Research Article
Print
Research Article
A new species of Dipsas (Serpentes, Dipsadidae) from central Panama
expand article infoJulie M. Ray‡, Paola Sánchez-Martínez§, Abel Batista|#, Daniel G. Mulcahy¤, Coleman M. Sheehy III«, Eric N. Smith», R. Alexander Pyron¤˄, Alejandro Arteaga˅
‡ University of Nevada-Reno, Reno, United States of America
§ Museu de Zoologia da Universidade de São Paulo, São Paulo, Brazil
| Universidad Autónoma de Chiriquí (UNACHI), David, Panama
¶ Fundación Los Naturalistas, Boquete, Panama
# Sistema Nacional de Investigación (SNI), Senacyt, Panama
¤ National Museum of Natural History, Smithsonian Institution, Washington, United States of America
« University of Florida, Gainesville, United States of America
» University of Texas at Arlington, Arlington, United States of America
˄ The George Washington University, Washington, United States of America
˅ Biodiversity Field Lab (BioFL), Khamai Foundation, Quito, Ecuador

Corresponding author: Julie M. Ray ( teamsnakepanama@gmail.com )

Academic editor: Robert Jadin
© 2023 Julie M. Ray, Paola Sánchez-Martínez, Abel Batista, Daniel G. Mulcahy, Coleman M. Sheehy III, Eric N. Smith, R. Alexander Pyron, Alejandro Arteaga.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Ray JM, Sánchez-Martínez P, Batista A, Mulcahy DG, Sheehy III CM, Smith EN, Pyron RA, Arteaga A (2023) A new species of Dipsas (Serpentes, Dipsadidae) from central Panama. ZooKeys 1145: 131-167. https://doi.org/10.3897/zookeys.1145.96616
ZooBank: urn:lsid:zoobank.org:pub:044CC09C-3FF7-4B4C-B27B-FA776A6A5FE0
Open Access

Abstract

A new species of Dipsas Laurenti, 1768, from Central Panama is described based on molecular analyses, hemipenial morphology, and external characters. This is the sixth species of Dipsas to be described for the country; the snake has been suspected to exist since 1977 and has not been thoroughly studied until now. Additionally, morphological comparations including scale counts are done with other species within the genus, and the current geographic distribution of Dipsas temporalis (Werner, 1909), the sister species, is updated. Finally, a key to the species of Dipsas currently known from Middle America is presented.

Resumen

Describimos una nueva especies de Dipsas Laurenti, 1768 de la región central de Panamá en base a análisis moleculares, morfología hemipenial y caracteres de morfología externa. Esta es la sexta especie del género Dipsas descrita para el país. Se sospechaba su existencia desde 1977 pero no había sido estudiada exhaustivamente hasta ahora. Adicionalmente, presentamos comparaciones morfológicas (incluyendo lepidosis) con otras especies del género y actualizamos la distribución geográfica de su especie hermana Dipsas temporalis (Werner, 1909). Finalmente, presentamos una clave para las especies de Dipsas distribuidas en Centroamérica.

Keywords

Dipsadini, Dipsas temporalis, new species, phylogeny, snail-eating snake, systematics

Introduction

The Neotropical snake genus Dipsas Laurenti, 1768, belongs to the tribe Dipsadini, a group of primarily arboreal snakes that includes the genera Dipsas, Plesiodipsas Harvey et al., 2008, Sibon Fitzinger, 1826, and Tropidodipsas Günther, 1858 (Harvey et al. 2008; Zaher et al. 2009; Grazziotin et al. 2012; Arteaga et al. 2018). The “snail-eating” snakes (Mertens 1952; Peters 1956) or “snail-suckers” (Peters 1956) are part of a larger group of neotropical snakes called the “goo-eaters” (Cadle and Greene 1993) because of their proclivity for feeding on soft and often slimy invertebrates. According to Cadle and Greene (1993), the “goo-eaters” also include the mainly earthworm- and slug-eating species in the genera Adelphicos Jan, 1862, Atractus Wagler, 1828, Geophis Wagler, 1830, and Ninia Baird & Girard, 1853, and possibly also Chersodromus Reinhardt, 1860 and Cryophis Bogert & Duellman, 1963 (see Sheehy 2012); though, Cryophis is also known for preying on salamanders (Mulcahy 2007). The discovery of a broader diet for some snail-eating snakes of the genera Sibon and Dipsas to include additional invertebrates and anuran eggs further refined our understanding of the diet of these snakes (Ryan and Lips 2004; Montgomery et al. 2007; Ray et al. 2012).

The genus Dipsas currently contains 53 small- to moderately-sized species that can be distinguished from the other genera of the tribe by external features, such as body often strongly compressed (in arboreal taxa), head distinct from neck, usually more than 10 infralabials, vertebral scale row usually enlarged, preoculars 0–2, supralabials and infralabials not notably enlarged, mental groove very weak to absent, and often two or more pairs of infralabials in contact behind mental (Peters 1960; Harvey and Embert 2008; Uetz et al. 2022). Harvey and Embert (2008) also describe internal characteristics, including a well-developed tracheal lung and characteristics of the hemipenes. Species of Dipsas are Neotropical and range from central Mexico to southern South America (Peters 1960; Solórzano 2004; Ray 2009), and five species are currently recognized in Panamanian territory: D. articulata Cope, 1868, D. nicholsi (Dunn, 1933), D. temporalis (Werner, 1909), D. tenuissima Taylor, 1954, and D. viguieri (Bocourt, 1884). Detailed reviews of Panamanian Dipsas are provided by Peters (1960), Savage (2002), Cadle and Myers (2003), and Ray (2017). Of these, D. tenuissima is at the southern and easternmost extent of its range and D. viguieri is at the northern and westernmost extent of its range in Panama (Ray 2017). Based on current information, D. nicholsi is endemic to the country, with most records found east of the Panama Canal and one record west of it (Myers et al. 2007). Dipsas temporalis was, until now, one of the most widespread of the species of Dipsas in Panama (Ray 2017).

The most complete, recent taxonomic review of the genus was by Peters (1960), who principally used color pattern to recognize species. This has led to several remaining taxonomic issues. The availability of new material has resulted in species and groups of species within the genus being revised frequently in subsequent years (Cadle and Myers 2003; Passos et al. 2004, 2005; Cadle 2005; Harvey 2008; Harvey and Embert 2008; Sheehy 2012; Arteaga et al. 2018). Phylogenetic relationships among species of Dipsas and closely related genera remain unclear, since most phylogenetic studies published regarding snake systematics (Zaher et al. 2009; Vidal et al. 2010; Grazziotin et al. 2012; Pyron et al. 2013; Figueroa et al. 2016) have not sampled a sufficient set of species in these genera. However, all these studies corroborated paraphyly of the genus Dipsas with respect to Sibynomorphus (see Sheehy 2012). A recent study focused on the systematics of South American Dipsas and Sibon described several new species, and synonymized Sibynomorphus with Dipsas (Arteaga et al. 2018).

Between 1997 and 2015, one of us (JMR) regularly studied reptiles and amphibians in Parque Nacional General de División Omar Torrijos Herrera (PNGDOTH), near the community of El Copé de La Pintada, Coclé Province, Republic of Panama. In 1977, before the area was established as a national park, it was visited by the late Charles W. Myers, who suggested that at least one undescribed species of Dipsas occurred at the site (Myers et al. 2007). More recently, other researchers have agreed with that assessment (Ray et al. 2012). After examination of specimens collected in 2006–2009 and 2011 and after analysis of molecular data, including the updated phylogeny constructed for this paper, we confirm the existence of at least one new species of Dipsas at this site, which we herein describe. Additionally, we have confirmed the presence of this species at other sites. We also confirm that Dipsas temporalis, the species to which this snake was believed to belong, is still found in Panama; thus, we update the range of D. temporalis. Finally, we provide a key to the Central American species of the genus Dipsas.

Materials and methods

Ethics statement

This study was carried out in strict accordance with the guidelines for use of live amphibians and reptiles in field research (Beaupre et al. 2004) compiled by the American Society of Ichthyologists and Herpetologists (ASIH), the Herpetologists’ League (HL), and the Society for the Study of Amphibians and Reptiles (SSAR). All procedures with animals (see below) were reviewed by the Ministerio del Ambiente, Agua y Transición Ecológica (MAATE) in Ecuador and by UNARGEN-Ministerio de Ambiente in Panamá, and specifically approved as part of obtaining the following field permits for research and collection: MAE-DNB-CM-2018-0105 and MAATE-DBI-CM-2022-0245 (granted to Universidad San Francisco de Quito) and SC/A-8-09, SC/A-28-09, SC/A-37-11, SC/A-33-12, SE/A-60-16, and SE/A-33-18 (granted to Museo Herpetológico de Chiriquí). Specimens were euthanized with 20% benzocaine, fixed in 10% formalin or 90% ethanol, and stored in 70% ethanol. Museum vouchers were deposited at the Smithsonian National Museum (USNM), Museo Herpetológico de Chiriquí (MHCH), the Senckenberg Forschungsinstitut Frankfurt (SMF), and at Museo de Zoología de la Universidad San Francisco de Quito (ZSFQ).

Common names

Criteria for common name designation are as proposed by Caramaschi et al. (2006) and Coloma and Guayasamin (2011–2017), reviewed by Arteaga et al. (2019). These are as follows (in order of importance): (i) the etymological intention (implicit or explicit) that the authors used when naming the species (specific epithet); (ii) a common name that is already widely used in the scientific literature; (iii) a common name that has an important ancestral or cultural meaning; (iv) a common name based on any distinctive aspect of the species (distribution, morphology, behavior, etc.).

Material examined

We examined 31 specimens suspected to be a new species from 15 locations in Panama. Of these, we examined 23 specimens collected at Parque Nacional General de División Omar Torrijos Herrera (PNGDOTH), located 7.5 km north of the community of El Copé de La Pintada, Coclé Province, Republic of Panama (8.670383, -80.592343, 763 m a.s.l.) between 650 and 850 m. Specimens from eight other species of Dipsas also were examined for comparison purposes (Appendix 1).

We gathered additional data for the Central American species of Dipsas from Peters (1960), Savage (2002), Cadle and Myers (2003), Solórzano (2004), and Ray (2017). We follow Dowling (1951) for the method of counting ventrals and subcaudals and Savage (1973) for the terminology of scales in the loreal region of the head. We follow Peters (1960) and Harvey and Embert (2008) for terminology for cephalic shields. Sex was determined by probe or by subcaudal incision unless hemipenes were everted. Head and scale measurements were made to the nearest 0.1 mm using digital calipers held under a dissecting microscope. Snout-vent length and tail length measurements were taken to the nearest 1.0 mm using a squeeze box (Quinn and Parker 1976) or tape measure.

Terminology for measurements is abbreviated as: snout-vent length, SVL; tail length, TL; total length, TOL; head length, HL; jaw length, JL; and head width, HW. Eye length equals the horizontal distance across eye at widest point. Scale dimensions were measured at the longest or widest points along the longitudinal or perpendicular axis of the body, respectively. Drawings of the head were made using digital photography and a dissecting microscope by Shannon Christensen. Hemipenial preparation follows Zaher (1999) and Zaher and Prudente (2003). Once prepared, the hemipenes were stained with alizarin in 70% ethanol to facilitate the visualization of calcified structures (Harvey and Embert 2008; Nunes et al. 2012).

Molecular phylogenetics

A subset of molecular data is presented here for 19 species of Dipsas (Appendix 3), taken from the thesis of CMS (Sheehy 2012), which included 175 total taxa representing most other genera in the subfamily Dipsadinae. Five loci were used: (1) a 714 base pair fragment of the mitochondrial NADH dehydrogenase subunit 4 (ND4), (2) a 199 base pair fragment of tRNAs His, Ser and Leu, (3) a 1071 base pair fragment of the mitochondrial cytochrome-b gene (cyt-b), (4) a 525 base pair fragment of the nuclear protein-coding neurotrophin-3 (NT3) gene, and (5) a 732 base pair fragment of the nuclear protein-coding dynein, axonemal, heavy chain 3 (DNAH3) gene (see Appendix 2 for primers used). Genomic DNA was isolated from tissues using a Qiagen DNeasy kit (Qiagen, Valencia, California, USA). All amplification reactions used GoTaq Green Master Mix, 2X (Promega Corporation, Madison, Wisconsin, USA). Thermal cycling followed standard protocols and are detailed in Sheehy (2012). Successfully amplified PCR products were prepared for sequencing by using the ExoSAP-IT kit (United States Biochemical). A BigDye Terminator Cycle Sequencing Kit (Applied Biosystems Inc.) was used for sequencing following the manufacturer’s protocol and using PCR primers. The sequenced products were precipitated using an ethanol/sodium acetate method and rehydrated in HPLC purified formamide (HIDI). The sample was then analyzed on an ABI PRISM 3100xl Genetic Analyzer in the Genomics Core Facility at the University of Texas at Arlington, USA.

Alignments were constructed using the program Sequencher 4.8 (Gene Codes, Ann Arbor, Michigan, USA), and edited by eye using the program MacClade 4.08 (Maddison and Maddison 2005). The tRNAs were aligned using an annotated mitochondrial genome for Sibon nebulatus (GenBank accession number EU728583; Mulcahy and Macey 2009) as a template sequence.

Phylogenetic analyses were conducted using Maximum Likelihood (ML) and Bayesian Index (BI) on the data matrix consisting of 194 taxa and up to 3241 base pairs. Various models of molecular evolution were tested using the software package MEGA 5 (Tamura et al. 2011) on the complete alignment partitioned by gene fragment (seven partitions: ND4, cytb, tRNA His, tRNA Ser, tRNA Leu, NT3, and DNAH3). The model test results identified GTR+I+G and GTR+G as among the best-fit models of nucleotide substitution for each gene fragment based on corrected Akaike Information Criterion (AICc), although they did not always receive the best scores. The ML analyses employing the rapid bootstrapping algorithm were conducted using the program RAxML 7.3.0 (Stamatakis 2006) on the CIPRIS Science Gateway server v. 3.2 (Miller et al. 2010) using the model GTR+G instead of GTR+I+G because the 25 discrete rate categories appear to better estimate invariant sites (Stamatakis 2006). The multiple alignment was partitioned by gene region (five partitions: ND4, cytb, tRNAs, NT3, DNAH3), which allowed RAxML to calculate and apply the most appropriate gamma distribution parameter to each partition separately. Nodal support for ML was provided by rapid bootstrapping (1000 pseudoreplicates), with bootstrap values ≥ 0.70 considered strong support (Hillis and Bull 1993).

Bayesian analyses were conducted with the computer program MrBayes (Huelsenbeck and Ronquist 2001) on a partitioned alignment using the reversible-jump Markov chain Monte Carlo algorithm (mixed model), which avoids the risk of acquiring misleadingly high posterior probabilities at the nodes of hard or nearly hard polytomies due to their arbitrary resolution (Lewis et al. 2005). Each of the four protein coding genes in the alignment was partitioned by codon position with one partition including the first and second positions and another including the third position for a total of nine partition schemes (the three tRNAs were not partitioned).

Two independent runs were conducted simultaneously with four Markov chains (three heated and one cold) per run, and average standard deviation of the split frequencies below 0.01 was considered acceptable. Stationarity was determined to be reached visually using Tracer v. 1.5 (Rambaut and Drummond 2009). The analysis ran for 17,000,000 generations while sampling trees every 1000 generations. Stationarity was reached after approximately 11,500,000 generations, after which the standard deviation of the split frequencies dropped to 0.008. Therefore, we sampled the resulting 5000 trees from the last five million generations (12–17 million generations), which should be a good representation of the posterior distribution of trees. The initial 12 million generations were discarded as burn-in, and a 50% majority rule consensus tree with estimates of Bayesian support was constructed using the remaining sampled trees. Posterior probabilities (PP) provided nodal support for Bayesian analyses, with PP values ≥0.95 considered strong support (Alfaro et al. 2003; Huelsenbeck and Rannala 2004; Mulcahy et al. 2011).

Distribution maps and ecological niche models

We present ranges of occurrence for two species of Dipsas, D. temporalis and a new species herein described. Presence localities are derived from museum vouchers (Appendix 1), photographic records (iNaturalist), and the literature. For each species, a binary environmental niche model (ENM) accompanies the dot maps. These models estimate potential areas of distribution based on observed presences and a set of environmental predictors (Elith and Leathwick 2009). To delimit the occupancy areas and the potential species distribution, we used the BAM diagram proposal (Soberón and Peterson 2005; Peterson et al. 2011). To create the models, we used presence localities as described above, 19 bioclimatic variables from Worldclim 1.4 (Hijmans et al. 2005), and Maxent 3.4.1k, an algorithm based on the principle of maximum entropy (Phillips et al. 2006; Elith et al. 2011; Renner and Warton 2013).

For the first explorative exercise, we used the 19 climate layers from the WorldClim project and assessed which variables were the most important for the model, according to the Jackknife test calculated in MaxEnt (Royle et al. 2012). Correlated environmental variables (r < 0.8) were identified using the PEARSON correlation test of PAST 3. In a second modelling exercise, we used the locality records for each species and the variables identified in the first approach to generate the species distribution. 5,000 iterations were specified to the program with clamping and no extrapolation. All other parameters in MaxEnt were maintained at default settings. To create the binary environmental niche models, suitable areas were distinguished from unsuitable areas by setting a minimum training presence threshold value. The logistic format was used to obtain the values for habitat suitability (continuous probability from 0 to 1), which were subsequently converted to binary presence-absence values on the basis of the established threshold value, defined herein as the minimum training presence. The convergence threshold was set to 10-5, maximum iterations to 500, and the regularization parameter to “auto.”

Results

Systematics

The ML and Bayesian analyses were largely congruent, particularly with respect to the well-supported clades. The ML phylogeny of a well-supported clade containing most species of Dipsas sampled (except “D.” gaigeae; see Sheehy 2012) is here presented, with Bayesian posterior-probabilities superimposed on well-supported nodes (Fig. 1). The specimens from PNGDOTH formed a clearly divergent, strongly supported lineage separate from the other Central American species and is sister to Dipsas temporalis, to which it differs by ~ 7% (uncorrected pairwise-distance) for the ND4 locus. Based on this genetic distinctiveness, along with discontinuous morphological variation in scalation and unique hemipenes morphology (see below), we determine that it does, indeed, represent a new species as previously hypothesized.

Figure 1. 

Phylogeny of 20 species of Dipsas using the best ML tree. Black circles denote strong nodal support (≥ 0.95 PP and ≥ 0.70 ML bootstrap). See Sheehy (2012) for further details on the outgroup taxa.

Figure 2. 

Live individual of Dipsas aparatiritos sp. nov. in Parque Nacional General de División Omar Torrijos Herrera photographed in the wild and not collected. Photography by Kevin Enge.

Dipsas aparatiritos sp. nov.

https://zoobank.org/E96CAB59-FBB7-451B-9D11-4372182F9809
Figs 2, 3, 4, 5, 6, 7, 8, Appendix 3 Proposed standard English name: Hidden Snail-eating Snake Proposed standard Spanish name: Caracolera Escondida

Type material

Holotype. Panama • ♀; PNGDOTH, ca. 7.5 km N of El Copé de La Pintada, Coclé Province, 8.670383°N, 80.592343°W, 763 m a.s.l.; 30 Jul 2010; S. Gotte, J. Jacobs, D. Mulcahy and R. Reynolds; USNM 579828 (Biol. Survey Field Series 4608) (Figs 3, 4).

Figure 3. 

Holotype (USNM 579828) of Dipsas aparatiritos sp. nov. showing a dorsum and b venter. Ruler units in cm. Photographs by James Poindexter.

Figure 4. 

Holotype (USNM 579828) of Dipsas aparatiritos sp. nov. showing a dorsum of head and b chin shields and c lateral view. Ruler notches denote mm. Photographs by James Poindexter.

Paratype. Panama • ♀; PNGDOTH, ca. 7.5 km N of El Copé de La Pintada, Coclé Province, 8.670383°N, 80.592343°W, 763 m a.s.l.; 30 Jul 2010; S. Gotte, J. Jacobs, D. Mulcahy and R. Reynolds; USNM 579829 (Biol Survey Field Series 4609) (Figs 5, 6).

Figure 5. 

Paratype (USNM 579829) of Dipsas aparatiritos sp. nov. showing a dorsum and b venter. Ruler units in cm. Photographs by James Poindexter.

Figure 6. 

Paratype (USNM 579829) of Dipsas aparatiritos sp. nov. showing a dorsum of head and b chin shields and c lateral view. Ruler notches denote mm. Photographs by James Poindexter.

Diagnosis

Dipsas aparatiritos sp. nov. is placed in the genus Dipsas based on phylogenetic evidence (Fig. 1) and the absence of a labial that is noticeably higher than other labials. The species is diagnosed based on the following combination of characters: (1) 15/15/15 smooth dorsals with enlarged vertebral row (1.5–2.4× as wide as adjacent rows); (2) loreal and a preocular in contact with orbit; (3) 7 supralabials with 4th and 5th contacting orbit, 1st supralabial fused with nasal scale; (4) 8–9 infralabials with 3rd to 6th in contact with chin shields, first pair of infralabials not in contact behind symphysial due to presence of two postmentals; (5) 191–196 ventrals in males, 177–197 in females; (6) 122–136 divided subcaudals in males, 111–126 in females; (7) dorsal and ventral color consisting of 17–20 dark brown to black white-bordered body bands (10–12 dorsal scales long anteriorly to 3–5 dorsal scales long posteriorly) separated from each other by white to pale yellow (anteriorly) to pale brown (posteriorly) interspaces measuring 2–6 dorsal scales long, ventral surfaces white with encroachment from the dorsal dark blotches and with smaller blackish marks in-between the blotches, dorsal aspect of head dark reddish brown with small blotches on the labial and temporal scales as well as a pale nuchal collar, throat white with small dark brown to blackish markings, iris pale brown with minute black speckles; (8) 310–465 mm SVL in males, 169–424 mm females; (9) 122–260 mm TL in males, 65–247 mm in females.

Description of the holotype

An adult female; SVL 424 mm; TL 211 mm (49.7% SVL); head broadly distinct from body; head length 13.2 mm (3.10% SVL); head width 7.3 mm (55% head length); snout-orbit distance 3.3 mm; eye diameter 2.5 mm; rostral broader than high, triangular in frontal view, not visible from above; internasals broader than long; prefrontals broader than long and do not enter the orbit; from above, the triangular shape of the top of the preocular is visible; supraocular longer than broad; frontal longer than broad, with a triangular shape in dorsal view; parietals longer than broad; nasal entire and fused with the first supralabial on both sides; loreal longer than high, enters the orbit; one upper preocular; two postoculars; temporals 2+3 left side, 2+2 right side, where the upper primary and secondary scales are fused; 7 supralabials, 4 and 5 contacting orbit (first supralabial is fused with the nasal) symphysial contacting the first pair of chin shields; 9 infralabials; four pairs of irregular chin shields, the first pair is smaller, second pair is longer than broad, the third pair is slightly longer than broad, but its scales are not in contact, the last pair is broader than long. Dorsals smooth in 15-15-15 rows; mid-vertebral scales moderately enlarged; 178 ventral scales; 118 paired subcaudals; cloacal scale single.

In preservative, dorsal ground color of head uniformly brown except for some small dark-brown blotches on the occipital areas; laterals with small pale brown and dark blotches; white supralabials with evident pale brown and dark blotches; ground color of infralabial and gular region cream colored with dark-brown blotches and pale-brown spots; dorsal color of body pale brown with dark-brown blotches and pale interspaces; on the anterior portion of the body the blotches are dark-brown and long (between 10 and 13 scales) contacting the opposite one in the vertebral row, the interspaces are pale brown with small and scarce dark-brown spots on the dorsal, and white on the lateral; on the middle of the body, the dark-brown blotches diminish their length (between 8 and 9 scales), and they lose the dorsal continuation between them in the vertebral row, the interspaces get a pale-brown color with some small dark-brown spots; on the posterior portion, the blotches are shorter (5–7 scales), rounded, and they are margined by a white edge with many small dark-brown spots; ground color of the belly cream-colored, with irregular blotches of different sizes along the ventral line of the interspaces; tail resembles the body in color pattern; body with 16 blotches, and tail with 12. Color in preservative (70% ethanol) similar to color in life.

Description of the paratype

An adult female; SVL 328 mm; TL 170 mm (51.8% SVL); head broadly distinct from body; head length 12.2 (3.7% SVL); head width 6.6mm (54% head length); snout-orbit distance 2.9 mm; eye diameter 2.3 mm; rostral broader than high, triangular in frontal view, not visible from above; internasals, broader than long; prefrontals long as wide, no enter the orbit; from above, the triangular shape of the top of the preocular is visible; supraocular longer than broad; frontal longer than broad, with a triangular shape in dorsal view; parietals longer than broad; nasal entire; loreal longer than high, enters the orbit; one upper preocular; two postoculars; temporals 2+3 left side, 3+4 right side; 8 supralabials, 4 and 5 contacting orbit; symphysial contacting the first pair of chin shields; 9 infralabials; three pairs of irregular chin shields, the first pair is the smaller, second pair is longer than broad; the third pair is slightly broader than long. Dorsals smooth in 15-15-15; vertebral scale moderately enlarged; 183 ventral scales; 124 paired subcaudals; cloacal scale single. In preservative, dorsal ground color of head uniformly brown except for some small dark-brown blotches on the occipital areas; laterals with small blotches pale brown and dark; white supralabials with evident pale brown and dark blotches; ground color of infralabial and gular region cream with dark-brown blotches and pale-brown spots; dorsal color of body pale-brown with dark-brown blotches and pale interspaces; on the anterior and middle portion of the body the blotches are dark-brown and long (12–14 scales) contacting the opposite one in the vertebral row, the interspaces are pale brown with small and scarce dark-brown spots on the dorsal, and white on the lateral; on the posterior portion, the blotches are shorter (between 5 and 7 scales), rounded, they are margined by a white edge with many dark-brown small spots, and they lose the dorsal continuation between them in the vertebral row, the interspaces get a pale-brown color with some small dark-brown spots; ground color of the belly cream, with irregular blotches of different sizes along the ventral line of the interspaces; tail resembles the body; body with 19 blotches, and tail with 15. Color in preservative (70% ethanol) similar to color in life.

Referred specimens

MHCH 2311, juvenile male collected by Sebastian Lotzkat and Andreas Hertz on 18 August 2010 at Cerro Mariposa, Veraguas province, Panama (8.51166°N, 81.12163°W; 940 m), SMF 89551–53, adult males collected by Leonhard Stadler and Nadim Hamad between 8 May and 7 July 2008 at the type locality. SMF 90036, adult male collected by Arcadio Carrizo on 28 July 2008 at Cerro Negro, Veraguas province, Panama (8.56901°N, 81.09894°W; 700 m). SMF 97346, adult male collected by Abel Batista on 25 January 2013 at Donoso, Coclé province, Panama. SMF 89953–54, juvenile and adult of undetermined sex, respectively, collected by Leonhard Stadler and Nadim Hamad on 8 May 2008 at the type locality. SMF 89769, juvenile of undetermined sex collected by Sebastian Lotzkat and Andreas Hertz on 3 April 2009 at Cerro Negro, Veraguas province, Panama (8.56901°N, 81.09894°W; 700 m). MHCH 3123, adult female collected by Marcos Ponce and Roger Morales on 30 May 2018 at Cerro Campana, Panama province, Panama (8.69378°N, 79.92098°W; 730 m).

Additionally, a series of individuals was collected from Parque Nacional General de División Omar Torrijos Herrera between 2006 and 2009 that included 15 females and 12 males. There was variation between sexes and among individuals (Tables 1–3). A summary of the most commonly measured characteristics includes the range of 173–192 ventrals in females (n = 11) and 187–191 in males (n = 12), subcaudals 116–131 in females (n = 13) and 129–136 in males (n = 8). All individuals had either 7 or 8 supralabials on both sides (n = 26) except one female USNM 579810 with only 6 on the left. Individuals (n = 25) had 8 or 9 left infralabials with two individuals having 10. However, the right infralabials ranged from 7–9 with the same individual as above (USNM 579810) having 6 (Fig. 7).

Table 1.
Download as
CSV
XLSX

Measurements of body and head of Dipsas aparatiritos to nearest mm. * = Holotype, ** = Paratype.

Catalogue number Sex Svl (mm) Tail length (mm) Vertebral scale width (mm) Dorsal scale width (mm) Eye length (mm) Rostral to eye length (mm) Head width (mm) Head length (mm)
USNM 579820 F 169 65 1.11 0.82 1.98 2.19 4.27 8.90
USNM 579822 F 197 95 1.17 0.78 2.10 1.93 4.29 8.83
USNM 579827 F 205 1.35 0.99 2.19 1.93 4.52 8.80
USNM 579826 F 242 124 1.13 1.04 2.18 2.43 4.86 9.75
USNM 579813 F 265 133 1.17 1.25 2.38 2.25 4.75 9.78
USNM 579825 F 312 175 1.53 1.51 2.51 2.69 4.91 11.85
USNM 579808 F 319 162 1.34 1.46 2.34 2.71 5.00 11.18
USNM 579829** F 328 170 2.19 1.75 2.34 2.96 6.61 12.28
USNM 579824 F 333 179 1.86 1.70 2.38 2.51 5.09 11.49
USNM 579807 F 346 165 1.64 1.82 2.26 2.99 5.63 12.68
USNM 579823 F 357 189 1.94 1.82 2.54 2.81 5.73 11.98
USNM 579810 F 395 219 2.19 1.65 2.60 2.97 5.97 13.80
USNM 579814 F 400 221 2.06 2.03 2.40 3.54 5.81 13.32
USNM 579809 F 420 221 1.73 2.40 2.58 3.11 6.29 14.00
USNM 579828* F 424 211 2.70 2.22 2.56 3.31 7.35 13.26
USNM 579816 M 310 122 1.12 1.33 2.47 2.39 5.16 10.57
USNM 579815 M 415 244 1.72 1.83 2.64 3.14 5.91 12.75
USNM 579812 M 420 236 1.63 1.77 2.88 3.00 5.81 12.94
USNM 579819 M 450 251 1.83 2.15 2.83 3.44 5.86 12.06
USNM 579811 M 465 260 1.90 1.69 3.05 3.30 6.05 13.77
USNM 579817 M 465 241 2.18 2.11 2.70 3.27 5.91 13.17
Table 2.
Download as
CSV
XLSX

Scale counts for dorsals, ventrals, labials and loreals, along with dorsal blotch counts for a series of 31 Dipsas aparatiritos sp. nov. collected from Parque Nacional General de Division Omar Torrijos Herrera. Also included are available data for specimens collected at other sites. s = single; w = wide loreal; co = contacting the orbit; irr l = irregular loreal. *holotype and **paratype

Catalogue number Sex Dorsal scale rows Ventrals Sub-caudals Anal plate Right supralabials Left supralabials Right infralabials Infralabials contact behind mental Left infra-labials Right loreal Left loreal Dorsal blotches
SMF 89554 – 15-15-15 116 s 7(4–6) 8
SMF 89769 Juv 15-15-15 181 181 s 7(4–5) 9
SMF 89953 Juv 15-15-15 175 110 s 7(4–5) 8
MHCH 3123 F 15-15-15 194 126 s 7(4–5) 9(2–5)
USNM 579820 F 15-15-15 s 7–4.5 9–5.6 9 0 8 w co w co 20
USNM 579822 F 15-15-15 131 s 7–4.5 7–4.5 9 0 9 w co w co 17
USNM 579827 F 15-15-15 s 7–4.5 7–4.5 9 0 9 w co w co 18
USNM 579826 F 15-15-15 197 129 s 7–4.5 7–4.5 9 0 9 w co w co 18
USNM 579813 F 15-15-15 188 125 s 7–4.5 7–4.5 8 0 8 w co w co 20
USNM 579825 F 15-15-15 177 119 s 7–4.5 7–4.5 9 0 9 w co w co 19
USNM 579808 F 15-15-15 184 118 s 7–4.5 7–4.5 8 0 8 w co w co 18
USNM 579829** F 15-15-15 183 124 s 8–4.5 8–4.5 9 0 9 w co w co 19
USNM 579824 F 15-15-15 121 s 7–4.5.6 7–4.5.8 8 0 8 w co w co 19
USNM 579807 F 15-15-15 178 111 s 7–4.5 7–4.5 9 0 9 w co w co 18
USNM 579823 F 15-15-15 185 122 s 7–4.5 7–4.5 9 0 8 w co w co 19
USNM 579810 F 15-15-15 182 116 s 7–4.5 6–4.5 8 0 8 w co w co
USNM 579814 F 15-15-15 182 124 s 7–4.5 7–4.5 9 0 9 w co w co 17
USNM 579809 F 15-15-15 180 118 s 7–4.5 7–4.5 9 0 9 w co w co 18
USNM 579828* F 15-15-15 178 118 s 7–4.5 7–4.5 9 0 9 w co w co 16
USNM 579816 M 15-15-15 192 s 7–4.5 7–4.5 9 0 w co w co 17
USNM 579815 M 15-15-15 196 135 s 7–4.5 8–5.6 9 0 9 w co w co 17
USNM 579812 M 15-15-15 195 131 s 7–4.5 7–4.5 10 0 9 w co w co 19
USNM 579819 M 15-15-15 194 136 s 7–4.5 7–4.5 8 0 8 irr l irr l co 19
USNM 579811 M 15-15-15 195 129 s 7–4.5 7–4.5 9 0 9 w co w co 18
USNM 579817 M 15-15-15 191 s 8–4.5 7–4.5 9 0 9 w co w co 19
MHCH 2311 M 15-15-15 194 130 s 7(4–5) 9(3–6)
SMF 89551 M 15-15-15 191 130 s 7(4–5) 9
SMF 89552 M 15-15-15 192 122 s 7(4–5) 9/8
SMF 89553 M 15-15-15 190 130 s 7(4–5) 9
SMF 90036 M 15-15-15 192 122 s 7(4–5) 9/8
SMF 97346 M 15-15-15 192 s – 9
Table 3.
Download as
CSV
XLSX

Scale counts related to the ocular region of the series of 31 Dipsas aparatiritos sp. nov. specimens. upp = upper; low = lower. * = holotype, ** = paratype.

Catalogue number Sex Right preocular Left Preocular Right presubocular Left presubocular Right postocular Left postocular Right post-subocular Left post-subocular
SMF 89554 – 2
SMF 89769 Juv 3
SMF 89953 Juv 2
MHCH 3123 F 2
USNM 579820 F 1 upp 1 upp 0 0 3 3 0 0
USNM 579822 F 1 upp 1 upp 0 0 2 2 0 0
USNM 579827 F 1 upp 1 upp 0 0 2 2 0 0
USNM 579826 F 1 upp 1 upp 0 0 3 3 0 0
USNM 579813 F 1 upp 1 upp 0 0 2 2 0 0
USNM 579825 F 1 upp 1 upp 0 0 3 3 0 0
USNM 579808 F 1 upp 1 upp 0 0 2 2 0 0
USNM 579829** F 1 upp 1 upp 0 0 2 2 0 0
USNM 579824 F 1 upp 1 upp 0 0 1 upp/ 1 low 1 upp/ 1 low 0 0
USNM 579807 F 0 0 0 0 2 2 0 0
USNM 579823 F 1 upp 1 upp 0 0 2 2 0 0
USNM 579810 F 1 upp 1 upp 0 0 2 2 0 0
USNM 579814 F 1 upp 1 upp 0 0 2 2 0 0
USNM 579809 F 1 upp 1 upp 0 0 2 1 upp/ 1 low 0 0
USNM 579828* F 1 upp 1 upp 0 0 2 2 0 0
USNM 579816 M 1 upp 1 upp 0 0 3 3 0 0
USNM 579815 M 1 upp/ 1 low 1 upp/ 1 low 0 0 3 3 0 0
USNM 579812 M 1 upp 1 upp 0 0 2 2 0 0
USNM 579819 M 2 1 upp/ 1 low 0 0 3 2 0 0
USNM 579811 M 1 upp 1 upp 0 0 2 2 0 0
USNM 579817 M 1 upp 1 upp 0 0 2 1 upp/ 1 low 0 0
MHCH 2311 M 4
SMF 89551 M 2
SMF 89552 M 3
SMF 89553 M 3
SMF 90036 M 3
SMF 97346 M 3
Figure 7. 

Illustration of the head scales of a Dipsas aparatiritos sp. nov. (USNM 579810). Drawings by Shannon Bowley Christensen.

Hemipenial morphology

Description based on the hemipenes fully everted, but not completely expanded, for the specimen USNM 579815 (Fig. 8). Distal end of retractor muscle divided, hemipenis unilobed, unicapitate and unicalyculate; capitulum with papillate and spinulate calyces, it covers approximately the distal half of the organ in the sulcate face, and the distal one-third in the asulcate; the inferior capitular edge of the sulcate face is V-shape, and in the asulcate face the capitular arch is present. In both faces, the hemipenial body is covered by a few small spines, and mostly by medium-sized spines which have curved and robust tips. The base of the organ also is covered by dispersed little spinules on both faces; there is not an evident nude pocket, and there are two spines of similar size on the asulcate side. The sulcus spermaticus bifurcates at the base of the capitulum; both branches diverge and extend diagonally oriented, and end at the distal edge of the lateral face of the organ.

Figure 8. 

Hemipenes of Dipsas aparatiritos sp. nov. USNM 579815 a sulcate face b, d lateral faces c asulcate face. Photographs by James Poindexter.

Comparisons

Dipsas aparatiritos sp. nov. can be distinguished from all other similar or related species by the following combination of characters: 15 dorsal scale rows; one upper preoculars; two or three postoculars; temporals 1+2; seven or eight supralabials, fourth and fifth contacting the orbit; eight or nine infralabials, no infralabials in contact behind mental; vertebral row moderately enlarged; 191–196 ventrals in males, and 177–197 in females; 129–136 subcaudals in males, and 111–131 in females; by the alternating dark brown and tan brown bands running the length of the body, including the tail.

Dipsas aparatiritos sp. nov. differs from the majority of its congeners by having the nasal scale fused with the first supralabial, anterior infralabials separated by a pair of (rarely fused) small postmentals, and temporals usually entering the orbit. Dipsas aparatiritos sp. nov. shares with the other Central American species of the genus the number of dorsal scales rows (15-15-15), except with D. gaigeae Oliver (13-13-13); number of temporals (1+2+ 2); absence of preoculars, except D. brevifacies Cope (1, 2 or 3); and number of postoculars (2,3), except D. temporalis Werner (3,4). The number of infralabials (9–10) is in the range of all Panamanian species, but the infralabial scales in contact behind mental (0) differs from all species, except with D. temporalis. The number of supralabials (7–8) is within the variation found in D. gaigeae (7–8), D. nicholsi (7–9), D. temporalis (6–8), and D. tenuissima Taylor (8), but differs from D. articulata Cope, D. bicolor Günther, D. brevifacies, and D. viguieri Bocourt (9–10); the supralabials scales in contact with the eye (4–5) also are in the variation found in the other species (Table 4). The vertebral row is enlarged moderately as in D. nicholsi and D. temporalis, and it different from the other species where it is scarcely enlarged. The number of ventral scales of males and females of Dipsas aparatiritos sp. nov.is larger than D. brevifacies and D. gaigeae and fewer than D. articulata, D. tenuissima and the males of D. temporalis, while overlapping with D. bicolor, D. nicholsi, D. viguieri, and the females of D. temporalis (Table 2). The number of subcaudal scales of males and females is larger than D. brevifacies, D. gaigeae, D. nicholsi, and D. tenuissima, while overlapping with D. articulata, D. bicolor, D. temporalis, and D. viguieri (Table 4).

Table 4.
Download as
CSV
XLSX

Scale counts, measurements and degree of enlargement of the vertebral row of the species of Dipsas known to occur in Central America, combining data from the examined specimens listed in Appendix 1 and from references listed in Materials and methods. The values of the ventral and subcaudal counts are minimum and maximum.

D. articulata D. bicolor D. brevifacies D. gaigeae D. nicholsi D. aparatiritos D. temporalis D. tenuissima D. viguieri
Dorsals 15-15-15 15-15-15 15-15-15 13-13-13 15-15-15 15-15-15 15-15-15 15-15-15 15-15-15
Ventrals M 198–217 F 195–210 M 195–199 F 185–199 M 167–181 F 166-174 M 162–166 F 163–167 M 192–210 F186–201 M 190–196F 177–197 M 197–208 F 184–192 M 225 F 227 M 196–211 F 190–206
Subcaudals M 115–135 F 108–118 M 129–132 F 111–129 M 71–102 F 69–87 M 64–72 F 53–62 M 81–100 F 84–97 M 122–136F 111–131 M 120–132 F 120–123 M 99 Fno data M 113–129 F 102–126
Preoculars 0 0 1, 2, 3 0 0 0 0 0 0
Postoculars 2–3 2–3 3 2 2 2–3 3–4 3 2–3
Supralabials 9–10 10 9–10 7–8 7–9 7–8 6–8 8 9–10
Supralabials contacting eye [4,5] [5,6] [4,5,6,7] [4,5] [3,4] [3,4] [4,5] [4,5] [3,4] [4,5] [4,5] [4,5] [5,6]
Infralabials 10–13 10–12 9–13 7–9 10–13 9–10 8–13 9–10 9–12
Infralabials in contact [1,1] [1,1] [2,2] [1,1] [1,1] [2,2] 0 0 [1,1] [1,1]
Temporals 2+3+4 1+2+3 2+3+4 2+3+4 2+3+4 2+3+4 2+3+3 2+3+4
TOL of largest specimen (mm) M 715 F 655 M no data F 627 M 596 F 536 M 652 F726 M 861 F 798 M 725 F 713 M 697 F 645 M 554 F 572 M 719 F 547
Vertebral row Scarcely enlarged Scarcely enlarged Scarcely enlarged Not enlarged Moderately to broadlyenlarged Moderately enlarged Moderately to broadlyenlarged Scarcely enlarged Scarcely enlarged
TL / TOL M 32% F 31% M 33% F% M 30% F 26% M 23% F 28% M 25% F 24% M 35% F 34% M 38% F 33% M 29%F no data M 33%F 30%

The new species is sister to Dipsas temporalis, from which it differs on the following characters of coloration and lepidosis. In D. aparatiritos sp. nov., the first dorsal band extends far onto the ventrals (restricted to the dorsum or barely entering ventrals in D. temporalis) and the posterior body bands form elliptical blotches usually broken along the vertebral line (bands complete over dorsum or elliptical blotches joined along the vertebral line in D. temporalis). The color of the anterior interspaces is white or bright pale yellow in D. aparatiritos sp. nov. and pale brown in D. temporalis. Overall, D. temporalis compared to D. aparatiritos sp. nov. have a greater number of ventral scales in males (x̄ = 198) vs. (x̄ = 192) and females (x̄ = 192) vs. (x̄ = 184) respectively, although there is overlap in the counts (Table 5, Fig. 10).

Table 5.
Download as
CSV
XLSX

Differences in coloration, scale counts and size between Dipsas temporalis and D. aparatiritos sp. nov. The range of each continuous variable is from our own sample, Harvey (2008), and Lotzkat (2015). The numbers in parentheses represent the sample size.

Variable Dipsas temporalis Dipsas aparatiritos sp. nov.
First dorsal band extends far onto the ventrals No Yes
Condition of posterior body bands Complete over dorsum or elliptical blotches joined along the vertebral line Forming elliptical blotches usually broken along the vertebral line
Color of anterior interspaces Pale brown White or bright pale yellow
Infralabials 8–9 9–10
Sex Males
(n = 5)		 Females
(n = 8)		 Males
(n = 12)		 Females
(n = 16)
Maximum TOL 694 mm 630 mm 688 mm 713 mm
Ventral scales 183–210 184–203 177–197 190–196
Subcaudal scales 112–132 111–134 122–136 111–131

Etymology

The species name is an adjective formed from the Greek word aparatíritos (απαρατήρητος), which means unnoticed. The snake has hidden in plain sight for more than forty years at a very well-studied field site for herpetological research. We suggest the common name “Hidden Snail-eater” (“Caracolera Escondida” in Spanish).

Distribution

Dipsas aparatiritos sp. nov. is found in both the Atlantic and Pacific slopes of the Cordillera Central in western Panama, with an additional population on the Parque Nacional Chagres. The species occurs over an estimated 9,630 km2 area and has been recorded at elevations 597–1002 m above sea level, which makes it the most wide-spread species of Dipsas in Panama. A series of individuals were collected from PNGDOTH. This is a mid-elevation, premontane cloud-forest with mature secondary forest and many streams branching from Río Guabal (McCaffery and Lips 2013). The mean annual rainfall is 3500 mm and mean annual temperature range is 19–31 °C (Lips et al. 2006). Two localities (Donoso, Colón province, and Quebrada Las Tres Honeras, Panama province) are in valleys 134–197 m above sea level. Since these localities are much lower in elevation than all other reported localities, it is likely that the specimens collected there (SMF 97346 and MCZ 50214) were actually found in the neighboring mountain ridges (Fig. 9).

Figure 9. 

Map of locality data for Dipsas aparatiritos sp. nov. (red showing range, circles marking specimens included in this paper) and updated range data for D. temporalis (yellow showing range, triangles marking specimens included in this paper).

Figure 10. 

Photographs of species of Dipsas previously subsumed under D. temporalis a D. aparatiritos sp. nov. from Cerro Gaital, Antón, Coclé province, Panama b D. temporalis ZSFQ 5063 from Durango, Esmeraldas province, Ecuador c D. temporalis ZSFQ 5062 from Durango, Esmeraldas province, Ecuador.

Natural history notes

The holotype was encountered at 21:58 h in mature secondary (40+ years) premontane forest on the Atlantic versant, but only ca. 100 m from the Continental Divide. The trail is known as “the old logging road” as described by Myers et al. (2007). The Tropical Amphibian Declines in Streams (TADS) project, which has been working in the area since 1997, refers to the trail as “Rocky Road,” while the park calls it “La Salida” to Sendero La Rana. The snake was elongate and crawling on small tree 0.75 m off the ground. The paratype was encountered at 2159h in mature secondary (40+ years) premontane forest on the Atlantic versant, but only ca. 100 m from the Continental Divide on the same trail as the holotype. The snake was elongate and crawling on small tree 0.75 m off the ground. Lotzkat (2015) found specimens of Dipsas aparatiritos sp. nov. foraging at night on vegetation 30–200 cm above the ground. JMR found this species to be more common in forest and along streams rather than around ponds. In PNGDOTH, JMR examined the fecal samples of this species and found that one (2% of the sample) contained the operculum of a snail and 49 (98%) contained oligochaete chaetae.

Despite being a new species, it is relatively common at the PNGDOTH site and has been documented for years, thus providing much data on the natural history. Specimens have been found in vegetation, at times over one meter in height, but at other times just centimeters off the ground where it blended in well with leaf litter, as proven by one individual found on the ground (Fig. 2). Gravid females were found in all months except February, March, October, and December with the highest frequency in June and July (JMR pers. obs.). Females had either one or two ova. Breeding events were not observed, although one night four different Dipsas aparatiritos sp. nov. were observed intertwined on a single branch (Fig. 11).

Figure 11. 

Four individuals of Dipsas aparatiritos sp. nov. intertwined on one plant at Parque Nacional General de División Omar Torrijos Herrera. Photograph by Noah Carl.

Near the area where the holotype of Dipsas aparatiritos sp. nov. was found in PNGDOTH, JMR has recorded the following species of amphibians and reptiles: salamanders including Oedipina collaris (Stejneger, 1907), and Bolitoglossa colonnea (Dunn, 1924), frogs, including Diasporus diastema (Cope, 1875), Espadarana prosoblepon (Boettger, 1892), lizards including Anolis humilis Peters, 1863, and Enyalioides heterolepis (Bocourt, 1874), and snakes including Bothrops asper (Garman, 1883), Bothriechis schlegelii (Berthold, 1846), D. nicholsi, Imantodes cenchoa (Linnaeus, 1758), Oxybelis brevirostris (Cope, 1861), Sibon annulatus, and S. nebulatus (Linnaeus, 1758).

Conservation

We consider Dipsas aparatiritos sp. nov. to be included in the Near Threatened category following the IUCN Red List categories and criteria, v. 3.1, second edition (IUCN 2012) because, although the species’ estimated extent of occurrence is less than 10,000 km2 and nearly 44% of this area has already been deforested (CATHALAC 2011), the species occurs in at least four major national parks (Santa Fe, PNGDOTH, Altos de Campana, and Chagres) and satellite images show that there is forest connectivity between populations. At PNGDOTH, the occurrence rate of D. aparatiritos sp. nov. has actually increased by a factor of three in the period between 2006 and 2012 (Zipkin et al. 2020). Also, the body condition of the individuals in this locality increased following the collapse of amphibian populations due to chytridiomycosis (Zipkin et al. 2020). However, the causes for these changes are enigmatic given that amphibians presumably do not comprise an important part of the diet of this species. The status and trend of other populations should be evaluated carefully given that D. aparatiritos sp. nov. is endemic to Panama and probably highly dependent on old-growth forests.

Other Dipsas species at the site

In addition to the new species there are two other species of Dipsas known from the site: Dipsas nicholsi (Myers et al. 2007 [see edit to proof]) and Dipsas articulata (Vecchiet et al. 2014). This adds one more confirmed species, bringing the total to three. Furthermore, also known to occur at the site are at least four species of Sibon (S. argus, S. canopy, S. longifrenis, and S. nebulatus), which are closely related phylogenetically (Peters 1960; Sheehy 2012) and ecologically (Ray et al. 2011). Sibon lamari also may be present at the site (JMR unpubl. data). Dipsas aparatiritos sp. nov. was found throughout the general survey area, both on metered-transects and within the adjacent forest between transects.

Key to Central American Dipsas

1 Dorsals 13-13-13, loreal longer than high contacting the orbit; preoculars absent; seven supralabials, third and fourth contacting the orbit; 7 or 8 infralabials, one pair in contact behind the mental; vertebral scale not enlarged; ventrals M 162–166, F 163–167; subcaudals M 64–72, F 53–62 Dipsas gaigeae
– Dorsals 15-15-15 2
2 Ventrals > 220; square loreal contacting the orbit; one preocular; eight supralabials, fourth and fifth contacting the orbit; 9 or 10 infralabials, one pair in contact behind the mental; vertebral scale slightly enlarged; ventrals M 225, F 227; subcaudals M 99 Dipsas tenuissima
– Ventrals < 220 3
3 Black horseshoe pattern present on the dorsum of head; irregular or square-shaped loreal contacting the orbit; preoculars absent; 8 or 9 supralabials, fourth and fifth contacting the orbit; 12 infralabials, one pair in contact behind the mental; vertebral scale slightly enlarged; ventrals M192–210, F 186–201; subcaudals M 81–100, F 84–97; beige with dark brown saddles Dipsas nicholsi
– Lack of black horseshoe pattern on the dorsum of head; typically, dark brown alternating with paler brown or tan; white outline may be present 4
4 Alternating brown with pale beige or white with rose/pink/red on white spots of dorsum 5
– Lacking rose/pink/red on white spots of dorsum 6
5 Single chin shields; irregular or square shape loreal contacting the orbit; one preocular; 10 supralabials, fourth, fifth, and sixth contacting the orbit; 11 or 12 infralabials, one pair in contact behind the mental; vertebral scale not enlarged; ventrals M 195–199, F 185–199; subcaudals M 129–132, F 111–129 Dipsas bicolor
– Paired chin shields; loreal longer than high or square loreal contacting the orbit; preoculars absent; eight supralabials, fourth and fifth contacting the orbit; 10 or 11 infralabials, one pair in contact behind the mental; vertebral scale slightly enlarged; ventrals M 198–217, F 195–210; subcaudals M 115–135, F 108–118 Dipsas articulata
6 Supralabials 6–8 7
– Supralabials 9 8
7 Loreal longer than high contacting the orbit; one preocular; seven or six supralabials, fourth and fifth or third and fourth contacting the orbit; 8–10 infralabials, none in contact behind the mental; vertebral scales slightly enlarged; ventrals M 197–208, F 184–200; subcaudals M 120–132, F 120–123 Dipsas temporalis
– Loreal longer than high contacting the orbit; one preocular; 7 or 8 supralabials, fourth and fifth contacting the orbit; 9 or 10 infralabials, none in contact behind the mental; vertebral scales moderately enlarged; ventrals M 191–196, F 177–197; subcaudals M 129–136, F 111–131, Head pale brown Dipsas aparatiritos
8 Irregular or square shape loreal contacting the orbit; preoculars absent; 9 supralabials, fourth and fifth or sixth contacting the orbit; 9–11 infralabials, one pair in contact behind the mental; vertebral scales slightly enlarged; ventrals M 196–211, F 190–206; subcaudals M 113–129, F 102–126; Head reddish-brown Dipsas viguieri
– Loreal longer than high contacting the orbit; preoculars one; nine supralabials, fourth and fifth contacting the orbit; 10–12 infralabials, two pairs in contact behind the mental; vertebral scale slight enlarged; ventrals M 167–181, F 166–174; subcaudals M 71–102, F 69–87 Dipsas brevifacies

Discussion

In the past decade, a significant number of species have been added to the fauna of Panama, either as range extensions across political borders or as newly described species to science. The former includes Ninia sebae (Duméril, Bibron, & Duméril, 1854) and Porthidium volcanicum Solórzano, 1995 in the western part of the country, and Leptophis cupreus (Cope, 1868) (Batista and Wilson 2017) and Micrurus dumerilii Jan, 1858 (Prairie et al. 2015) in the east. The latter includes dipsadine species such as Sibon perissostichon (Köhler et al. 2010) and S. noalamina (Lotzkat et al. 2012), along with the colubrine Tantilla berguidoi (Batista et al. 2016). Additionally, the number of the very rare Geophis bellus Myers, 2003 (Dipsadinae) specimens has increased significantly (Lara et al. 2015 and an additional, complete specimen of Atractus imperfectus Myers, 2003 (Dipsadinae) was found (Ray 2017). According to our assessment, the range of Dipsas temporalis in Panama has been reduced to the eastern portion of the Darien. However, this species is still currently found in Panama.

Interestingly, Dipsas aparatiritos sp. nov. has been known at the PNGDOTH site since the late 1970s when Charles Myers visited and mentioned the potential presence of at least one new species of Dipsas. Given how similar it is to the previously documented D. temporalis, and that the very rare D. nicholsi also was found in this remote area, suggests that other species of Dipsas may be found in other isolated, mountainous areas around the country. There is a need for continued research, especially in remote areas, to fully document the serpent fauna of Panama.

Dipsas aparatiritos sp. nov. is sister to D. temporalis. We have decided to name in our phylogeny the specimen MHUA 14278 as D. temporalis following the work of Sheehy (2012) and Arteaga et al. (2018) and to not follow the suggestion by Barros et al. (2012) of identifying the sample as D. sanctijoannis. The sample in question was identified before as D. pratti (Daza et al. 2009, see GenBank) but Sheehy (2012) incorporated samples of D. pratti from the type locality and Venezuela, which clearly represents a different species. Sheehy presents the sample in question as D. temporalis. Later, Arteaga et al. (2018) presented a near topotypic sequence of D. temporalis, QCAZR5050, from San Lorenzo, Esmeraldas, 866 m. This near topotypic sequence forms a tight clade with the sample in question, MHUA 14278, in their phylogeny. Dipsas temporalis is typically a lowland Chocoan species inhabiting from Ecuador to Panama, below 100 m elevation. Dipsas pratti is a highland Andean species inhabiting the Cordillera Central and the Cordillera Oriental of Colombia and Venezuela, as shown by Barros et al. (2012). Dipsas sanctijoannis is a highland species distributed along the Cordillera Occidental and Cordillera Central of Colombia, and known from elevations between 1585 and 2400 (Boulenger 1911; Harvey et al. 2008). The lowest record of D. sanctijoannis that we know about is the type, from the town of Pueblo Rico, above the Río San Juan, near the Risaralda-Choco border at 1585 m (Boulenger 1911). Harvey et al. (2008) reports on a specimen of D. temporalis from near the type locality and along the San Juan drainage but, from much lower elevation, ca 60 m elevation (USNM 267244). This specimen is less than 90 km away from the type locality of D. sanctijoannis. The specimen MHUA 14278, originates from the lowlands of the northwestern branch of the Department of Antioquia, at 233 m elevation. Both the previous phylogenetic analyses and the lowland affinity of D. temporalis as compared to the highland D. pratti and D. sanctijoannis support our taxonomic decision.

Despite being a newly described species, Dipsas aparatiritos sp. nov. is quite common at the type locality. Fortunately, this area is a protected national park. Regardless, during the ten years JMR spent studying at the site, there was a reduction in number of park rangers (already very few for such a large, protected area), and there was a decline in the care of the trails near the ranger station. The site was logged in the past and unpermitted collection of rare butterflies was observed at the site, suggesting that other unpermitted collectors could arrive in the future. In 2015, the community began to pave the road leading into the park in an effort to pave to the town of La Rica inside the park boundaries. This advancement will greatly increase the ease with which tourists and poachers alike are able to reach the site. In the past, the site was only accessible with high-clearance four-wheel-drive vehicles. Finally, chytridiomycosis reached the site in 2004, but Ray et al. (2012) showed that D. aparatiritos sp. nov. (Dipsas sp. in that publication) feeds primarily on oligochaetes. There may be a desire of horticulturists and invertebrate enthusiasts to collect bromeliads where both the bromeligenous oligochaetes and D. aparatiritos sp. nov. spend considerable time. It is hoped that the area will remain protected and D. aparatiritos sp. nov. can continue to thrive.

Acknowledgements

We thank the Tropical Amphibian Decline in Streams Project especially Chad Montgomery and Karen Lips, Smithsonian Tropical Research Institute and Roberto Ibáñez for logistical support. Some fieldwork in Panama was made possible with the support of Liberty University, Tropical Herping, and the Canopy Family lodges. For granting access to the protected forests under their care, we are grateful to Daniel Arias and Raúl Arias of the Canopy Family lodges and to Martin Schaefer and David Agro of Fundación Jocotoco. We are grateful to David Kizirian (AMNH), Ned Gilmore (ANSP), Alan Resetar (FMNH), Rafe Brown and Luke Welton (KU), Carol Spencer (MVZ), Hussam Zaher (MZUSP), Kenneth L. Krysko (UF), Greg Schneider (UMMZ), Roy McDiarmid, Steve W. Gotte, Jeremy F. Jacobs, and Kevin de Queiroz (USNM) for allowing access to specimens under their care. For facilitating fieldwork, specimen and/or tissue access we also thank E. Arbeláez-Ortiz (Bioparque Amaru), T. Barros and G. Rivas (MBLUZ), M. Calderón-Espinoza (ICN), J. M. Daza (U. Antioquia), W. E. Duellman (KU), J. C. Murphy (FMNH), M. Sasa-Marín and A. Solorzano (ICP and UCR), C. Señaris (MHNLS), L. Vitt (UO), and M. Yánez-Muñoz and M. Urgilés (DHMECN). White background images of living specimens were created by Jose Vieira (ExSitu). Other photos were edited by Cassie A. Bishop (Winter High School) and Whitley Mike (Carmichael Lynch). Financial support for some components of this study was provided by grants to ENS from the National Science Foundation (DEB-0416160) and Instituto Bioclon, Mexico. JMR was funded by USNSF IBN-0429223 and IOB-0519458 (to Alan H. Savitzky), and by grants from Sigma Xi, Society for the Study of Amphibians and Reptiles, Chicago Herpetological Society, Sophie Danforth Conservation Biology Fund, and Wisconsin Division for Vocational Rehabilitation. PMSM was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) grant 2015/09054-1. RAP was funded in part by US NSF grants DBI-0905765 and DEB-1441719. AB was supported by Sistema Nacional de Investigación (SNI) of the Secretaría Nacional de Ciencia, Tecnología e Innovación (SENACYT, Panamá). We thank G. Rivas and an anonymous reviewer for comments that improved this manuscript.

References

  • Alfaro ME, Zoller S, Lutzoni F (2003) Bayes or bootstrap? A simulation study comparing the performance of Bayesian Markov chain Monte Carlo sampling and bootstrapping in assessing phylogenetic confidence. Molecular Biology and Evolution 20(2): 255–266. https://doi.org/10.1093/molbev/msg028
  • Arévalo ES, Davis SK, Sites Jr JW (1994) Mitochondrial DNA sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus grammicus complex (Phrynosomatidae) in central Mexico. Systematic Biology 43(3): 387–418. https://doi.org/10.1093/sysbio/43.3.387
  • Arteaga A, Salazar-Valenzuela D, Mebert K, Peñafiel N, Aguiar G, Sánchez-Nivicela JC, Pyron RA, Colston TJ, Cisneros-Heredia DF, Yánez-Muñoz MH, Venegas PJ, Guayasamin JM, Torres-Carvajal O (2018) Systematics of South American snail-eating snakes (Serpentes, Dipsadini), with the description of five new species from Ecuador and Peru. ZooKeys 766: 79–147. https://doi.org/10.3897/zookeys.766.24523
  • Arteaga A, Bustamante L, Vieira J, Tapia W, Guayasamin JM (2019) Reptiles of the Galápagos: life on the Enchanted Islands. Tropical Herping, Quito, 208 pp. https://doi.org/10.47051/AQJU7348
  • Barros TR, Jadin RC, Caicedo‐Portilla JR, Rivas GA (2012) Discovery of a rare snail‐eater snake in Venezuela (Dipsadinae, Dipsas pratti), with additions to its natural history and morphology. Zoosystematics and Evolution 88(1): 125–134. https://doi.org/10.1002/zoos.201200011
  • Batista A, Wilson LD (2017) A new record for Leptophis cupreus (Cope, 1868) (Squamata: Colubridae) for Panama and Mesoamerica. Mesoamerican Herpetology 4: 671–673.
  • Batista A, Mebert K, Lotzkat S, Wilson LD (2016) A new species of centipede snake of the genus Tantilla (Squamata: Colubridae) from an isolated premontane forest in eastern Panama. Mesoamerican Herpetology 3: 949–960.
  • Beaupre SJ, Jacobson ER, Lillywhite HB, Zamudio K (2004) Guidelines for use of live amphibians and reptiles in field and laboratory research. American Society of Ichthyologists and Herpetologists, Lawrence, 43 pp.
  • Berthold AA (1846) Über verschiedene neue oder seltene Reptilien aus Neu-Granada und Crustaceen aus China. Abh. K. Gesell. Wiss. Göttingen 3: 3–32. https://doi.org/10.5962/bhl.title.5485
  • Bocourt MF (1874) Deux notes sur quelques sauriens de l’Amérique tropicale. In Annales des Sciences Naturelles. Zoologie et Biologie Animale 19: 1–5.
  • Bocourt MF (1884) Note sur quelques ophidiens nouveaux, provenant de l’Amerique inter-tropicale. Bulletin de la Société Philomathique de Paris 8: 133–142.
  • Boulenger GA (1911) III.—descriptions of new Reptiles from the Andes of South America, preserved in the British Museum. Annals and Magazine of Natural History 7(37): 19–25. https://doi.org/10.1080/00222931108692903
  • Cadle JE (2005) Systematics of snakes of the Dipsas oreas complex (Colubridae: Dipsadinae) in western Ecuador and Peru, with revalidation of D. elegans (Boulenger) and D. ellipsifera (Boulenger). Bulletin of the Museum of Comparative Zoology 158(3): 67–136. https://doi.org/10.3099/0027-4100(2005)158[67:SOSOTD]2.0.CO;2
  • Cadle JE, Greene HW (1993) Phylogenetic Patterns, Biogeography, and the Ecological Structure of Neotropical Snake Assemblages. Species Diversity in Ecological Communities: Historical and Geographical Perspectives. Edited by Ricklefs RE, Schluter D. University of Chicago Press, Chicago, USA, 281–293.
  • Cadle JE, Myers CW (2003) Systematics of snakes referred to Dipsas variegata in Panama and western South America, with revalidation of two species and notes on defensive behaviors in the Dipsadini (Colubridae). American Museum Novitates 3409: 1–47. https://doi.org/10.1206/0003-0082(2003)409<0001:SOSRTD>2.0.CO;2
  • Caramaschi U, de Sá RO, Heyer WR (2006) Leptodactylus. Information bank for Leptodactylus frogs. https://facultyhub.richmond.edu [accessed 16 September 2022]
  • CATHALAC (2011) Mapa Centroamericano de cobertura y uso de la tierra, cambios de cobertura y uso de la tierra 1980-1990-2000-2010. Programa Regional para la Reducción de la Vulnerabilidad y Degradación Ambiental, Ciudad de Panamá, 166 pp.
  • Cope ED (1861) Catalogue of the Colubrids in the museum of the Academy of Natural Sciences of Philadelphia. Part 3. The Proceedings of the Academy of Natural Sciences of Philadelphia 12: 553–566.
  • Cope ED (1868) An examination of the Reptilia and Batrachia obtained by the Orton Expedition to Ecuador and the Upper Amazon, with notes on other species. Proceedings. Academy of Natural Sciences of Philadelphia 20: 96–140.
  • Cope ED (1875) “1876”. On the Batrachia and Reptilia of Costa Rica. Journal of the Academy of Natural Sciences of Philadelphia. Series 2(8): 93–154.
  • Daza JM, Smith EN, Páez VP, Parkinson CL (2009) Complex evolution in the Neotropics: the origin and diversification of the widespread genus Leptodeira (Serpentes: Colubridae). Molecular Phylogenetics and Evolution 53(3): 653–667. https://doi.org/10.1016/j.ympev.2009.07.022
  • Dowling HG (1951) A proposed standard system of counting ventrals in snakes. British Journal of Herpetology 1: 97–99.
  • Duméril AMC, Bibron G, Duméril AHA (1854) Erpétologie générale ou Histoire Naturelle complète des Reptiles. Vol. 7 (partie 1). Nouvelles suites a Buffon, Paris, [xvi +] 780. https://doi.org/10.5962/bhl.title.118797
  • Dunn ER (1924) New salamanders of the genus Oedipus with a synoptical key. Field Museum of Natural History Publication. Zoological Series 12: 95–100.
  • Figueroa A, McKelvy AD, Grismer LL, Bell CD, Lailvaux DP (2016) A species-level phylogeny of extant snakes with description of a new colubrid subfamily and genus. PLoS ONE 11(9): e0161070. https://doi.org/10.1371/journal.pone.0161070
  • Fitzinger LJ (1826) Neue Classification der Reptilien nach ihren Naturlichen. Verwandtscaften, Vienna, 66 pp.
  • Grazziotin FG, Zaher H, Murphy RW, Scrocchi G, Benavides MA, Zhang YP, Bonatto SL (2012) Molecular phylogeny of the new world Dipsadidae (Serpentes: Colubroidea): a reappraisal. Cladistics 28(5): 437–459. https://doi.org/10.1111/j.1096-0031.2012.00393.x
  • Günther A (1858) Catalogue of Colubrine snakes in the Collection of the British Museum. Trustees of the British Museum, London, 281 pp.
  • Harvey MB, Embert D (2008) Review of Bolivian Dipsas (Serpentes: Colubridae), with comments on other South American species. Herpetological Monograph 22(1): 54–105. https://doi.org/10.1655/07-023.1
  • Harvey MB, Fuenmayor GR, Portilla JRC, Rueda-Almonacid JV (2008) Systematics of the enigmatic dipsadine snake Tropidodipsas perijanensis Alemán (Serpentes: Colubridae) and review of morphological characters of Dipsadini. Herpetological Monograph 22(1): 106–132. https://doi.org/10.1655/08-025.1
  • Hijmans RJ, Cameron SE, Parra JL, Jones PG, Jarvis A (2005) Very high resolution interpolated climate surfaces for global land areas. International Journal of Climatology 25(15): 1965–1978. https://doi.org/10.1002/joc.1276
  • Hillis DM, Bull JJ (1993) An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Systematic Biology 42(2): 182–192. https://doi.org/10.1093/sysbio/42.2.182
  • Ingrasci MJ (2011) Molecular systematics of the coffee snakes, genus Ninia (Colubridae: Dipsadinae). MS Thesis, UT Arlington, Texas, USA, 1–127.
  • IUCN (2012) IUCN Red List Categories and Criteria: Version 3.1. 2nd edn. IUCN, Gland, Switzerland/Cambridge, UK, [iv +] 32 pp.
  • Jan G (1858) Plan d’une iconographie descriptive des ophidiens et description sommaire de nouvelles espèces des serpents. Revue et magasin de zoologie pure et appliquée 10(2): 438–449, 514–527. https://doi.org/10.5962/bhl.title.12473
  • Jan G (1862) Enumerazione sistematico delle specie d’ofidi del gruppo Calamaridae. Archivio per la Zoologia l’Anatomia e la Fisiologia 2: 1–76.
  • Köhler G, Lotzkat S, Hertz A (2010) A new species of Sibon (Squamata: Colubridae) from western Panama. Herpetologica 66(1): 80–85. https://doi.org/10.1655/08-077.1
  • Lara LCE, Sosa-Bartuano Á, Ruback P, Ray JM (2015) Range extension and natural history observations of a rare Panamanian snake, Geophis bellus Myers, 2003 (Colubridae: Dipsadinae). Check List 11(4): 1675. https://doi.org/10.15560/11.4.1675
  • Laurenti JN (1768) Specimen medicum, exhibens synopsin reptilium emendatum cum experimentis circa venena et antidota reptilium austriacorum. Joan Thom, 1–214. https://doi.org/10.5962/bhl.title.5108
  • Linnaeus C (1758) Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata, 10th edn. Laurentii Salvii, Holmiæ, 824 pp. https://doi.org/10.5962/bhl.title.542
  • Lips KR, Brem F, Brenes R, Reeve JD, Alford RA, Voyles J, Carey C, Livo L, Pessier AP, Collins JP (2006) Emerging infectious disease and the loss of biodiversity in a Neotropical amphibian community. Proceedings of the National Academy of Sciences 103(9): 3165–3170. https://doi.org/10.1073/pnas.0506889103
  • Lotzkat S (2015) Diversity, taxonomy, and biogeography of the reptiles inhabiting the highlands of the Cordillera Central (Serranía de Talamanca and Serranía de Tabasará) in western Panama. Doctoral dissertation, Frankfurt am Main, Johann Wolfgang Goethe-Univ., Dissertation, 931 pp.
  • Lotzkat S, Hertz A, Köhler G (2012) A new species of Sibon (Squamata: Colubroidea: Dipsadidae) from the Cordillera Central of western Panama, with comments on other species of the genus in the area. Zootaxa 3485(1): 26–40. https://doi.org/10.11646/zootaxa.3485.1.2
  • Maddison WP, Maddison DR (2005) MacClade Ver. 4.08. Analysis of phylogeny and character evolution. Sinauer Associates, Sunderland, MA. http://macclade.org [accessed 14 November 2011]
  • McCaffery RM, Lips KR (2013) Survival and abundance in males of the glass frog Espadarana (Centrolene) prosoblepon in Central Panama. Journal of Herpetology 47(1): 162–168. https://doi.org/10.1670/11-327
  • Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: Proceedings of the Gateway Computing Environments Workshop (GCE). 14 Nov. 2010, New Orleans, LA, USA, 1–8. https://doi.org/10.1109/GCE.2010.5676129
  • Montgomery CE, Ray JM, Savitzky AH, Griffith Rodriguez EJ, Ross HL, Lips KR (2007) Sibon longifrenis (Drab Snail-eater) diet. Herpetological Review 38(3): 343.
  • Mulcahy DG (2007) Molecular systematics of neotropical cat-eyed snakes: a test of the monophyly of Leptodeirini (Colubridae: Dipsadinae) with implications for character evolution and biogeography. Biological Journal of the Linnean Society 92(3): 483–500. https://doi.org/10.1111/j.1095-8312.2007.00855.x
  • Mulcahy DG, Macey JR (2009) Vicariance and dispersal form a ring distribution in nightsnakes around the Gulf of California. Molecular Phylogenetics and Evolution 53(2): 537–546. https://doi.org/10.1016/j.ympev.2009.05.037
  • Mulcahy DG, Beckstead TH, Sites Jr JW (2011) Molecular systematics of the Leptodeirini (Colubroidea: Dipsadidae) revisited: species-tree analyses and multi-locus data. Copeia 2011(3): 407–417. https://doi.org/10.1643/CH-10-058
  • Noonan BP, Chippindale PT (2006) Vicariant origin of Malagasy reptiles supports Late Cretaceous Antarctic land bridge. American Naturalist 168(6): 730–741. https://doi.org/10.1086/509052
  • Nunes PMS, Fouquet A, Curcio FF, Kok PJ, Rodrigues MT (2012) Cryptic species in Iphisa elegans Gray, 1851 (Squamata: Gymnophthalmidae) revealed by hemipenial morphology and molecular data. Zoological Journal of the Linnean Society 166(2): 361–376. https://doi.org/10.1111/j.1096-3642.2012.00846.x
  • Parkinson CL, Campbell JA, Chippindale PT (2002) Multigene phylogenetic analyses of pitvipers; with comments on the biogeographical history of the group. In: Schuett GW, Höggren M, Douglas ME, Greene HW (Eds) Biology of the Vipers. Eagle Mountain Publishing, Salt Lake City, Utah, 93–110.
  • Passos P, Fernandes DS, Caramaschi U (2004) The taxonomic status of Leptognathus incertus Jan, 1863, with revalidation of Dipsas alternans (Fischer, 1885) (Serpentes: Colubridae: Dipsadinae). Amphibia-Reptilia 25(4): 381–393. https://doi.org/10.1163/1568538042788951
  • Passos P, Fernandes R, Porto M (2005) Geographical variation and taxonomy of the snail-eating snake Dipsas albifrons (Sauvage, 1884), with comments on the systematic status of Dipsas albifrons cavalheiroi Hoge, 1950 (Serpentes: Colubridae: Dipsadinae). Zootaxa 1013(1): 19–34. https://doi.org/10.11646/zootaxa.1013.1.2
  • Peters JA (1956) An analysis of variation in a South American snake, Catesby’s snail-sucker (Dipsas catesbyi Sentzen). American Museum Novitates 1783: 1–41.
  • Peters JA (1960) The snakes of the subfamily Dipsadinae. Miscellaneous Publications Museum of Zoology University of Michigan 114: 1–224.
  • Prairie A, Chandler K, Ruback P, Ray JM (2015) Dumeril’s Coralsnake (Micrurus dumerilii Jan, 1858) in Panama. Mesoamerican Herpetology 2: 253–259.
  • Pyron RA, Burbrink FT, Wiens JJ (2013) A phylogeny and revised classification of Squamata, including 4161 species of lizards and snakes. BMC Evolutionary Biology 13(1): 93. https://doi.org/10.1186/1471-2148-13-93
  • Quinn H, Jones JP (1974) Squeeze box technique for measuring snakes. Herpetological Review 5: 35.
  • Rambaut A, Drummond AJ (2009) TRACER v1.5. University of Oxford, Oxford, UK.
  • Ray JM (2009) Ecology of Neotropical arboreal snakes and behavior of New World mollusk-eating snakes. Old Dominion University. Ph.D. Dissertation, 169 pp.
  • Ray JM (2017) Snakes of Panama: A Field Guide to all Species. CreateSpace Independent Publishing Platform. Scotts Valley, CA, USA, 214 pp.
  • Ray JM, Wilson B, Griffith Rodriquez EJ, Ross HL (2011) Sibon argus (Blotched Snail Sucker) Diet. Herpetological Review 42(1): 102–103.
  • Ray JM, Montgomery CE, Mahon HK, Savitzky AH, Lips KR (2012) Goo-eaters: Diets of the neotropical snakes Dipsas and Sibon in Central Panama. Copeia 2012(2): 197–202. https://doi.org/10.1643/CH-10-100
  • Royle JA, Chandler RB, Yackulic C, Nichols JD (2012) Likelihood analysis of species occurrence probability from presence-only data for modelling species distributions. Methods in Ecology and Evolution 3(3): 545–554. https://doi.org/10.1111/j.2041-210X.2011.00182.x
  • Ryan MJ, Lips KR (2004) Sibon argus (NCN). Diet. Herpetological Review 35: 278. [Sibon argus (NCN). Dieta.]
  • Savage JM (1973) A revised terminology for plates in the loreal region of snakes. British Journal of Herpetology 5: 360–362.
  • Savage JM (2002) The Amphibians and Reptiles of Costa Rica. A Herpetofauna between Two Continents, between Two Seas. University of Chicago Press. Chicago, Illinois, 934 pp.
  • Sheehy CM III (2012) Phylogenetic relationships and feeding behavior of Neotropical snail-eating snakes (Dipsadinae, Dipsadini). PhD Thesis, UT Arlington, Texas, USA, 135 pp.
  • Soberón J, Peterson TA (2005) Interpretation of models of fundamental ecological niches and species’ distributional areas. Biodiversity Informatics 2(0): 1–10. https://doi.org/10.17161/bi.v2i0.4
  • Solórzano A (2004) Serpientes de Costa Rica. INBio, San José, CR, 792 pp.
  • Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: Molecular Evolutionary Genetics Analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28(10): 2731–2739. https://doi.org/10.1093/molbev/msr121
  • Townsend TM, Alegre RE, Kelley ST, Wiens JJ, Reeder TW (2008) Rapid development of multiple nuclear loci for phylogenetic analysis using genomic resources: An example from squamate reptiles. Molecular Phylogenetics and Evolution 47(1): 129–142. https://doi.org/10.1016/j.ympev.2008.01.008
  • Vecchiet JA, Ray JM, Knight JL, Wedow J (2014) Dipsas articulata (Red-striped Thirst Snake) Geographic Distribution. Herpetological Review 45: 94.
  • Vidal N, Dewynter M, Gower DJ (2010) Dissecting the major American snake radiation: A molecular phylogeny of the Dipsadidae Bonaparte (Serpentes, Caenophidia). Comptes Rendus Biologies 333(1): 48–55. https://doi.org/10.1016/j.crvi.2009.11.003
  • Wagler JG (1828) (Colubridae, Xenodontinae) en la Amazonia Colombiana. Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales 28: 409–446.
  • Wagler JG (1830) Natürliches System der Amphibien mit vorangehender Classification der Säugthiere und Vogel. München, Stuttgart, und Tubingen, [vi +] 354 pp. https://doi.org/10.5962/bhl.title.108661
  • Zaher H (1999) Hemipenial morphology of the South American xenodontine snakes: with a proposal for a monophyletic Xenodontinae and a reappraisal of colubroid hemipenes. Bulletin of the AMNH; no. 240. http://hdl.handle.net/2246/1646
  • Zaher H, Prudente ALC (2003) Hemipenes of Siphlophis (Serpentes, Xenodontinae) and techniques of hemipenial preparation in snakes: a response to Dowling. Herpetological Review 34(4): 302–306.
  • Zaher H, Grazziotin FG, Cadle JE, Murphy RW, Moura-Leite JCD, Bonatto SL (2009) Molecular phylogeny of advanced snakes (Serpentes, Caenophidia) with an emphasis on South American Xenodontines: a revised classification and descriptions of new taxa. Papéis Avulsos de Zoologia (São Paulo) 49: 115–153. https://doi.org/10.1590/S0031-10492009001100001
  • Zipkin EF, DiRenzo GD, Ray JM, Rossman S, Lips KR (2020) Tropical snake diversity collapses after widespread amphibian loss. Science 367(6479): 814–816. https://doi.org/10.1126/science.aay5733

Appendix 1

Specimens examined

The numbers with an asterisk (*) correspond to holotypes.

Dipsas aparatiritos sp. nov. Panama, Coclé, Donoso: SMF 97346; El Copé, ca. 5.5 km N of Parque Nacional General de División Omar Torrijos Herrera: USNM 579807–579829; Panamá Oeste, Cerro Campana: MHCH 3123; Veraguas, Cerro Mariposa: MHCH 2311, SMF 89551–53, SMF 89953–54; Cerro Negro: SMF 89769, SMF 90036.

Dipsas articulata. Nicaragua, Río San Juan, Elev. 13m, Río Indio Lodge: MVZ 269222–269223; Panama, Bocas del Toro: AMNH 124125, Cocuyas de Veragua: ANSP 10113*; Isla Bastimentos, Old Point: USNM 297917; Laguna de Tierra Oscura, 3.7 km S of Tiger Key: USNM 348490–348491; Costa Rica, Limón, La Castilla, Lower Reventazon: ANSP 22380; Pandora: UMMZ 125236.

Dipsas bicolor. Honduras, Gracias a Dios, Bachi Kiamp: USNM 578015; Cabeceras de Río Rus Rus: USNM 559619; Urus Tingni Kiamp: USNM 561921; Warunta Tingni Kiamp: USNM 561922; Olancho, Nueva Esperanza: USNM 559618.

Dipsas brevifacies. Mexico, Yucatán: FMNH 20634, 36397, 36401, 36406, USNM 6562; Citilpeck: ANSP 10129.

Dipsas gaigeae. Mexico, Colima: AMNH 82017; Colima: USNM 160938; Hacienda Paso del Rio/Periquillo: UMMZ 80221*; Jalisco, Barra de Navidad: USNM 196499.

Dipsas nicholsi. Panama, Canal Zone, Madden Forest Preserve: KU 110310–314; Coclé, Parque Nacional General de División Omar Torrijos Herrera: USNM 579806; Panamá: FMNH 217310, Chagres Village: ANSP 21907.

Dipsas temporalis. Colombia, Antioquia, unknown: UV-C 5388; Choco, Agua Clara, Río Tamana: USNM 267244; Chocó, Condoto: NHMUK; N slope Alto de Buey: LACM 72747; Valle de Cauca, Tamboral: CPZ-UV 04568; Valle del Cauca, Quebrada la Batea: CZI-R 080; Panama, Comarca Emberá-Wounaan, Serranía de Jingurudo: MHCH 2878; Darién, S slope Cerro Cituro, Serrania de Pirre: KU 110301, 110303–304, 110307–309; Ridge between Río Jaqué and Río Imamadó: KU 110295; Panamá, S slope Cerro La Campana: KU 110293; Rancho Frío Field Station: MHCH 2881. Ecuador, Esmeraldas, Durango: ZSFQ 5062 and ZSFQ 5063; Junto al Río Chuchubí: QCAZ 5050; 16 km W of Lita: MHNG 2521.083; Tundaloma Lodge: MZUTI 3331.

Dipsas tenuissima. Costa Rica, San José, 15 mi NW San Isidro del General: KU 31961*; Panama, Chiriquí, Pto. Armuelles: ANSP 24255; Panama Isthmus, MZUSP 2049.

Dipsas viguieri. Colombia, Chocó: FMNH 74376; Panama, Darién: AMNH 36200; Rio Tuira at Rio Mono: KU 110316; Canal Zone, Madden Forest Preserve: UF 44291, KU 110317; Madden Forest Road, 2.0 mi S. Trans Isthmus Highway: UF 44290; Pipeline Road: UMMZ 155717.

Appendix 2

Table A1.
Download as
CSV
XLSX

Primers used in this study, gene, name, direction, sequence (5'–3' direction), and reference.

Primers Reference
cyt-b S20596F (F) AACCACTCTTGTTAATCAACTACA Ingrasci 2011
cyt-b S21790R (R) ACCCATGTTTGGTTTACAAAAACAATGCT Ingrasci 2011
cyt-b GLUDG (F) TGACTTGAARAACCAYCGTTG Parkinson et al. 2002
cyt-b AtrCB3 (R) TGAGAAGTTTTCYGGGTGRTT Parkinson et al. 2002
ND4 ND4 (F) CACCTATGACTACCAAAAGCTCATGTAGAAGC Arévalo et al. 1994
ND4 LEU (R) CATTACTTTTACTTGGATTTGCACCA Arévalo et al. 1994
ND4 605F (F) GTCTCCATCTATGACTCCCA Ingrasci 2011
ND4 L68R (R) TACCACTTGGATTTGCACCA Ingrasci 2011
NT3 NT3-F3 (F) ATATTTCTGGCTTTTCTCTGTGGC Noonan and Chippindale 2006
NT3 NT3-R4 (R) GCGTTTCATAAAAATATTGTTTGACCGG Noonan and Chippindale 2006
DNAH3 DNAH3-f1 (F) GGTAAAATGATAGAAGAYTACTG Townsend et al. 2008
DNAH3 DNAH3-r6 (R) CTKGAGTTRGAHACAATKATGCCAT Townsend et al. 2008

Appendix 3

Table A2.
Download as
CSV
XLSX

Specimens used in genetic analyses and respective GenBank numbers.

Taxa Voucher museum number Field or tissue number Locality ND4 cyt-b NT3 DNAH3
D. andiana Bioparque Amaru RSCDSP 0389 JM 79 (J. M. Daza) Ecuador: Los Ríos JX398453 JX398607 JX398744 JX293843
D. aparatiritos USMN 579815 JM 664 Panama: Coclé JX398476 JX398626
D. aparatiritos USMN 579814 JM 663 Panama: Coclé JX398475 JX398625
D. aparatiritos USNM HerpTissue 113 JM 758 Panama: Coclé JX398477 JX398627 JX398752
D. aparatiritos USMN 579818 JM 795 Panama: Coclé JX398478 JX398628 JX398753
D. articulata D161; MSM/ASL at UCR Costa Rica: Limón JX398454 JX398740
D. bicolor ASL 277 at UCR Costa Rica: Limón JX398455 JX398741 JX293844
D. catesbyi DHMECN 11952 ENS 13477 Ecuador: Napo JX398456 JX398608
D. catesbyi UTA R-55949 ENS 12341 Ecuador: Tungurahua JX398457 JX398609 JX398742 JX293845
D. catesbyi UTA R-55974 ENS 12204 Ecuador: Tungurahua JX398458 JX398610 JX398743 JX293846
D. catesbyi KU 214851 WED 57932 Peru: Madre de Dios EF078537 EF078585
D. catesbyi WED 59073 Peru: Madre de Dios JX398459 JX398611 JX398745 JX293847
D. georgejetti UTA R-61628 ENS 12817 Ecuador: Manabí JX398554 JX398694 JX398817 JX293897
D. gracilis ICN 12019 RAM 315 Colombia: Cesar JX398465 JX398615 JX398746 JX293852
D. gracilis UTA R-55943 ENS 12671 Ecuador: Esmeraldas JX398466 JX398616 JX398747 JX293853
D. gracilis UTA R-55944 ENS 12672 Ecuador: Esmeraldas JX398467 JX398617 JX398748
D. indica KU 204908 WED 56989 Peru: Madre de Dios JX398468 JX398618 JX398734 JX293854
D. jamespetersi Bioparque Amaru RSCDSP 0390 JM 72 (J. M. Daza) Ecuador: Azuay JX398555 JX398695 JX398818 JX293898
D. mikanii CTMZ 495 Brazil: São Paulo JX398693 JX398816 JX293896
D. nicholsi JM 812 Panama: Coclé JX398469 JX398619
D. pavonina LSUMZ-H 13989 Brazil: Amazonas JX398470 JX398620 JX398749 JX293855
D. palmeri DHMECN 11954 ENS 12421 Ecuador: Tungurahua JX398471 JX398621
D. peruana LSUMZ-H 1532 Peru: Pasco JX398472 JX398622 JX398750 JX293856
D. pratti MBUCV 6837 TB 149H Venezuela: Zulia JX398473 JX398624 JX398751
D. pratti MHUA 14638 Colombia: Antioquia JX398474 JX398623
D. temporalis MHUA 14278 Colombia: Antioquia GQ334583 GQ334482 GQ334667 GQ334560
D. turgida LSUMZ 36734 LSUMZ-H 6458 Bolivia: Unknown JX398556 JX398696 JX398819 JX293899
D. trinitatis UWIZM.2011.20.25 Trinidad: Arima JX398479 JX398629
D. variegata D99; Vidal et al. (2000) French Guiana: Cayenne JX398480 JX398630 JX398737 JX293857
D. variegata MHNLS 18013 ENS 11187 Venezuela: Bolivar JX398481 JX398631
D. variegata UTA R-15772 WWL 3152 Suriname: Marowijne JX398482 JX398601 JX398736 JX293858
D. vermiculata UTA R-55939 ENS 12353 Ecuador: Morona-Santiago JX398483 JX398632 JX398754 JX293859
login to comment