Sampling

We collected the leaves of vegetables and ornamental plants infested with agromyzid leafminers in different provinces of China from 2016 to 2022. The leaves were placed in cages and each cage was labeled with collection date, locality, and host plant. The collected leaf material was maintained in climate chambers set at 25 ± 1 °C, 30–50% relative humidity, and a photoperiod of 14:10 h (light: dark) until agromyzid leafminers and their parasitoids emerged. All wasp specimens and their hosts were preserved in absolute ethanol and maintained at -20 °C at the Institute of Plant Protection (IPP), Chinese Academy of Agricultural Sciences (CAAS), Beijing, China. All data for D. difasciatus specimens are presented in Table 1.

Two males and two females of D. difasciatus reared from C. horticola were imaged and morphologically characterized. One male and one female (the holotype) were reared from leaves of Lactuca sativa Linn. and Brassica rapa var. glabra Regel in Hebei, China; one female was reared from leaves of Sonchus oleraceus Regel in Gansu, China; one male was reared from leaves of L. sativa in Hebei, China. Two female and one male of D. bimaculatus Zhu, LaSalle & Huang were used for imaging and morphological characterization, which were reared from leaves of Sonchus oleraceus in Tibet, China. Specimens used for molecular analyses included 67 specimens of D. difasciatus, 1♀ D. bimaculatus (Tibet), and 1♀ D. isaea (Walker) (Hubei). Diglyphus bimaculatus and D. isaea sequences were used as outgroups for analyzing the phylogenetic relationship of D. difasciatus. Furthermore, one female of D. bimaculatus used for molecular analyses was reared from leaves of Taraxacum mongolicum Hand.-Mazz., which was collected from Tibet, China (29°39'3"N, 91°08'41"E) in August 2020. The single D. isaea specimen was reared from C. horticola in Pisum sativum Linn. leaves, collected in Hubei, China (30°28'26"N, 114°21'17"E) in April 2017.

Morphological identification methods

The specimens were examined using a stereomicroscope (Olympus, SZX-16). Photographs were taken using an Olympus BX43 microscope equipped with a Helicon Focus 6.

The morphological terminology and measurement methods follow Gibson (1989), Hansson (1990), and Yefremova et al. (2011), and the following abbreviations were used:

F1–2 Flagellomeres 1–2: maximum length of flagellomeres 1–2.

OOL Ocular ocellar line: shortest distance between the lateral ocelli and eyes.

POL Posterior ocellar line: shortest distance between lateral ocelli.

Molecular diagnosis methods

Genomic DNA was extracted from the metasoma of each specimen. The extraction methods followed those described by De Barro and Driver (1997), with some modifications. The DNA extraction was performed using a 200-µL microcentrifuge tube (Bioevopeak, Shandong, China) and 200-µL pipette tip (Bioevopeak) sealed by heating to grind the metasoma into a homogenate. The homogenate was incubated at 65 °C, 25 °C, and 96 °C for 30, 2, and 10 min, respectively. After extraction, the genomic DNA was stored at -20 °C until molecular diagnosis. The primers used for amplification were in Table 2.

Table 2.
Download as
CSV
XLSX

Primers used for amplification.

Gene Primers Sequences (5’-3’) References
COI LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. 1994
ITS2 ITS2F TGTGAACTGCAGGACACATG Campbell et al. 1993
ITS2R AATGCTTAAATTTAGGGGGTA Campbell et al. 1993
28S D2-3549F AGTCGTGTTGCTTGATAGTGCAG Campbell et al. 1993
D2-4068R TTGGTCCGTGTTTCAAGACGGG Campbell et al. 1993

Amplifications were performed as described by Hebert et al. (2003) and Du et al. (2021). Polymerase chain reaction (PCR) consisted of 0.4 μL Taq enzyme (2.5 UμL-1), 0.4 μL deoxynucleotide triphosphate (2.5 mM), 2.5 μL 10× buffer (containing Mg2+), 0.4 μL forward primer, 0.4 μL reverse primer, 1 μL DNA template, and 19.9 μL double-distilled H2O. Next, the PCR cycling conditions consisted of an initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing for 45 s, extension at 72 °C for 60 s, and a single cycle of final extension at 72 °C for 5 min. The annealing temperatures for the COI, ITS2, and 28S genes were 50 °C, 52 °C, and 58 °C, respectively.

The unpurified PCR products were sent to Sangon Biotech Co., Ltd, Beijing, China, for bidirectional sequencing, and primers were designed by Sangon Biotech Co., Ltd, Beijing, China. The PCR instrument used was an ABI thermal cycler (Applied Biosystems Veriti 9902; Woburn, MA, USA).

Sequence analysis

The D. difasciatus sequences were analyzed using the National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/) and the Barcode of Life Data systems (BOLD, http://www.boldsystems.org/index.php). The phylogenetic relationships between D. difasciatus, D. bimaculatus, and D. isaea were also analyzed.

All sequences were aligned following the default options of the CLUSTAL W tool (Kimura 1980); in Molecular Evolutionary Genetics Analysis (MEGA) X ver. 10.1.8 (Kimura 1980; Kumar et al. 2018). Pairwise and mean sequence divergence were estimated based on the Kimura-2 parameter (K2-P) (Kimura 1980). Gene haplotypes were calculated using DNA sequence polymorphism ver. 5 (Bioinformatics, Arlington, VA, USA) (Librado and Rozas 2009). The phylogenetic tree was constructed using the Neighbor-Joining method in MEGA X (Kimura 1980; Nei and Kumar 2000; Kumar et al. 2018). Bootstrap values were obtained after 1000 replications for sequence divergence and phylogenetic relationships. Bootstrap support values ≥75% is indicated above the branches of the phylogenetic tree.

Results

Taxonomy

Diglyphus difasciatus Liu, Hansson & Wan, sp. nov.

https://zoobank.org/DA756718-6C6B-4958-8375-BED1BF06EE3C
Figs 1–2, 3–7

Material

Holotype female: China, Hebei; 41°09'11"N, 114°03'40"E; 25 August 2022; Miao-Miao Mao leg.; reared from Chromatomyia horticola on leaves of Lactuca sativa and Brassica rapa var. glabra, deposited in IPP. Paratypes: 1♀ 2♂ with same label data as holotype, deposited in National Animal Collection Resource Center, Institute of Zoology, Chinese Academy of Sciences. 1♀ China, Beijing; 39°52'32"N, 116°11'21"E; 11 May 2019; Qiang Wu leg.; reared from C. horticola on leaves of Sonchus oleraceus and Ixeris polycephala, deposited in National Animal Collection Resource Center, Institute of Zoology, Chinese Academy of Sciences. 2♀ China, Beijing; 39°36'18"N, 116°18'57"E; 20 May 2019; Jing He and Meng Guo leg.; reared from C. horticola on leaves of Hemisteptia lyrata, deposited in IPP. 1♀ 2♂ China, Shanxi; 39°11'23"N, 113°15'14"E; 6 June 2017; Zhu-Sheng Zheng leg.; reared from C. horticola on leaves of Lepidium apetalum, deposited in IPP. 1♀ 2♂ China, Shanxi; 36°11'8"N, 113°04'22"E; 17 May 2018; Jing He and Su-Jie Du leg.; reared from C. horticola on leaves of Cirsium japonicum, deposited in IPP. 3♀ 5♂ China, Shanxi; 35°29'33"N, 112°54'16"E; 9 May 2019; Jing He and Su-Jie Du leg.; reared from C. horticola on leaves of Crepidiastrum sonchifolium, deposited in IPP. 2♀ 1♂ China, Hebei; 38°16'48"N, 114°41'59"E; 14 May 2017; Rong-Jun Zhen and Gui-Fen Zhang leg.; reared from C. horticola on leaves of an unidentified Asteraceae, deposited in IPP.

Diagnosis

Scape white with apical 1/3–1/2 dark brown (Figs 1–5). The yellow markings on the vertex and face, and those on the male are wider than those on the female. Fore wing with complete vertical infuscate bands below base of marginal and stigmal veins respectively, the two bands are interconnected medially (Figs 1–3, 7); speculum bare, without dense setae and postmarginal vein almost equal in length to stigmal vein (Figs 1–3, 7). Mid and hind femora black with apical 1/4 yellowish-white (Figs 1–3). Fore and mid tibia yellowish-white with a dark ring basally (Figs 1–3). Hind tibia black with apical 1/5 yellowish-white (Figs 1–3). Pretarsus on all legs black (Figs 1–3).

Figures 1–2. 

Diglyphus difasciatus sp. nov. 1 female holotype, habitus, dorsal view 2 male paratype, habitus, dorsal view.

Description

Female (Fig. 1). Body length 1.6mm, Fore wing length 0.8mm. Scape white with apical 1/3–1/2 dark brown. Pedicel and flagellum dark brown. Head dark brown. Eyes red and ocelli brown. Mandibles brownish. Yellow markings on the vertex and face. Pronotum, mesoscutum, scutellum, dorsellum, and propodeum metallic blue-green. Fore wing with two complete vertical infuscate bands below base of marginal and stigmal veins respectively, the two bands are interconnected medially (Fig. 7). Mid and hind femora black with apical 1/4 yellowish-white. Fore and mid tibia yellowish-white with a dark ring basally. Hind tibia black with apical 1/5 yellowish-white. Gaster dark brown.

Head (Fig. 1). Head length 0.6× width in dorsal view, and length 0.9× width in frontal view. POL 1.8× OOL. Malar space 0.7× height of eye, and malar sulcus present. Frons and vertex with distinct reticulation. Eyes with sparse and short setae. Toruli situated below the level of lower margin of eyes. Maxillary palpus with two segments and labial palpus with one segment. Antennal flagellum with two funiculars and three clavomeres; scape 4.0× as long as broad and 2.8× as long as pedicel; pedicel 1.3× as long as broad; F1 1.4× and F2 0.9× as long as broad, F1 1.5× as long as F2; clava 2.4× as long as broad, 1.3× as long as scape, and 3.6× as long as F2.

Mesosoma (Fig. 1). Pronotum without transverse carina, reticulate, shorter than mesoscutum. Mesoscutum 1.2× as long as scutellum; mid lobe with two pairs of long setae; notauli incomplete and diverging posteriorly to meet anterior part of axillae. Setae on pronotum and mesoscutum pale. Scutellum as long as broad with straight sublateral grooves and two pairs of setae. Dorsellum with superficial reticulation with isodiametric meshes, posterior margin round. Propodeum shorter than scutellum and without median carina; callus with five setae. Fore wing with 5–7 setae on dorsal surface of submarginal vein; speculum mainly bare, with few scattered setae; costal cell with two rows of setae, including 15 setae at the base of costal cell and an incomplete row with eight setae in apical part; postmarginal vein almost equal in length to stigmal vein; Fore wing length 1.7× fore wing width. Petiole short and inconspicuous. Gaster subrotund, 1.9× as long as wide in dorsal view; apex acute. Tip of ovipositor sheaths visible in dorsal view.

Male (Fig. 2). Similar to the female. Body length 1.4mm, Fore wing length 0.8mm. Head length 0.5× width in dorsal view, and length 0.8× width in frontal view. POL 1.1× OOL. Scape 4.7× as long as broad, 2.2× as long as pedicel. Pedicel 1.6× as long as broad. Antennal flagellum with two funiculars and three clavomeres, F1 0.8× and F2 0.7× as long as broad, F1 1.2× as long as F2. Clava 3.1× as long as broad, 1.1× as long as scape and 4.6× as long as F2. Mesoscutum 1.2× as long as scutellum. Scutellum as long as broad. Fore wing length 1.7× as long as fore wing width. Gaster 1.8× as long as wide in dorsal view.

Variation

Females are slightly larger than males (1.6 mm and 1.4 mm, respectively).

Hosts and biology

Diglyphus difasciatus is a larval ectoparasitoid, primarily on Chromatomyia horticola, and occasionally on Liriomyza bryoniae (Kaltenbach), L. sativae, and L. trifolii (Burgess). The hosts are usually mining in leaves of Asteraceae, Brassicaceae and Fabaceae, especially on Ixeris polycephala Cass. ex DC. and Pisum sativum (Table 1). Diglyphus difasciatus occurs and reaches its highest occurrence period in May, and then disappears in October. Female Diglyphus exhibit three types of host-killing behavior (Zhu et al. 2000; Liu et al. 2013; Hansson and Navone 2017; Ye et al. 2018). The host-killing behavior of D. difasciatus is not known and requires further studies.

Distribution

China (Beijing, Gansu, Hebei, Inner Mongolia, Ningxia, Qinghai, Shaanxi, Shandong, and Shanxi).

Etymology

The name is derived from a combination of the Latin di (double) and fascia (band) by referring to the two vertical infuscate bands in the fore wings.

Comments

Diglyphus difasciatus is very similar to D. bimaculatus (Figs 8–10), but has two complete vertical infuscate bands that are interconnected medially in the fore wing, whereas D. bimaculatus has two infuscate spots in the fore wing. In addition, the scape of D. difasciatus is white with apical 1/3–1/2 dark brown (Figs 1–5), which is less than the scape of D. bimaculatus with white upper surface (Fig. 9). Besides, molecular data support the separation of these two morphologically similar species as distinct species.

Figures 3–8. 

Diglyphus spp. 3–7 D. difasciatus sp. nov. 3 female paratype, habitus, lateral view 4 female paratype, antenna, lateral view 5 male paratype, head, lateral view 6 male paratype, mesosoma, dorsal view 7 female holotype, left fore and hind wings, dorsal view 8 D. bimaculatus Zhu, LaSalle & Huang, female, left fore and hind wings, dorsal view.

Figures 9–10. 

Diglyphus bimaculatus 9 female habitus, lateral view 10 male habitus, dorsal view.

Molecular identification results

COI

The length of COI sequences from 67 D. difasciatus specimens was 514 bp, including 35 variable sites with 20 parsimony-informative sites, and 29 haplotypes were found (Fig. 12). The highest percentage similarity (89%) of sequences between D. difasciatus and other Diglyphus species in the NCBI and BOLD databases was with D. pulchripes (Erdös & Novicky) (NCBI accession number: MG442711).

Figure 11. 

Collection sites of Diglyphus difasciatus sp. nov. in China from 2016 to 2022.

Figure 12. 

Phylogenetic tree of the three Diglyphus species based on the COI gene. The phylogenetic tree was constructed using the maximum likelihood method based on the Neighbor-Joining model. Accession numbers submitted to GenBank are shown next to each haplotype, and bootstrap support values (≥ 75%) are shown next to the branches.

The mean genetic distance of COI sequences between D. difasciatus/D. bimaculatus and D. difasciatus/D. isaea, based on the COI gene, was 11.33% and 13.37%, respectively (Table 3). The analyses of the intraspecific diversity in D. difasciatus showed that the mean genetic distance between the 29 haplotypes was 1.53% (Table 3). The genetic distance within D. difasciatus ranged from 0.19 to 3.42%.

Table 3.
Download as
CSV
XLSX

The mean genetic distance between three Diglyphus species based on the COI, ITS2 and 28S genes.

Species COI ITS2 28S
1 2 3 1 2 3 1 2 3
1 D. difasciatus 0.0153 – –
2 D. bimaculatus 0.1133 – 0.0862 – 0.0018 –
3 D. isaea 0.1337 0.1485 – 0.0649 0.0414 – 0.0018 0.0037 –

ITS2

The length of the 25 D. difasciatus sequences was 415 bp; there were no variable sites. The highest percentage similarity of sequences in the NCBI and BOLD databases was between D. difasciatus and D. isaea (86%). The mean interspecific genetic distance between D. difasciatus/D. bimaculatus and D. difasciatus/D. isaea was 8.62% and 6.49%, respectively (Table 3).

28S

The length of the 11 sequences obtained from D. difasciatus was 547 bp; there were no variable sites. The highest percentage similarity of sequence in NCBI and BOLD between D. difasciatus and other Diglyphus species was with D. crassinervis (100% [NCBI accession number: MW393686]). The mean interspecific genetic distance between D. difasciatus, D. bimaculatus and D. isaea was 0.18% (Table 3).

All gene sequences are uploaded to GenBank with accession numbers OP933727–OP933732 and OP936054–OP936075.

Discussion

The new species, D. difasciatus, is defined by morphological data and molecular data from the genes COI, ITS2, and 28S. Morphologically, D. difasciatus is most similar to D. bimaculatus, from which it can be separated by a different wing pattern in the fore wing and the color of scape (Figs 3, 7–9). Molecular data from COI, ITS2, and 28S also show that D. difasciatus and D. bimaculatus are two different species.

Acknowledgments

We thank Miao-Miao Mao for collecting material of the new species, and Editage (www.editage.cn) for English language editing. The present was supported by the National Natural Science Foundation of China (Grant No. 31772236 and No. 31972344), the National Key R&D Program of China (Grant No. 2021YFC2600400) and the Science and Technology Innovation Program of Chinese Academy of Agricultural Sciences (Grant No. caascx-2017-2022-IAS)

References

  • Bader AE, Heinz KM, Wharton RA, Bogran CE (2006) Assessment of interspecific interactions among parasitoids on the outcome of inoculative biological control of leafminers attacking chrysanthemum. Biological Control 39(3): 441–452. https://doi.org/10.1016/j.biocontrol.2006.06.010
  • Bernardo U, Monti MM, Nappo AG, Gebiola M, Russo A, Pedata PA, Viggiani G (2008) Species status of two populations of Pnigalio soemius (Hymenoptera: Eulophidae) reared from two different hosts: An integrative approach. Biological Control 46(3): 293–303. https://doi.org/10.1016/j.biocontrol.2008.05.009
  • Burks RA, Heraty JM, Gebiola M, Hansson C (2011) Combined molecular and morphological phylogeny of Eulophidae (Hymenoptera: Chalcidoidea), with focus on the subfamily Entedoninae. Cladistics 27(6): 581–605. https://doi.org/10.1111/j.1096-0031.2011.00358.x
  • Campbell BC, Steffen-Campbell JD, Werren JH (1993) Phylogeny of the Nasonia species complex (Hymenoptera: Pteromalidae) inferred from an internal transcribed spacer (ITS2) and 28S rDNA sequences. Insect Molecular Biology 2(4): 225–237. https://doi.org/10.1111/j.1365-2583.1994.tb00142.x
  • De Barro PJ, Driver F (1997) Use of RAPD PCR to distinguish the B biotype from other biotypes of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). Australian Journal of Entomology 36(2): 149–152. https://doi.org/10.1111/j.1440-6055.1997.tb01447.x
  • Du SJ, Yefremova Z, Ye FY, Zhu CD, Guo JY, Liu WX (2021) Morphological and molecular identification of arrhenotokous strain of Diglyphus wani (Hymenoptera, Eulophidae) found in China as a control agent against agromyzid leafminers. ZooKeys 1071: 109–126. https://doi.org/10.3897/zookeys.1071.72433
  • Foba CN, Salifu D, Lagat ZO, Gitonga LM, Akutse KS, Fiaboe KKM (2016) Liriomyza leafminer (Diptera: Agromyzidae) parasitoid complex in different agroecological zones, seasons, and host plants in Kenya. Environmental Entomology 45(2): 357–366. https://doi.org/10.1093/ee/nvv218
  • Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.
  • Gauthier N, LaSalle J, Quicke DLJ, Godfray HCJ (2000) Phylogeny of Eulophidae (Hymenoptera: Chalcidoidea), with a reclassification of Eulophinae and the recognition that Elasmidae are derived eulophids. Systematic Entomology 25(4): 521–539. https://doi.org/10.1046/j.1365-3113.2000.00134.x
  • Gebiola M, Bernardo U, Monti MM, Navone P, Viggiani G (2009) Pnigalio agraules (Walker) and Pnigalio mediterraneus Ferriere & Delucchi (Hymenoptera: Eulophidae): two closely related valid species. Journal of Natural History 43(39–40): 2465–2480. https://doi.org/10.1080/00222930903105088
  • Gebiola M, Gomez-Zurita J, Monti MM, Navone P, Bernardo U (2012) Integration of molecular, ecological, morphological and endosymbiont data for species delimitation within the Pnigalio soemius complex (Hymenoptera: Eulophidae). Molecular Ecology 21(5): 1190–1208. https://doi.org/10.1111/j.1365-294X.2011.05428.x
  • Gebiola M, Bernardo U, Ribes A, Gibson GAP (2015) An integrative study of Necremnus Thomson (Hymenoptera: Eulophidae) associated with invasive pests in Europe and North America: taxonomic and ecological implications. Zoological Journal of the Linnean Society 173(2): 352–423. https://doi.org/10.1111/zoj.12210
  • Gibson GAP (1989) Phylogeny and classification of Eupelmidae, with a revision of the world genera of Calosotinae and Metapelmatinae (Hymenoptera: Chalcidoidea). Memoirs of the Entomological Society of Canada 121(S149): 1–149. https://doi.org/10.4039/entm121149fv
  • Gordh G, Hendrickson Jr R (1979) New species of Diglyphus, a world list of the species, taxonomic notes, and a key to New World species of Diglyphus and Diaulinopsis (Hymenoptera: Eulophidae). Proceedings of the Entomological Society of Washington 81: 666–684.
  • Hansson C (1990) A taxonomic study on the Palearctic species of Chrysonotomyia Ashmead and Neochrysocharis Kurdjumov (Hymenoptera: Eulophidae). Entomologica Scandinavica 21(1): 29–52. https://doi.org/10.1163/187631290X00021
  • Hansson C, Navone P (2017) Review of the European species of Diglyphus Walker (Hymenoptera: Eulophidae) including the description of a new species. Zootaxa 4269(2): 197–229. https://doi.org/10.11646/zootaxa.4269.2.2
  • Hebert P, Cywinska A, Ball S, Dewaard J (2003) Biological identifications through DNA barcodes. Proceedings. Biological Sciences 270(1512): 313–321. https://doi.org/10.1098/rspb.2002.2218
  • Kaspi R, Parrella MP (2006) Improving the biological control of leafminers (Diptera: Agromyzidae) using the sterile insect technique. Journal of Economic Entomology 99(4): 1168–1175. https://doi.org/10.1093/jee/99.4.1168
  • Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16(2): 111–120. https://doi.org/10.1007/BF01731581
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Molecular Biology and Evolution 35(6): 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Liu WX, Wang WX, Wang W, Zhang YB, Wan FH (2013) Characteristics and application of Diglyphus parasitoids (Hymenoptera: Eulophidae: Eulophinae) in controlling the agromyzid leafminer. Acta Entomologica Sinica 56: 427–437. [In Chinese]
  • Nei M, Kumar S (2000) Molecular evolution and phylogenetics. Oxford University Press, New York, 333 pp.
  • Rajender K, Sharma PL (2016) Studies on diversity and abundance of parasitoids of Chromatomyia horticola (Goureau) (Agromyzidae: Diptera) in north-western Himalayas, India. Journal of Applied and Natural Science 8(4): 2256–2261. https://doi.org/10.31018/jans.v8i4.1121
  • Ye FY, Zhu CD, Yefremova Z, Liu WX, Guo JY, Wan FH (2018) Life history and biocontrol potential of the first female-producing parthenogenetic species of Diglyphus (Hymenoptera: Eulophidae) against agromyzid leafminers. Scientific Reports 8(1): 3222. https://doi.org/10.1038/s41598-018-20972-3
  • Yefremova Z (2007) The subfamilies Eulophinae, Euderinae and Entedoninae (Hymenoptera: Eulophidae) in Yemen. Fauna of Arabia 23: 335–368.
  • Yefremova Z, Civelek HS, Boyadzhiyev P, Dursun O, Eskin A (2011) A review of Turkish Diglyphus Walker (Hymenoptera: Eulophidae), with description of a new species. Annales de la Société Entomologique de France 47(3–4): 273–279. https://doi.org/10.1080/00379271.2011.10697720

Supplementary material

Supplementary material 1 

The genetic distance between three Diglyphus species based on the COI gene

Wei-Jie Wan, Su-Jie Du, Christer Hansson, Wan-Xue Liu

Data type: phylogenetic

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (15.73 kb)
login to comment