Research Article
Print
Research Article
A new species of Bush frog (Anura, Rhacophoridae, Raorchestes) from southeastern Yunnan, China
expand article infoJunkai Huang‡, Xiao Long Liu§, Lingyun Du‡, Justin M. Bernstein|, Shuo Liu, Yun Yang#, Guohua Yu‡, Zhengjun Wu‡
‡ Guangxi Normal University, Guilin, China
§ Southwest Forestry University, Kunming, China
| Rutgers University Newark, Newark, United States of America
¶ Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China
# The Management Bureau of Wenshan National Nature Reserve, Wenshan, China

Corresponding author: Guohua Yu ( yugh2018@126.com )

Corresponding author: Zhengjun Wu ( wu_zhengjun@aliyun.com )

Academic editor: Annemarie Ohler
© 2023 Junkai Huang, Xiao Long Liu, Lingyun Du, Justin M. Bernstein, Shuo Liu, Yun Yang, Guohua Yu, Zhengjun Wu.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Huang J, Liu XL, Du L, Bernstein JM, Liu S, Yang Y, Yu G, Wu Z (2023) A new species of Bush frog (Anura, Rhacophoridae, Raorchestes) from southeastern Yunnan, China. ZooKeys 1151: 47-65. https://doi.org/10.3897/zookeys.1151.95616
ZooBank: urn:lsid:zoobank.org:pub:4AACB0A6-2800-465D-A10F-E69B4CEE3E05
Open Access

Abstract

In this study, based on morphological and molecular data, a new bush frog species is described from Yunnan, China. Eleven samples of Raorchestes malipoensis sp. nov. were collected from Malipo County, southeastern Yunnan. This species can be distinguished from other congeners by a combination of 13 morphological characters. Phylogenetic analyses based on the 16S rRNA gene indicate that these individuals form a monophyletic group, and genetic divergence between this clade and its closest relatives is higher than 3.1%, which is comparable to the divergence between recognized Raorchestes species. The discovery of this new species suggests that additional extensive surveys in the southeastern Yunnan would yield more amphibian lineages yet unknown to science.

Keywords

Kurixalus gryllus, Raorchestes gryllus, Raorchestes malipoensis sp. nov., taxonomy

Introduction

The genus Raorchestes Biju, Shouche, Dubois, Dutta & Bossuyt, 2010 belongs to the family Rhacophoridae Hoffman, 1932. It includes bush frogs with adult size ranging from 10.0 mm to 50.5 mm (Priti et al. 2016). They are distinguished by the presence of a transparent/translucent vocal sac, the absence of vomerine teeth, and direct development without free swimming tadpoles (Seshadri et al. 2012). The genus Raorchestes currently contains 74 species, ranging from the southern tip of the Indian Peninsula to northeastern India, Indo-China, and southwestern China (Frost 2021): most are from south and Southeast Asia including southern India to Nepal, Myanmar, Thailand, Laos, southern China, Vietnam, and West Malaysia. Of the 74 recognized species, seven species have been originally described from China: Raorchestes longchuanensis (Yang & Li, 1978), R. menglaensis (Kou, 1990), R. andersoni (Anderson, 1927), R. cangyuanensis (Wu et al., 2019), R. dulongensis (Wu et al., 2021), R. hillisi (Jiang et al., 2020), and R. huanglianshan (Jiang et al., 2020). Detailed ecological data is not available for the species reported in China except for R. longchuanensis, for which Yan et al. (2021) reported the breeding mode.

Many Raorchestes species from the region were described with few diagnostic characters and limited morphological data, which hampers the identification of these small-sized bush frogs (Jiang et al. 2020). In addition, the taxonomy of Raorchestes gryllus is under dispute. It was originally described as Philautus gryllus Smith, 1924, from Langbian Peaks, southern Vietnam. Biju et al. (2010) classified this species into Raorchestes according to the 16S sequences from Pac Ban, Tuyen Quang, northern Vietnam, and recently Poyarkov et al. (2021) suggested a transfer to Kurixalus based on morphological and molecular data of specimens from the type locality (Langbian, southern Vietnam).

In this work we studied specimens allocated to Raorchestes from Malipo County. This county is located in the southeast of Yunnan Province, and lies on the China-Vietnam border where few herpetological investigations have been conducted. During the fieldwork, we collected 11 specimens of a small-sized bush frog that could be assigned to the genus Raorchestes based on morphological and molecular evidence. Phylogenetically, these specimens were grouped together with a misidentified “R. gryllus” from Pac Ban, Tuyen Quang, northern Vietnam. However, considering that the type locality of Philautus gryllus, Langbian Plateau, is 1200 km far from the China-Vietnam border and that obvious morphological differences exist between Philautus gryllus and the lineage consisting of individuals from China-Vietnam border region, we consider that these specimens represent a new species that we formally describe here.

Materials and methods

Sampling

Fieldwork was conducted at Malipo County, Yunnan Province, China (23.182°N, 104.78°E, elevation 1496 m). Six specimens were collected on 7 May 2019 (Figs 1, 2) and another five specimens were collected on 22 July 2020. Specimens were collected by hand and subsequently euthanized with 20% ethanol following standard euthanasia protocols for amphibians. Liver or muscle tissues were taken from the specimens and preserved in 95% ethanol before fixing them in 75% ethanol. Voucher specimens SWFU 3110, SWFU 3113, SWFU 3114, SWFU 3116, SWFU 3111, and SWFU 3112 were deposited at Southwest Forestry University (SWFU). GXNU 000338, GXNU 000339, GXNU 000340, GXNU 000341, GXNU 000342 were deposited at Guangxi Normal University (GXNU).

Figure 1. 

The type locality of Raorchestes malipoensis sp. nov., its closest relatives, and also Kurixalus gryllus (previously Raorchestes gryllus).

Figure 2. 

Habitat at the type locality of Raorchestes malipoensis sp. nov., Malipo County, Yunnan Province, 23.182°N, 104.78°E, elevation 1496 m, China.

Morphology and morphometrics

All the measurements were made with slide calipers to the nearest 0.1 mm. Morphological terminology and measurement methods followed Fei et al. (2009). The morphological characters include: snout-vent length (SVL); head length (HL); head width (HW); snout length (SL); internarial distance (INS); interorbital distance (IOS); eye horizontal diameter (EHD); maximum width of upper eyelid (UEW); tympanum diameter (TD); forelimb and hand length (FAHL); width of lower arm (LAW); hand length (HAL); femur length (FML); tibia length (TBL); length of tarsus and foot (TFL); foot length (FOL); tibia width (TBW); and femur width (FMW). Morphological measurements of the specimens are given in Table 1. Males and females (breeding individuals) were identified based on the presence or absence of an external single subgular vocal sac. Comparative morphological data of congeneric species were taken from previous studies and are presented in Table 2.

Table 1.
Download as
CSV
XLSX

Measurements (mm) of adult specimens in the type series of Raorchestes malipoensis sp. nov. Abbreviations defined in the Materials and methods.

Sex Males (n = 4) Females (n = 2) Males (n = 3) Females (n = 2)
Catalog No. SWFU 3110 SWFU 3113 SWFU 3114 SWFU 3116 SWFU 3111 SWFU 3112 GXNU 000338 GXNU 000339 GXNU 000341 GXNU 000340 GXNU 000342
SVL 17.1 17.0 16.5 14.7 19.3 19.0 17.5 17.7 17.3 18.7 18.3
HL 5.7 5.8 6.3 5.2 6.5 7.9 5.9 6.4 5.7 6.3 6.7
HW 7.7 7.5 8.2 5.5 8.2 7.9 6.5 6.8 6.4 7 7
SL 2.5 2.6 1.8 2.5 2.9 2.6 2 2.6 2.4 2.5 2.2
INS 1.5 2.2 2.2 2.0 2.2 2.1 2.2 2.1 2.3 2.2 2
IOS 2.7 2.7 2.9 2.9 3.2 2.9 2.9 2.6 2.9 2.7 2.9
UEW 1.2 1.2 1.9 1.4 1.6 1.7 1.6 1.3 1.4 1.4 1.7
EHD 2.2 2.1 2.1 2.6 2.6 2.8 2.4 2.6 2.4 2.5 2.2
TD 1.4 1.4 1.5 1.3 1.1 1.5 1.2 1.5 1.4 1.6 1.4
FAHL 9.3 9.3 8.8 7.0 8.6 9.6 7.8 8.2 7.2 7.3 7.1
HAL 5.6 5.6 5.3 4.2 5.2 5.6 5.3 5.2 5.3 4.6 5.4
LAW 1.7 2.0 1.6 1.3 1.4 1.6 1.5 1.2 1.6 1.3 1.3
TBL 9.1 8.7 8.4 7.5 9.1 9.2 9 8.8 8 8.7 8.8
FML 7.5 9.2 8.3 7.1 8.0 10.2 7.5 8 7.5 8.2 7.9
TBW 2.1 2.6 1.8 1.5 2.0 2.8 1.7 1.7 1.8 1.8 1.9
TFL 9.8 10.9 10.6 8.8 10.0 11.8 10.8 11 10.1 9.6 10.7
Table 2.
Download as
CSV
XLSX

The source of morphological data for Raorchestes species used in this study.

ID Raorchestes species Literature
3 Raorchestes ghatei Padhye, Sayyed, Jadhav, & Dahanukar, 2013 Padhye et al. 2013
4 Raorchestes parvulus (Boulenger, 1893) Bossuyt and Dubois 2001
5 Raorchestes cangyuanensis Wu, Suwannapoom, Xu, Murphy, & Che, 2019 Wu et al. 2019
6 Raorchestes longchuanensis (Yang & Li, 1978) Al-Razi et al. 2020 b; Yang and Li 1978
7 Raorchestes menglaensis (Kou, 1990) Jiang et al. 2020
8 Raorchestes hillisi Jiang Ren, Guo, Wang & Li, 2020 Jiang et al. 2020
9 Raorchestes huanglianshan Jiang, Wang, Ren, & Li, 2020 Jiang et al. 2020
10 Raorchestes dulongensis Wu, Liu, Gao, Wang, Li, Zhou, Yuan, & Che, 2021 Wu et al. 2021
11 Raorchestes andersoni (Ahl, 1927) Bossuyt and Dubois 2001
12 Raorchestes rezakhani Al-Razi, Maria, & Muzaffar, 2020 Al-Razi et al. 2020 a
13 Raorchestes annandalii (Boulenger, 1906) Che et al. 2020

DNA sequencing and analyses of sequences

Total DNA was extracted using a commercial tissue DNA isolation kit (Chenlu Biotech, China). For seven specimens in this study, the mitochondrial gene 16S ribosomal RNA (16S rRNA) gene was sequenced. The fragments of 16S rRNA were amplified using primers 16Sar-L (5’–CGCCTGTTTATCAAAAACAT–3’) and 16Sbr-H (5’–CCGGTCTGAACTCAGATCACGT–3’) (Palumbi et al. 1991). Polymerase chain reactions (PCR) amplifications were performed in a 25 μl reaction volume with an initial denaturation at 94 °C for 5 min, followed by 35 cycles of 94 °C for 1 min, 51 °C for 1 min, 72 °C for 1 min, and a final extension at 72 °C for 10 min. The PCR products were sequenced using an ABI 3730 automated sequencer. To study the phylogenetic relationships among Raorchestes species, matrilineal genealogies were reconstructed based on the 16S fragment. Fifty-two sequences of Raorchestes and representative outgroups (Jiang et al. 2020) were downloaded from GenBank (Table 3). The dataset was checked by eye and manually adjusted using MEGA 6.0 with default settings (Tamura et al. 2013), and the alignment was checked by eye and adjusted manually. JMODELTEST v. 2.1.7 (Darriba et al. 2012) was used to select an appropriate nucleotide substitution model for Bayesian Inference (BI). The GTR+G+I model was chosen as the best-fit model following the Bayesian information criterion (BIC; Posada 2008). Bayesian analysis was performed using MrBayes 3.2 (Ronquist et al. 2012). For BI analyses, the Monte Carlo Markov chain length was run for 120,000,000 generations and sampled every 100 generations with a burn-in of 25%. Convergence was assessed by the average standard deviation of split frequencies (below 0.01) and ESS values (greater than or equal to 200) in TRACER 1.5 (Rambaut and Drummond. 2009). Maximum likelihood (ML) analyses were performed using RAxML v. 8.2.10 (Stamatakis 2014) with 1000 rapid bootstrap replicates under GTR+I+G nucleotide substitution model for the concatenated dataset (Stamatakis, 2014). Mean genetic distances (uncorrected p-distance) between and within species were calculated in MEGA v. 6.0.6 (Tamura et al. 2013) based on 16S sequences.

Table 3.
Download as
CSV
XLSX

Information on voucher numbers, GenBank accession numbers, and localities of specimens used in this study; for collections and their abbreviations see Material and methods.

Species Voucher No. GenBank No. Locality Resource
Ingroup
Raorchestes malipoensis sp. nov. SWFU 3110 ON128247 Malipo, Yunnan, China This study
Raorchestes malipoensis sp. nov. SWFU 3111 ON128241 Malipo, Yunnan, China This study
Raorchestes malipoensis sp. nov. ROM 30288 GQ285674 Pac Ban, Tuyen Quang, Vietnam Li et al. 2009
Raorchestes malipoensis sp. nov. GXNU 000338 ON128246 Malipo, Yunnan, China This study
Raorchestes malipoensis sp. nov. GXNU 000339 ON128245 Malipo, Yunnan, China This study
Raorchestes malipoensis sp. nov. GXNU 000340 ON128244 Malipo, Yunnan, China This study
Raorchestes malipoensis sp. nov. GXNU 000341 ON128243 Malipo, Yunnan, China This study
Raorchestes malipoensis sp. nov. GXNU 000342 ON128242 Malipo, Yunnan, China This study
Raorchestes dulongensis KIZ 035082 MW537814 Qinlangdang, Yunnan, China Wu et al. 2021
Raorchestes hillisi CIB 116331 MT488411 Xiding, Yunnan, China Jiang et al. 2020
Raorchestes longchuanensis KIZ 048468 MN475870 Unknown Wu et al. 2019
Raorchestes parvulus LSUHC:11118 MH590201 Gunung Stong, Kelantan, Malaysia Chan et al. 2018
Raorchestes menglaensis CIB 116349 MT488410 Menglun, Yunnan, China Jiang et al. 2020
Raorchestes huanglianshan CIB 116365 MT488414 Lvchun, Yunnan, China Jiang et al. 2020
Raorchestes cangyuanensis KIZ 015855 MN475866 Cangyuanensis, Yunnan, China Wu et al. 2019
Raorchestes tuberohumerus CESF 148 JX092697 Western Ghats, India Vijayakumar et al. 2014
Raorchestes bombayensis CESF 1010 JX092657 Western Ghats, India Vijayakumar et al. 2014
Raorchestes ghatei AGCZRL Amphibia 128 KF366391 Western Ghats, India Padhye et al. 2013
Raorchestes griet CESF 073 JX092654 Western Ghats, India Vijayakumar et al. 2014
Raorchestes coonoorensis CESF 439 JX092716 Western Ghats, India Vijayakumar et al. 2014
Raorchestes charius CESF 132 JX092691 Western Ghats, India Vijayakumar et al. 2014
Raorchestes marki CESF 467 JX092719 Western Ghats, India Vijayakumar et al. 2014
Raorchestes indigo CESF 138 KM596557 Kudremukh Massif, Western Ghats, India Vijayakumar et al. 2014
Raorchestes emeraldi CESF 1365 KM596556 Valparai plateau, Western Ghats, India Vijayakumar et al. 2014
Raorchestes ponmudi CESF 063 JX092651 Western Ghats, India Vijayakumar et al. 2014
Raorchestes aureus CESF 1164 KM596540 Malabar, Western Ghats, India Vijayakumar et al. 2014
Raorchestes montanus CESF 130 KM596552 Western Ghats, India Vijayakumar et al. 2014
Raorchestes tinniens CESF 438 JX092715 Western Ghats, India Vijayakumar et al. 2014
Raorchestes primarrumfi CESF 442 KM596575 Nilgiri Massif, Western Ghats,India Vijayakumar et al. 2014
Raorchestes signatus Unknow AY141841 Sri Lanka Meegaskumbura et al. 2002
Raorchestes chromasynchysi CESF 1127 JX092667 Western Ghats, India Vijayakumar et al. 2014
Raorchestes chotta CESF 1003 JX092656 Western Ghats, India Vijayakumar et al. 2014
Raorchestes nerostagona CESF 1061 JX092661 Western Ghats, India Vijayakumar et al. 2014
Raorchestes kadalarensis CESF 1766 JX092701 Western Ghats, India Vijayakumar et al. 2014
Raorchestes agasthyaensis CESF 492 JX092723 Western Ghats, India Vijayakumar et al. 2014
Raorchestes travancoricus CESF 473 JX092721 Western Ghats, India Vijayakumar et al. 2014
Raorchestes luteolus CESF 1012 JX092659 Western Ghats, India Vijayakumar et al. 2014
Raorchestes beddomii CESF 072 JX092653 Western Ghats, India Vijayakumar et al. 2014
Raorchestes theuerkaufi CESF 1342 JX092693 Western Ghats, India Vijayakumar et al. 2014
Raorchestes munnarensis CESF 094 JX092655 Western Ghats, India Vijayakumar et al. 2014
Raorchestes anili CESF 386 JX092708 Western Ghats, India Vijayakumar et al. 2014
Raorchestes resplendens CESF 1258 JX092683 Western Ghats, India Vijayakumar et al. 2014
Raorchestes dubois CESF 114 JX092668 Western Ghats, India Vijayakumar et al. 2014
Raorchestes kakachi CESF 1385 KM596558 Western Ghats, India Vijayakumar et al. 2014
Raorchestes kaikatti CESF 444 JX092718 Western Ghats, India Vijayakumar et al. 2014
Raorchestes sushili CESF 1259 JX092684 Western Ghats, India Vijayakumar et al. 2014
Raorchestes flaviocularis CESF 1252 KM596549 Manalar Plateau, Western Ghats, India Vijayakumar et al. 2014
Raorchestes ochlandrae CESF 1111 JX092666 Western Ghats, India Vijayakumar et al. 2014
Raorchestes manohari CESF 1187 JX092674 Western Ghats, India Vijayakumar et al. 2014
Raorchestes uthamani CESF 483 JX092722 Western Ghats, India Vijayakumar et al. 2014
Raorchestes chlorosomma FB-2008c EU450017 Munnar, Idukki, Kerala, India Biju and Bossuyt 2009
Raorchestes crustai CESF 1199 JX092677 Western Ghats, India Vijayakumar et al. 2014
Raorchestes graminirupes CESF 044 JX092649 Western Ghats, India Vijayakumar et al. 2014
Raorchestes johnceei CESF 1236 JX092679 Western Ghats, India Vijayakumar et al. 2014
Raorchestes glandulosus CESF 1080 JX092665 Western Ghats, India Vijayakumar et al. 2014
Raorchestes jayarami CESF 1260 JX092686 Western Ghats, India Vijayakumar et al. 2014
Raorchestes bobingeri CESF 1238 JX092680 Western Ghats, India Vijayakumar et al. 2014
Raorchestes akroparallagi CESF 061 JX092650 Western Ghats, India Vijayakumar et al. 2014
Outgroup
Philautus abditus ROM 33145 GQ285673 Krong Pa, Gia Lai, Vietnam Li et al. 2009

Results

The final DNA sequence dataset is consisted of 59 sequences and the length of the sequence alignment is 542 base pairs (bp) (Table 3), of which 194 sites are variable and 135 are parsimony informative. The BI and ML trees had almost identical topologies (Fig. 3). The samples from Malipo County, Yunnan Province form a monophyletic group and the sample from Pac Ban, Tuyen Quang (northern Vietnam) previously identified as R. gryllus was also nested in the clade with strong support (Fig. 3). Genetic distances between the samples from Malipo County and the other species of Raorchestes varied from 3.1% (R. longchuanensis) to 6.0% (R. huanglianshan) (Table 4).

Table 4.
Download as
CSV
XLSX

Uncorrected pairwise sequence divergence (%) among 16S ribosomal RNA mtDNA sequences, including R. malipoensis sp. nov., R. dulongensis, R. hillisi, R. longchuanensis, R. menglaensis, R. huanglianshan, R. cangyuanensis, R. parvulus, R. bombayensis, R. tuberohumerus, and R. ghatei as shown in phylogenetic tree presented in Fig. 3.

Species 1 2 3 4 5 6 7 8 9 10
R. malipoensis sp. nov.
R. bombayensis 4.5
R. tuberohumerus 4.8 2.0
R. ghatei 4.5 4.2 4.0
R. parvulus 5.9 5.1 5.9 5.4
R. cangyuanensis 5.7 6.6 6.8 5.6 7.1
R. longchuanensis 3.1 4.7 4.9 4.0 4.0 5.6
R. menglaensis 5.2 4.2 4.9 5.7 2.0 5.9 4.7
R. hillisi 4.3 4.9 5.2 4.3 61 6.3 4.2 5.4
R. huanglianshan 6.0 6.1 6.4 5.2 45 6.8 5.4 4.5 5.4
R. dulongensis 5.2 6.1 6.4 5.0 6.6 6.6 4.2 6.2 3.3 5.7
Figure 3. 

Phylogram of Raorchestes derived from analyses of concatenated DNA fragments of the mitochondrial 16S rRNA. Nodal support values with Bayesian posterior probability (BPP) > 0.95 / ML inferences (ML-BS) > 70 are shown near the respective nodes. A “-” denotes a Bayesian posterior probability < 0.95 and bootstrap support < 70. The scale bar represents 0.1 nucleotide substitutions per site.

Taxonomic account

Raorchestes malipoensis sp. nov.

https://zoobank.org/0DCF253A-45E1-4354-9C6B-AA44E7C6C309
Fig. 4, Table 1

“Pseudophilautus gryllus” (Li et al. 2009).

“Raorchestes gryllus” (Biju et al. 2010).

Holotype

GXNU 000339, adult male, collected from Malipo County, Yunnan Province (23.182°N, 104.78°E, elevation 1496 m) on 22 July 2020 by Shuo Liu.

Paratypes

SWFU 3110, SWFU 3113, SWFU 3114, SWFU 3116, GXNU 000338, GXNU 000341 (six adult males), SWFU 3111, SWFU 3112, GXNU 000340, GXNU 000342 (four adult females), collected at the same locality as the holotype on 22 July 2020 by Xiaolong Liu and Shuo Liu.

Diagnosis

The genus Raorchestes is a group of small frogs, diagnosed primarily on the basis of an adult snout-vent length between 15 and 45 mm; vomerine teeth absent; large gular pouch transparent while calling; nocturnally active; direct development without free-swimming tadpoles in all species for which the development is known (Biju et al. 2010). Although the mode of development in the new species remains unknown, R. malipoensis sp. nov. is placed in the genus Raorchestes due to the combination of following characters: small body size, vomerine teeth absent, single translucent external subgular vocal sac present, and tips of all fingers and toes expanded into discs with circum-marginal grooves. The new species is distinguished from geographically and molecularly relevant congeners by the following combination of characters: (1) very small body size (males SVL 14.6–17.7 mm, n = 7; females SVL 18.3–19.3 mm, n = 4); (2) head wider than long; (3) tympanum small, supratympanic fold distinct; (4) tips of all fingers and toes yellow; (5) webbing formula (I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V); (6) inner and outer metacarpal tubercle indistinct; (7) heels not meeting when limbs held at right angles to body; (8) tibiotarsal articulation reaching anterior border of eye when hindlimb is stretched alongside of body; (9) iris golden brown; (10) nuptial pad small and milky white; (11) inner metatarsal tubercle rounded, outer metatarsal tubercle absent; (12) fingers and toes having lateral dermal fringe; and (13) interorbital distance larger than eye horizontal diameter.

Description of the holotype

Adult male (Fig. 4), body size small (SVL 17.7 mm); head wider than long (HL 6.4 mm; HW 6.8 mm); top of head relatively flat; snout rounded in profile, projecting beyond lower jaw; snout length almost equal to interorbital distance at narrowest point (SL 2.6 mm; IOS 2.6 mm); the canthus rostralis rounded, loreal region slightly concave; tympanum small (TD 1.5 mm); internarial distance wider than maximum width of upper eyelid (INS 2.1 mm; UEW 1.3 mm); nostril slightly closer to tip of snout than to anterior corner of eyes; tongue pyriform, with a deep notch at posterior tip; vomerine teeth absent; pineal ocellus absent; eyes moderately large (EHD 2.6 mm) and protruding, pupil horizontal; supratympanic fold distinct, from posterior corner of eye to above insertion of arm.

Figure 4. 

Holotype (GXNU 000339) of Raorchestes malipoensis sp. nov. in life.

Forelimbs fairly robust (FAHL 8.2 mm); relative finger lengths: I < II < IV < III, tips of all four fingers expanded into discs with circum-marginal grooves; all fingers with lateral dermal fringes on both sides; subarticular tubercles distinct, rounded; supernumerary tubercles absent; no webbing between fingers; inner and outer metacarpal tubercle indistinct; nuptial pad is small and milky white on dorsal surface of the first finger.

Foot long and relatively robust (TFL 11 mm), longer than tibia length (TBL 8.8 mm); relative toe lengths: I < II < V < III < IV; tips of toes with discs having circum-marginal grooves, toe discs smaller than finger discs; all toes with lateral dermal fringes on both sides; subarticular tubercles distinct, rounded; supernumerary tubercles absent; webbing formula (I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V); inner metatarsal tubercle rounded, outer metatarsal tubercle absent.

Dorsal surfaces of head, body, forelimbs, thighs, and tibia rough with small granules; upper eyelid with several small granules; throat, chest, and ventral surfaces of forelimbs smooth; abdomen, ventral side of thigh, and area around vent with granules; dorsolateral folds absent.

Coloration of holotype in life

For coloration of the holotype in life see Fig. 4. Dorsal surface beige, with pale brown band between eyes; dorsal surface with a dark brown X-shaped marking; pale brown interorbital rectangle between eyes; upper and lower lips with white and black dots; supratympanic fold pale brown; iris golden brown; dorsal parts of arms and legs with dark brown crossbars that align; crotch with a distinct black patch bordering large creamy white plaque below the black patch near the groin; dorsal thigh beige with one brown crossbar when leg is bent in resting position; ventral surface body and beige, and area around vent with small black spots; discs of fingers and toes yellow.

Coloration in alcohol

After preservation in alcohol, the general pattern did not change. Dorsal color changed to grayish brown, the blotches or spots blackish brown, discs on the fingers become pale gray similar to the body color, ventral side become whiter (Fig. 5).

Figure 5. 

Holotype (GXNU 000339) of Raorchestes malipoensis sp. nov. in preservative, showing A dorsal view B ventral view C ventral view of hand D ventral view of foot.

Etymology

The specific epithet is named for the type locality, Malipo County, Yunnan Province, China. We suggest “Malipo Bush Frog” as its English common name, and “Ma Li Po Guan Shu Wa (麻栗坡灌树蛙)” as its Chinese common name.

Distribution

Currently known from the type locality, Malipo County (Fig. 1), Yunnan Province, China and Pac Ban, Tuyen Quang, in north of Vietnam.

Variation

The measurements are given in Table 1. GXNU 000338 has large black spots on dorsal side and GXNU000342 has distinctly darker ground color on dorsal side.

Comparisons

Rather than comparing R. malipoensis sp. nov. to all known Raorchestes, we focus on our morphological comparison with phylogenetically closely related taxa and species without genetic data in adjacent countries (Table 5).

Table 5.
Download as
CSV
XLSX

Comparison of R. malipoensis sp. nov. with phylogenetically closely related taxa or those with no genetic data in surrounding countries. “–” means unknown.

Species R. malipoensis sp. nov. R. menglaensis R. parvulus R. dulongensis R. hillisi R. huanglianshan R. cangyuanensis R. ghatei R. rezakhani R. annandalii R. bombayensis R. tuberohumerus R. longchuanensis R. andersoni
SVL of adult males (in mm) 14.6–17.7, n = 7 16.6–21.6, n = 14 – 15.0–19.0, n = 3 14.5–17.7, n = 3 17.0–19.6, n = 11 16.1–19.0 mm, n = 3 19.1–25.5, n = 9 18.8–19.0 mm, n = 4 – 30 mm, n = – 17.4–18.2 mm, n = 3 21.4–23.9 mm, n = 5 13.5–24.0 mm, n = 2
SVL of adult females (in mm) 18.3–19.3, n = 4 18.9–20.5, n = 2 23.6, n = 1 – 17.5, n = 1 21.5, n = 1 – 15.4–29.8, n = 13 – 17.0 mm, n = 1 – – –
SVL of adult (in mm) 14.6–19.3, n = 11 16.6–21.6, n = 18 23.6, n = 1 15.0–19.0, n = 3 14.5–17.7, n = 4 17.0–21.5, n = 4 16.1–19.0 mm, n = 3 15.4–29.8, n = 22 18.8–19.0 mm, n = 4 17.0 mm, n = 1 30 mm, n = – 17.4–18.2 mm, n = 3 21.4–23.9 mm, n = 5 13.5–24.0 mm, n = 2
IOS/EHD IOS > EHD, or IOS = EHD IOS > EHD IOS < EHD IOS < EHD IOS < EHD IOS > EHD, or IOS=EHD IOS < EHD – IOS < EHD IOS > EHD, or IOS = EHD – IOS > EHD, or IOS = EHD IOS > EHD IOS < EHD
HDW/HDL HDW > HDL HDW < HDL HDW > HDL HDW < HDL HDW < HDL HDW > HDL HDW > HDL HDW > HDL HDW > HDL HDW < HDL – HDW > HDL HDW ≈ HDL HDW > HDL
Tympanum Distinct Indistinct Distinct Distinct Distinct Distinct Indistinct Indistinct Indistinct Distinct Indistinct Indistinct Distinct Distinct
Nuptial pad Small and milky white white nuptial pad – Absent Present Present Reddish nuptial pad Absent Absent – – – Present –
Toe web I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V II 1 – 2 III 1 – 21/2 IV 21/2 – 1 V Webbing present, medium Rudimentary web II 1 – 2 III 1–21/2 IV 21/2 – 1 V II 1 – 2 III 1 – 2 – IV 2 – 1 V Rudimentary web I 2 – 2 II 2 – 2½ III 2 – 3 IV 2½ – 2 V I2 – 2 II 1¾ – 2 III 1½ – 3 IV 2¾ – 2 V Rudimentary web 1/3 webbing Rudimentary web 1/4 webbing 1/3 webbing
Lateral dermal fringe Present Absent – – Present Absent Present Present Absent Present – – – –
Disc color Yellow Not orange in life – Greyish or orange – Orange Orange – Reddish or whitish – – – Reddish, orange, or whitish orange
Inner metacarpal tubercle Indistinct Present Present Present Indistinct Indistinct – – Absent Present – – Present Present
Outer metacarpal tubercle Indistinct Present Present Present Indistinct Indistinct – – Absent Present – – Present Present
Inner metatarsal tubercle Round Present Present Round Round Round Round Round Absent Absent – Present Present Present
Outer metatarsal tubercle Absent Present Absent Absent Absent Absent Absent Absent Absent Absent – Absent Absent Absent
Relative toe lengths I < II < V < III < IV III ≈ V, or V > III I < II < V < III < IV I < II < V < III < IV I<II<III<V<IV I<II<III<V<IV I<II<V<III<IV I<II<V=III<IV I < II < V < III < IV I < II < V = III < IV – I < II ≤ V < III < IV III ≈ V I < II < III = V < IV
Range Malipo, Yunnan, China and the north of Vietnam Mengla, Yunnan, China Indochina Peninsula and peninsular Malaysia Gongshan, Yunnan, China Menghai, Yunnan, China Lvchun, Yunnan, China Cangyuan, Yunnan, China Western Ghats, India Northeastern Bangladesh Himalayas and northeastern India Western Ghats, India Western Ghats, India Yunnan, China and Lai Chau,Vietnam India, North Myanmar, Tibet and Yunnan, China

The new species differs from R. menglaensis by 1) tubercles absent along the outer side of the forearm and foot; (2) head wider than long; (3) tympanum distinct (TD 1.1–1.6 mm, n = 11); (4) webbing formula (I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V); (5) lateral dermal fringe present (6) inner and outer metacarpal tubercle indistinct; (7) outer metatarsal tubercle absent; and (8) relative toe lengths: I < II < V < III < IV (vs. a series of tubercles along the outer side of the forearm and foot; head length and head width are approximately the same; tympanum indistinct; webbing formula (II 1 – 2 III 1 – 21/2 IV 21/2–1 V); lateral dermal fringe present; inner and outer metatarsal tubercle present; outer metatarsal tubercle present; relative toe lengths: III ≈ V, or V > III).

The new species differs from R. parvulus by (1) smaller female body size (females 18.3–19.3 mm, n = 4); (2) interorbital distance larger than eye horizontal diameter; and (3) inner and outer metacarpal tubercle indistinct; (vs. female 23.6 mm, n = 1; interorbital distance smaller than eye horizontal diameter; inner and outer metacarpal tubercle present).

The new species differs from R. dulongensis by (1) head wider than long; (2) interorbital distance larger than eye horizontal diameter; (3) nuptial pad present; (4) yellow disc; and (5) inner and outer metacarpal tubercle indistinct (vs. head smaller than long; interorbital distance smaller than eye horizontal diameter; nuptial pad absent; greyish or orange disc; inner and outer metacarpal tubercle indistinct present).

The new species differs from R. hillisi by (1) larger female body size (females 18.3–19.3 mm, n = 4); (2) head wider than long; (3) interorbital distance larger than eye horizontal diameter; (4) webbing formula (I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V) ; and (5) and relative toe lengths: I < II < V < III < IV (vs. female 17.5 mm, n = 1; head longer than wider; interorbital distance smaller than eye horizontal diameter; webbing formula (II 1–2 III 1–21/2 IV 21/2–1 V); relative toe lengths: I < II < III < V <IV).

The new species differs from R. huanglianshan by (1) smaller female body size (females18.3–19.3 mm, n = 4); (2) lateral dermal fringe present; (3) yellow disc; (4) webbing formula (II 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V); and (5) relative toe lengths: I < II < V < III < IV (vs. female 21.5 mm, n = 1; lateral dermal fringe absent; orange disc; fingers and toes lacking lateral dermal fringe; webbing formula (II 1–2 III 1 – 2 – IV 2 – 1 V); relative toe lengths: I < II < III < V < IV).

The new species differs from R. cangyuanensis by (1) interorbital distance larger than eye horizontal diameter; (2) nuptial pad small and milky white; and (3) yellow discs (vs. interorbital distance smaller than eye horizontal diameter; reddish nuptial pad at the base of first finger; orange disc).

The new species differs from R. ghatei by (1) smaller body size (males 14.6–17.7 mm, n = 7; females18.3–19.3 mm, n = 4); (2) tympanum distinct (TD 1.1–1.6 mm, n = 11); (3) nuptial pad present; (4) webbing formula (I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V); and (5) relative toe lengths: I < II < V < III < IV (vs. males 19.1–25.5 mm, n = 9; females 15.4–29.8 mm, n = 13; tympanum indistinct; nuptial pad absent; webbing formula (I 2 – 2 II 2 – 2½ III 2– 3 IV 2½ – 2 V); relative toe lengths: I < II < V = III < IV).

The new species differs from R. rezakhani by (1) smaller male body size (males 14.6–17.7 mm, n = 7); (2) interorbital distance larger than eye horizontal diameter; (3) tympanum distinct (TD 1.1–1.6 mm, n = 11); (4) nuptial pad present; (5) lateral dermal fringe present; (6) yellow disc; (7) inner and outer metacarpal tubercle indistinct; (8) inner metatarsal tubercle round; and (9) webbing formula (I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V) (vs. males 18.8–19.0 mm; interorbital distance smaller than eye horizontal diameter; tympanum indistinct; nuptial pad absent; lateral dermal fringe absent; reddish or whitish; inner and outer metacarpal tubercle absent; inner metatarsal tubercle absent; webbing formula (I2 – 2 II 1¾ – 2 III 1½ – 3 IV 2¾ – 2 V).

The new species differs from R. annandalii by (1) head wider than long; and (2) relative toe lengths: I < II < V < III < IV (vs. head longer than wide; relative toe lengths: I < II < V = III < IV).

The new species differs from R. bombayensis by (1) smaller body size (males 14.6–17.7 mm, n = 7; females 18.3–19.3 mm, n = 4); (2) tympanum distinct (TD 1.1–1.6 mm, n = 11); and (3) webbing formula (I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V) (vs. 30 mm, n = 1; tympanum indistinct; 1/3 webbing between toes).

The new species differs from R. tuberohumerus by (1) tympanum distinct (TD 1.1–1.6 mm, n = 11); and (2) relative toe lengths: I < II < V < III < IV (vs. tympanum indistinct; relative toe lengths: I < II ≤ V < III < IV).

The new species differs from R. longchuanensis by (1) smaller male body size (males 14.6–17.7 mm, n = 7); (2) webbing formula (I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V); and (3) yellow disc (vs. males 21.4–23.9 mm, n = 5; 1/4 webbing between toes; reddish, orange, or whitish disc).

The new species differs from R. andersoni by (1) interorbital distance larger than eye horizontal diameter; (2) webbing formula (I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V); (3) yellow disc; and (4) relative toe lengths: I < II < V < III < IV (vs. interorbital distance smaller than eye horizontal diameter; 1/3 webbing between toes; orange disc; relative toe lengths: I < II < III = V < IV).

Discussion

Recently, Poyarkov et al. (2021) placed Philautus gryllus in the genus Kurixalus based on unpublished molecular evidence and a study of type materials. In this study, the sample previously identified as R. gryllus from northern Vietnam (voucher number: ROM 30288) nests in the clade of R. malipoensis sp. nov. without distinct genetic divergence (Table 4), indicating that they are likely conspecific (Table 4). Morphologically, Raorchestes malipoensis sp. nov. is obviously distinguishable from K. gryllus as described by Smith (1924; Table 6) by (1) smaller body size 14.6–19.3 mm, n = 11; (2) tympanum distinct (TD 1.1–1.6 mm, n = 11); (3) webbing formula (I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V); (4) no webbing between fingers; (5) outer metatarsal tubercle absent (vs. 25.0–27.0 mm, n = 3; tympanum distinct; toes a little more than half webbed; fingers free except for a rudiment of a web between the two outer; outer metatarsal tubercle separated for approximately two-thirds of their length). Therefore, we consider that Raorchestes malipoensis sp. nov. is not conspecific with K. gryllus and the record of R. gryllus (ROM 30288) from northern Vietnam should be revised to R. malipoensis sp. nov. We also suggest that the taxonomic status of other records of R. gryllus from Vietnam and Laos need further examinations.

Table 6.
Download as
CSV
XLSX

Morphological comparison between Raorchestes malipoensis sp. nov. and Kurixalus gryllus (Smith, 1924).

Character Species
Raorchestes malipoensis sp. nov. (n = 11) Kurixalus gryllus (n = 3)
SVL 14.6–19.3 mm 25.0–27.0 mm,
HL 5.2–7.9 mm 8.0–9.5 mm
HW 5.5–8.2 mm 10.0–11.0 mm
EHD 2.1–2.8 mm 3.0–3.5 mm
SL 1.8–2.9 mm 4–4.5 mm
HAL 4.2–5.6 mm 7.5–8.5 mm
TBL 7.5–9.2 mm 12–13 mm
TD 1.1–1.6 mm n = 11 tympanum indistinct
Tubercles along forearm and foot absent present
Web of toes I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V toes a little more than half webbed
Web of fingers no webbing between fingers fingers free except for a rudiment of a web between the two outer fingers
Metatarsal tubercle inner metatarsal tubercle rounded, outer metatarsal tubercle absent a small inner metatarsal tubercle
Coloration dorsal surface beige, with pale brown and dark brown spots, an individual having large black spots on its body surface dorsal color with pale or dark brown, green, yellow, or grey, many individuals had a bright green patch on the snout, and patches of similar color on the knees and round the vent

In recent years, many new species have been found along the border between China and Vietnam, such as Odorrana geminata (Bain et al., 2009), Tylototriton ziegleri (Nishikawa et al., 2013), Leptobrachella feii (Chen et al., 2020), Amolops shihaitaoi (Wang et al., 2022), and Theloderma hekouense (Du et al., 2022). Tropical montane forests in the border region between China and Vietnam are known to harbor a high level of species richness and local endemism (Sterling et al. 2006). One of the main reasons assumed to be responsible for this richness is the greater environmental heterogeneity observed in the montane regions as opposed to the lowland regions, allowing for a larger number of habitats to be occupied by species (Keller et al. 2009). It is expected that more new species from this region would be discovered, and further studies are required to accurately determine the species richness of tree frogs in China-Vietnam border region. Due to historical reasons, herpetological surveys of this region had been scarce, but considering the biogeographical interest of the region it is important to facilitate collaborative research to comprehensively understand herpetofaunal diversity, community composition, and species range limits around the region in order to better protect them and their environment in the face of global warming and habitat destruction.

Acknowledgements

We thank reviewers for their comments on the manuscript. This work was supported by grants from the National Natural Science Foundation of China (32060114), Guangxi Natural Science Foundation Project (2022GXNSFAA035526), Key Laboratory of Ecology of Rare and Endangered Species and Environmental Protection (Guangxi Normal University), Ministry of Education (ERESEP2022Z04), ang Guangxi Key Laboratory of Rare and Endangered Animal Ecology, Guangxi Normal University (19-A-01-06).

References

  • Al-Razi H, Maria M, Hasan S, Muzaffar SB (2020a) A new species of cryptic Bush frog (Anura, Rhacophoridae, Raorchestes) from northeastern Bangladesh. ZooKeys 927: 127–151. https://doi.org/10.3897/zookeys.927.48733
  • Al-Razi H, Maria M, Hasan S, Muzaffar SB (2020b) First record of Raorchestes longchuanensis Yang & Li, 1978 (Anura: Rhacophoridae) from northeastern Bangladesh suggests wide habitat tolerance. Amphibian & Reptile Conservation 14(1[: e225]): 119–131.
  • Anderson J (1878) Anatomical and zoological researches: Comprising an account of the zoological results of the two expeditions to Western Yunnan in 1868 and 1875. Vol 1. Bernard Quaritch, London, 703–860 + 969–975. [index] https://doi.org/10.5962/bhl.title.50434
  • Bain RH, Stuart BL, Nguyen TQ, Che J, Rao DQ (2009) A new Odorrana (Amphibia: Ranidae) from Vietnam and China. Copeia 2009(2): 348–362. https://doi.org/10.1643/CH-07-195
  • Biju SD, Bossuyt F (2009) Systematics and phylogeny of Philautus Gistel, 1848 (Anura, Rhacophoridae) in the Western Ghats of India, with descriptions of 12 new species. Zoological Journal of the Linnean Society 9(155): 374–444. https://doi.org/10.1111/j.1096-3642.2008.00466.x
  • Biju SD, Shouche Y, Dubois A, Dutta SK, Bossuyt F (2010) A ground-dwelling rhacophorid frog from the highest mountain peak of the Western Ghats of India. Current Science 98(8): 1119–1125.
  • Bossuyt F, Dubois A (2001) A review of the frog genus Philautus Gistel, 1848 (Amphibia, Anura, Ranidae, Rhacoporinae). Zeylonica 6: 1–112.
  • Boulenger GA (1893) Concluding report on the reptiles and batrachians obtained in Burma by Signor L. Fea dealing with the collection made in Pegu and the Karin Hills in 1887–88. Annali del Museo Civico di Storia Naturale di Genova Serie 2(13): 304–347.
  • Chan KO, Grismer LL, Brown RM (2018) Comprehensive multi-locus phylogeny of Old World tree frogs (Anura: Rhacophoridae) reveals taxonomic uncertainties and potential cases of over-and underestimation of species diversity. Molecular Phylogenetics and Evolution 127: 1010–1019. https://doi.org/10.1016/j.ympev.2018.07.005
  • Che J, Jiang K, Yan F, Zhang YP (2020) Amphibians and Reptiles in Tibet-Diversity and Evolution. Science Press, Beijing, 803 pp. [in Chinese]
  • Chen JM, Xu K, Poyarkov NA, Wang K, Yuan ZY, Hou M, Suwannapoom C, Wang J, Che J (2020) How little is known about “the little brown frogs”: description of three new species of the genus Leptobrachella (Anura: Megophryidae) from Yunnan Province, China. Zoological Research 41: 1–22. https://doi.org/10.24272/j.issn.2095-8137.2020.036
  • Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: More models, new heuristics and parallel computing. Nature Methods 9(8): 772. https://doi.org/10.1038/nmeth.2109
  • Fei L, Hu SQ, Ye CY, Huang YZ (2009) Fauna Sinica. Amphibia Vol. 2 Anura. Science Press, Beijing, 957 pp. [In Chinese]
  • Jiang K, Ren JL, Wang J, Guo JF, Wang Z, Liu YH, Jiang DC, Li JT (2020) Taxonomic revision of Raorchestes menglaensis (Kou, 1990) (Amphibia: Anura), with descriptions of two new species from Yunnan, China. Asian Herpetological Research 11(4): 263–281. https://doi.org/10.16373/j.cnki.ahr.200018
  • Keller A, Rödel MO, Linsenmair KD, Grafe TU (2009) The importance of environmental heterogeneity for species diversity and assemblage structure in Bornean stream frogs. Journal of Animal Ecology 78(2): 305–314. https://doi.org/10.1111/j.1365-2656.2008.01457.x
  • Kou ZT (1990) A new species of genus Philautus (Amphibia: Rhacophoridae) from Yunnan, China. In: From Water onto Land. China Forestry Press, Beijing, 210–212. [In Chinese]
  • Kuramoto M, Joshy SH (2003) Two new species of the genus Philautus (Anura: Rhacophoridae) from the Western Ghats, southwestern India. Current Herpetology 22(2): 51–60. https://doi.org/10.5358/hsj.22.51
  • Li JT, Che J, Murphy RW, Zhao H, Zhao EM, Rao DQ, Zhang YP (2009) New insights to the molecular phylogenetics and generic assessment in the Rhacophoridae (Amphibia: Anura) based on five nuclear and three mitochondrial genes, with comments on the evolution of reproduction. Molecular Phylogenetics and Evolution 53(2): 509–522. https://doi.org/10.1016/j.ympev.2009.06.023
  • Nishikawa K, Matsui M, Nguyen TT (2013) A new species of Tylototriton from northern Vietnam (Amphibia: Urodela: Salamandridae). Current Herpetology 32(1): 34–49. https://doi.org/10.5358/hsj.32.34
  • Padhye AD, Sayyed A, Jadhav A, Dahanukar N (2013) Raorchestes ghatei, a new species of shrub frog (Anura:Rhacophoridae) from the Western Ghats of Maharashtra, India. Journal of Threatened Taxa 5(15): 4913–4931. https://doi.org/10.11609/JoTT.o3702.4913-31
  • Palumbi SR, Martin AP, Romano SL, McMillan WO, Stice L, Grabowski G (1991) The Simple Fool’s Guide to PCR. Special Publications. Department of Zoology, University of Hawaii, Honolulu, Hawaii, USA, 94 pp.
  • Poyarkov NA, Nguyen TV, Popov ES, Geissler P, Pawangkhanant P, Thy N, Suwannapoom C, Orlov NL (2021) Recent progress in taxonomic studies, biogeographic analysis, and revised checklist of amphibians in Indochina. Russian Journal of Herpetology 28(3): 1–110. https://doi.org/10.30906/1026-2296-2021-28-3A-1-110
  • Priti H, Roshmi RS, Ramya B, Sudhira HS, Ravikanth G, Aravind NA, Gururaja KV (2016) Integrative taxonomic approach for describing a new cryptic species of Bush Frog (Raorchestes: Anura: Rhacophoridae) from the Western Ghats, India. PLoS ONE 11(3): e0149382. https://doi.org/10.1371/journal.pone.0149382
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large mod space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Seshadri KS, Gururaja KV, Aravind NA (2012) A new species of Raorchestes (Amphibia: Anura: Rhacophoridae) from mid-elevation evergreen forests of the south Western Ghats, India. Zootaxa 3410(1): 19–34. https://doi.org/10.11646/zootaxa.3410.1.2
  • Sterling EJ, Hurley MM, Le MD (2006) Vietnam: a natural history. Yale University, New Haven, 448 pp.
  • Subramanian KA, Dinesh KP, Radhakrishnan C (2013) Atlas of endemic amphibians of Western Ghats. Zoological Survey of India, Kolkata, 246 pp.
  • Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30(12): 2725–2729. https://doi.org/10.1093/molbev/mst197
  • Vijayakumar SP, Dinesh KP, Prabhu MV, Shanker K (2014) Lineage delimitation and description of nine new species of bush frogs (Anura: Raorchestes, Rhacophoridae) from the Western Ghats Escarpment. Zootaxa 3893(4): 451–488. https://doi.org/10.11646/zootaxa.3893.4.1
  • Wu YH, Suwannapoom C, Xu K, Chen JM, Jin JQ, Chen HM, Murphy RW, Che J (2019) A new species of the genus Raorchestes (Anura: Rhacophoridae) from Yunnan Province, China. Zoological Research 40(6): 558–563. https://doi.org/10.24272/j.issn.2095-8137.2019.066
  • Wu YH, Liu XL, Gao W, Wang YF, Li YC, Zhou WW, Yuan ZY, Che J (2021) Description of a new species of Bush frog (Anura: Rhacophoridae: Raorchestes) from northwestern Yunnan, China. Zootaxa 4941(2): 239–258. https://doi.org/10.11646/zootaxa.4941.2.5
  • Yan F, Liu XL, Zhang YP, Yuan ZY (2021) Direct development of the bush frog Raorchestes longchuanensis (Yang & Li, 1978) under laboratory conditions in Southern China. Journal of Natural History 55(1–2): 125–132. https://doi.org/10.1080/00222933.2021.1895349
  • Yang DT, Li SM (1978) In: Yang DT, Su CY, Li SM (Eds) Amphibians and Reptiles of Gaoligongshan, Kunming 8: 37–38. [In Chinese]
login to comment