Research Article
Print
Research Article
A new eyeless species of Nereis (Annelida, Nereididae) from deep-sea sediments of the northern South China Sea
expand article infoJun-Hui Lin‡, Ya-Qin Huang‡, Qian-Yong Liang§, Xue-Bao He‡
‡ Third Institute of Oceanography, Ministry of Natural Resources, Xiamen, China
§ Guangzhou Marine Geological Survey, China Geological Survey, Guangzhou, China

Corresponding author: Xue-Bao He ( hexuebao@tio.org.cn )

Academic editor: Christopher Glasby
© 2022 Jun-Hui Lin, Ya-Qin Huang, Qian-Yong Liang, Xue-Bao He.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Lin J-H, Huang Y-Q, Liang Q-Y, He X-B (2022) A new eyeless species of Nereis (Annelida, Nereididae) from deep-sea sediments of the northern South China Sea. ZooKeys 1134: 23-37. https://doi.org/10.3897/zookeys.1134.94198
ZooBank: urn:lsid:zoobank.org:pub:080F785C-D7E0-4514-96DA-908B2E06A934
Open Access

Abstract

A variety of nereidid species have been reported from the South China Sea, although little is known about the deep-sea species in this area. Recently, two specimens belonging to a novel nereidid polychaete were collected from a sedimentary habitat during an environmental survey to a deep-sea basin where cold seeps occur. This new species, Nereis tricirrata sp. nov., is described herein, based on morphological and molecular analyses. The most noteworthy feature is the absence of eyes on the prostomium; it can be distinguished from other eyeless Nereis species by the arrangement of conical paragnaths on the pharynx, the nature of homogomph falcigers and the shape of notopodial lobes in posterior chaetigers. The reconstructed phylogenetic tree, using concatenated sequences of mtCOI, 16S, and 18S rRNA, showed that all Nereis species included in this study form a monophyletic clade with full support. The mtCOI-based interspecific comparisons revealed a high genetic divergence (23.1%–37.3% K2P) from four-eyed Nereis species with the available sequences. This is the first record of an eyeless Nereis species in the South China Sea.

Keywords

Nereidiformia, phylogeny, polychaete, systematics, taxonomy

Introduction

Members of the annelid family Nereididae are commonly seen in marine and brackish benthic communities. The family is among the most diverse taxa groups, with 709 nominal species in 43 genera (Read and Fauchald 2021) distributed from the intertidal to the abyss (Wilson 2000). Nereidids are well represented in the deep sea at depths greater than 2000 m (Paterson et al. 2009). To date, a large number of deep-sea nereidid species have been recorded in previous surveys conducted in areas off New England to Bermuda (Hartman and Fauchald 1971), off western Mexico, east Pacific (Fauchald 1972), off the Japanese Pacific (Imajima 2009), and in the vicinity of eastern Pacific vents (Blake 1985; Blake and Hilbig 1990). Interestingly, some of these species lack eyes on the prostomium or have a sunken depression in place where the eyes usually occur (Blake 1985). These eyeless species have been assigned to a variety of nereidid genera, such as Ceratocephale (Hutchings and Reid 1990; Böggemann 2009), Micronereides (Day 1963), Neanthes (Kirkegaard 1995; Shimabukuro et al. 2017), Nereis (Fauchald 1972; Blake 1985; Blake and Hilbig 1990; Imajima 2009), Nicon (Fauchald 1972), Rullierinereis (Böggemann 2009; Imajima 2009), Tambalagamia (Shen and Wu 1993), and Typhlonereis (Bakken 2003), with Nereis species being the richest in species number. Nereis Linnaeus, 1758, is the type genus of the family Nereididae with more than 300 described species around the world, characterized by the presence of conical paragnaths in both pharyngeal rings and homogomph falcigers in the posterior notopodia (Sun and Yang 2004).

The South China Sea (SCS) is the largest marginal sea in the western Pacific, a biogeographic region which harbors diverse marine fauna (Salazar-Vallejo et al. 2014). Quite a few polychaete species in the family Nereididae have been reported from this area (Gallardo 1968; Sun and Yang 2004). Recently, Glasby et al. (2016) compiled a list of annelid species (excluding clitellates and siboglinids) from separate taxonomic publications and prepared a catalogue of polychaete fauna recorded in the South China Sea. In this species list, 1257 species in 73 families were reported from this area, with Nereididae being the most well-studied and diverse annelid family consisting of 134 species. These nereidid species are mostly recorded from shallow water, whereas little is known about the deep-sea species in this area owing to the difficulty in collecting specimens.

During an environmental survey to a deep-sea basin of the northern South China Sea in 2019, where cold seeps occur, two interesting nereidid specimens without prostomial eyes were collected from a sedimentary habitat. In this study, they are described and illustrated as a new species, Nereis tricirrata sp. nov., based on morphological and molecular analyses. This is the first record of an eyeless Nereis species in the South China Sea.

Materials and methods

Field sampling

In June 2019, sediment samples were collected at two sites in a deep-sea basin of the northern South China Sea (Fig. 1) using a box sampler onboard the R/V ‘Haiyangdizhi 10’. Subsequently, the sediment samples were washed through a 0.25 mm sieve with chilled, filtered seawater (4 °C) on board. The fauna retained by the sieve were fixed in either 95% ethanol or 8% diluted formalin. One of these specimens was complete, but broken into two fragments. For the complete specimen, chaetigers of the posterior fragment were dissected in the field and then preserved in 95% ethanol. The anterior fragment and the remaining posterior fragment were preserved in 8% diluted formalin in seawater.

Figure 1. 

Map showing the two collection localities in the South China Sea.

Morphological observations

In the laboratory, the specimens were examined using a Leica MZ9.5 optical stereoscope and a Leica DM6B compound microscope. Several parapodia from anterior, middle, and posterior parts of the holotype were dissected and mounted on slides for observation. Light photographs were taken under a Leica M205A stereoscope, equipped with a DFC 550 digital camera. The shape of the chaetae was observed and photographed under a Leica compound microscope (DM6B). Plates were prepared using the software Adobe Photoshop CS5. The terminology of parapodial structures used in this study follows Bakken and Wilson (2005) and Villalobos-Guerrero and Bakken (2018). The type material examined in this study was deposited at the Third Institute of Oceanography, Ministry of Natural Resources, Xiamen, China (TIO, MNR).

Molecular analysis

The total genomic DNA was extracted from the ethanol-preserved tissue sample of the holotype using a Transgen Micro Genomic DNA EE 181 Kit (Transgen, Beijing, China), following the manufacturer’s protocol. Polymerase chain reactions (PCRs) were conducted to amplify partial sequences of mitochondrial (mtCOI, 16S) and nuclear (18S, H3) genes using primer sets as shown in Table 1. The PCR mixtures contained 10 μl of TakaRa 10× Ex Taq buffer, 8 μl of dNTP mixture (2.5 mM), 2 μl of each primer (10 μM), 0.5 μl of TakaRa Ex Taq (5 U/μl), and 4 μl of DNA template and deionized water was added to make up a final volume of 100 μl. The thermal cycling conditions were as follows: 95 °C/240s – (95 °C/45s – 42 °C/60s – 72 °C/80s) *35 cycles – 72 °C/420s for mtCOI and 16S; 95 °C/240s – (95 °C/45s – 45 °C/60s – 72 °C/80s) *35 cycles – 72 °C/420s for 18S1, 18S2, 18S3, H3. The resulting PCR products were checked using 1% agarose gel electrophoresis and the successful PCR products were purified using a Transgen Quick Gel Extraction EG 101 Kit (Transgen, Beijing, China), following the manufacturer’s protocol. Sequencing of the purified DNA samples was performed on an ABI 3730XL DNA Analyzer (Applied Biosystems) at Biosune Company (Xiamen, China). Obtained sequences (18S1, 18S2 and 18S3) were manually assembled into a consensus sequence using the software DNAMAN 8 (Lynnon Biosoft, Quebec, Canada), then checked for potential contamination using BLAST. Eventually, about 649 bp of COI, 437 bp of 16S, 1330 bp of 18S, and 308 bp of H3 were successfully amplified in this study.

Table 1.
Download as
CSV
XLSX

List of primer sets used for PCRs and sequencing in this study.

Gene Primer name Sequence (5' to 3') Reference
COI LCO 1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994)
HCO 2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994)
16S 16SarL CGCCTGTTTAACAAAAACAT Palumbi (1996)
16SbrH CCGGTCTGAACTCAGATCACGT Palumbi (1996)
H3 aF ATGGCTCGTACCAAGCAGAC Colgan et al. (1998)
aR ATATCCTTRGGCATRATRGTGAC Colgan et al. (1998)
18S1 F GCTGTATGTACTGTGAAACTGCG Song et al. (2018)
R GGAATTACCGCGGCTGCTGGCACC Song et al. (2018)
18S2 F GTTCGATTCCGGAGAGGGAGCCT Song et al. (2018)
R GTTTCGGCCTTGCGACTATACTT Song et al. (2018)
18S3 F ACTGCGAAAGCATTTGCCAAGAGT Song et al. (2018)
R CACCTACGGAAACCTTGTTACGAC Song et al. (2018)

For phylogenetic analyses, the sequences of related genera of Nereididae were downloaded from GenBank, as well as species from Hesionidae (sister to Nereididae as verified by Dahlgren et al. 2000) as outgroups (more detail see Appendix 1). Sequences for each gene were aligned, respectively, using MUSCLE (Edgar 2004) implemented in MEGA X (Kumar et al. 2018) for COI and MAFFT (Katoh et al. 2002) for 16S and 18S with default setting. The unaligned sequences and highly divergent regions were removed using Gblocks 0.91b (Castresana 2000). SequenceMatrix v. 1.7.8 (Vaidya et al. 2011) was used to achieve a concatenated sequence of the three genes. Phylogenetic analyses were performed using the maximum likelihood (ML) and Bayesian inference (BI) methods. The ML analysis on the concatenated sequence was conducted in raxmlGUI 1.5 beta (Silvestro and Michalak 2012) using the GTR+G+I model and 1000 thorough bootstrap pseudoreplicates. The BI analysis was performed using MrBayes v. 3.2.6 (Ronquist et al. 2012), with four Markov chains run for 10 million generations, sampled every 1000 generations. The first 25% of these were discarded as burn-in. The tree was edited using FigTree v. 1.4 (Rambaut 2012) and Adobe Photoshop CS5. Interspecific comparisons were made with aligned COI sequences of Nereis species available in GenBank, using the Kimura’s two-parameter (K2P) model (Kimura 1980) implemented in MEGA X.

Results

Systematics

Order Phyllodocida Dales, 1962

Family Nereididae de Blainville, 1818

Nereis Linnaeus, 1758

Type species

Nereis pelagica Linnaeus, 1758.

Generic diagnosis

(after Bakken and Wilson 2005; Bakken et al. 2018). Prostomium with entire anterior margin, one pair of antennae, one pair of biarticulated palps with conical palpostyles. Peristomium apodous, greater than length of chaetiger 1, with four pairs of tentacular cirri. Eyes present or absent. Conical paragnaths present on both maxillary and oral ring of pharynx. Notopodial dorsal ligule similar in size in anterior and posterior chaetigers or markedly reduced on posterior chaetigers. Notopodial prechaetal lobe present or absent, smaller than notopodial dorsal ligule on anterior chaetigers, usually reduced or absent posteriorly. Dorsal cirrus basally attached to notopodial dorsal ligule throughout all chaetigers, lacking basal cirrophore. Notoaciculae absent from chaetigers 1 and 2. Notochaetae: homogomph spinigers, homogomph falcigers present. Neurochaetae, dorsal fascicle: homogomph spinigers present, heterogomph falcigers on anterior chaetigers present or absent, on posterior chaetigers present. Neurochaetae, ventral fascicle: heterogomph spinigers present or absent, heterogomph falcigers present or absent.

Nereis tricirrata sp. nov.

https://zoobank.org/67AD5443-63CA-4E5E-9710-B81A4CF60349
Figs 2A–H, 3A–L, 4A–F

Material examined

Holotype : TIO-BTS-Poly-137, complete, northern South China Sea, (17°33'N, 111°9'E), 1766 m depth, coll. Jun-Hui Lin, 16 June 2019. Paratype: TIO-BTS-Poly-138, incomplete, northern South China Sea, (18°26'N, 112°26'E), 1157 m depth, coll. Jun-Hui Lin, 21 June 2019.

Sequences

OP292645, COI gene, 649 bp; OP292646, 16S gene, 437 bp; OP292647, 18S gene, 1330 bp; OP292648, histone H3, 308 bp; extracted from ethanol-preserved tissue of the holotype.

Diagnosis

The new species is characterized by: (1) absence of eyes on the prostomium; (2) possession of three anal cirri instead of two on the pygidium; (3) few paragnaths on both rings of the pharynx; (4) notopodial and neuropodial ligules acutely conical; and (5) homogomph falcigers in posterior notopodia with several coarse teeth.

Description

Holotype complete but broken into two fragments. Body tapering posteriorly. Anterior fragment 35.27 mm long for 44 chaetigers, remaining posterior fragment 7.28 mm long for 15 chaetigers (including regenerated segments), maximum width 2.1 mm (excluding parapodia) at chaetiger 7. Paratype incomplete, broken into three fragments with 45 chaetigers, 12 chaetigers and 7 chaetigers, respectively. Body in formalin light brown. Preserved specimens without pigmentation (Fig. 2A).

Figure 2. 

Nereis tricirrata sp. nov., holotype (TIO-BTS-Poly-137) A anterior fragment, lateral view B anterior end, dorsal view C posterior end, dorsal view, intersegmental grooves of regenerated segments have been outlined with white lines D–H right parapodia (chaetigers 1, 5, 20, 40, posterior end), posterior view. Scale bars: 1 mm (A–C); 0.5 mm (D–H).

Prostomium pentagonal and slightly longer than wide, with one pair of digitiform frontal antennae (Fig. 2B). One pair of biarticulated palps arising antero-laterally, palpophores cylindrical, palpostyles globular. Eyes absent (Fig. 2B).

Peristomium apodous, 1.5 times as long as chaetiger 1. Four pairs of tentacular cirri slender, distally tapered (Fig. 2B); postero-dorsal pair the longest, extending to chaetiger 3.

Pharynx dissected, with dark brown jaws, distally curved, each with 15 blunt teeth on cutting edge. Small conical paragnaths sparse on both rings, arranged as follows: Area I = 0; II = 4 cones in a row; III = 0; IV = 2; V = 0; VI = 1; VII-VII = 2.

First two chaetigers uniramous, remaining ones biramous. Uniramous chaetigers with acutely conical dorsal ligules, subequal in length and of similar shape to ventral ligule (Fig. 2D). Dorsal cirri slightly longer than dorsal ligules.

Notopodia of biramous chaetigers with dorsal and ventral ligules, without notopodial prechaetal lobes. Notopodial dorsal ligules acutely conical (Fig. 2E–H), gradually becoming reduced towards posterior end (Fig. 2F–H). Dorsal cirri slender and attached to base of dorsal ligule throughout, subequal in length to notopodial dorsal ligules in anterior parapodia (Fig. 2D), and markedly longer than dorsal ligules in middle and posterior parapodia (Fig. 2G, H). Notopodial ventral ligules acutely conical, subequal in length to dorsal ligules in anterior parapodia (Fig. 2E), and 1.5–2 times length of dorsal ligules in posterior parapodia (Fig. 2G, H).

Neuropodia of biramous chaetigers with neuroacicular ligules subtriangular, postchaetal lobes rounded (Fig. 2E–H). Neuropodial ventral ligules acutely conical (Fig. 2E), longer than neuroacicular ones, decreasing in size to posterior end (Fig. 2E–H). Ventral cirri attached to ventral edge of parapodia, conical in anterior parapodia, becoming slender and cirriform from middle parapodia (Fig. 2F–H). Ventral cirri shorter than neuropodial ventral ligules in most chaetigers, but longer in chaetigers near pygidium (Fig. 2H).

In anterior parapodia, notochaetae with four homogomph spinigers (Fig. 3A, D); neurochaetae homogomph spinigers and heterogomph falcigers in dorsal fascicles (Fig. 3B, C, E, F), heterogomph spinigers and falcigers in ventral fascicles (Fig. 3B, E). In mid-body, notochaetae with two homogomph spinigers and one homogomph falciger (Fig. 3G); neurochaetae as in anterior parapodia (Fig. 3H, I). In posterior parapodia, notochaetae with two homogomph falcigers (Fig. 3J); neurochaetae as in anterior parapodia (Fig. 3K, L). Neurochaetae decreasing gradually in number towards posterior end.

Figure 3. 

Nereis tricirrata sp. nov., holotype and paratype A chaetiger 5, notochaetae B, C chaetiger 5, neurochaetae D chaetiger 20, notochaetae E, F chaetiger 20, neurochaetae G chaetiger 40, notochaetae H, I chaetiger 40, neurochaetae J posterior end, notochaetae (from paratype, as blades of notochaetae missing in the posterior fragment of holotype) K, L posterior end, neurochaetae. Abbreviations: HoS, homogomph spiniger; HoF, homogomph falciger; HeS, heterogomph spiniger; HeF, heterogomph falciger; DoF, dorsal fascicle; VeF, ventral fascicle. Scale bars: 100 μm (A–L).

All spinigers with long blades finely serrated (Fig. 4A–C); blade of notopodial spinigers shorter, but thicker than neuropodial ones. Notopodial falcigers commencing between chaetigers 20–30 (chaetiger 24 in paratype), with straight, finely serrated, blunt-tipped blade in mid-body (Fig. 4D), but with coarse teeth on relatively short blade in posterior parapodia (Fig. 4F). Neuropodial falcigers with relatively long, serrated, and blunt-tipped blade (Fig. 4E).

Figure 4. 

A–E Nereis tricirrata sp. nov. holotype (TIO-BTS-Poly-137) and F paratype (TIO-BTS-Poly-138) A notochaetae, homogomph spiniger, chaetiger 40 B neurochaetae, homogomph spiniger, dorsal fascicle, chaetiger 5 C neurochaetae, heterogomph spiniger, ventral fascicle, chaetiger 40 D notochaetae, homogomph falciger, chaetiger 40 E neurochaetae, heterogomph falciger, dorsal fascicle, chaetiger 20 F notochaetae, homogomph falciger, posterior parapodia. Scale bars: 50 μm (A–F).

Posterior end with six or seven regenerated chaetigers (Fig. 2C), which are disproportionately smaller than normal chaetigers. Pygidium with three anal cirri, all filiform, one on mid-dorsal and one on each of the ventro-lateral sides (Fig. 2C).

Etymology

The specific epithet tricirrata is composed by the Latin prefix tri-, meaning three, and the Latin noun cirrus, and refers to the three anal cirri present on the pygidium, one on the mid-dorsal and one on each of the ventro-lateral sides.

Distribution

Currently only known from the deep-sea sedimentary habitat in the northern South China Sea.

Habitat

Deep-sea soft sediments characterized by foraminiferal ooze at depths between 1100 m and 1800 m.

Phylogenetic analysis

There are no identical sequence matches on GenBank for COI and 16S. The low 18S gene divergence (0–1.9% K2P) between Nereis tricirrata sp. nov. and other Nereis species revealed their close genetic relationship, including an eyeless species, Nereis sanderi Blake, 1985 (AM159579). The reconstructed phylogenetic tree (Fig. 5), using the maximum likelihood and Bayesian inference analyses, indicates that all Nereis species form a monophyletic clade with 100% nodal support and confirms the placement of Nereis tricirrata sp. nov. within the genus Nereis. Currently, limited sequences of eyeless Nereis species are available, which hinders a better understanding of the relationship among eyeless Nereis species. When comparing the new species to other described Nereis species with COI genes available in GenBank, the mtCOI-based genetic divergence (K2P) ranged from 23.1% to 37.3% (Table 2), which was comparable to that of previous studies on other nereidid genera, such as Alitta species (Villalobos-Guerrero and Carrera-Parra 2015), Neanthes species (Shimabukuro et al. 2017), and cryptic species of Nereis denhamensis (Glasby et al. 2013).

Table 2.
Download as
CSV
XLSX

The mtCOI-based genetic divergence (K2P) between described Nereis species with the available sequences.

Taxa Locality 1 2 3 4 5 6 7 8 9 10 11
1 N. multignatha MT712473 China
2 N. pelagica HQ023592 Canada 0.286
3 N. vexillosa HM473512 Canada 0.285 0.259
4 N. zonata HQ024404 Canada 0.262 0.238 0.284
5 N. denhamensis JX294511 Australia 0.313 0.336 0.302 0.335
6 N. falsa KR916890 Portugal 0.344 0.282 0.330 0.339 0.360
7 N. heterocirrata MN256589 China 0.291 0.263 0.304 0.317 0.309 0.343
8 N. eakini MN138408 USA 0.238 0.242 0.250 0.272 0.343 0.338 0.314
9 N. riisei JF293304 Colombia 0.304 0.294 0.312 0.262 0.351 0.313 0.291 0.324
10 N. heronensis JX392066 Australia 0.287 0.248 0.311 0.306 0.332 0.364 0.302 0.319 0.336
11 N. lizardensis JX392060 Australia 0.290 0.307 0.296 0.306 0.277 0.320 0.291 0.287 0.303 0.327
12 N. tricirrata sp. nov. OP292645 SCS 0.288 0.231 0.254 0.275 0.337 0.359 0.308 0.267 0.373 0.344 0.314
Figure 5. 

The maximum likelihood (ML) tree inferred from the concatenated sequences of three genes (mtCOI, 16S and 18S rRNA) with GenBank accession numbers. Bootstrap values and posterior probabilities values at nodes were calculated from the ML and Bayesian inference (BI) analyses, respectively. Only bootstrap values ≥ 50 and posterior probabilities ≥ 0.7 are shown. GenBank accession numbers in parenthesis are present in the order of COI, 16S, and 18S; missing markers are denoted by a dash (–).

Remarks

Nereis tricirrata sp. nov. is distinguished from most Nereis species around the world by the absence of eyes on the prostomium. With the new species in this study, seven other described Nereis species from the deep Pacific also lack prostomial eyes. Six of these species belong to a distinct group with greatly prolonged notopodia in the posterior parapodia, including N. profundi Kirkegaard, 1956, N. anoculis Hartman, 1960, N. anoculopsis Fauchald, 1972, N. sandersi Blake, 1985, N. piscesae Blake & Hilbig, 1990, and N. abyssa Imajima, 1990. Comparison of the two eyeless species bearing normal notopodia throughout the body showed that Nereis tricirrata sp. nov. differs from Nereis izukai Okuda, 1939 (Imajima 1996) from the Japanese Pacific in the arrangement of paragnaths on the pharynx and the nature of notopodial falcigers in the posterior parapodia. Nereis izukai possesses far denser paragnaths on the pharynx (Area I = 11; II = 52–56; III = ~ 70; IV = 50–60; V = 0; VI = 6–12; VII-VIII = ~ 62), and its notopodial falcigers lack coarse teeth on the cutting edge in the posterior parapodia. A not-formally-named Nereis species without prostomial eyes, labelled as Nereis sp. B, was recorded from off eastern Taiwan Island at depths of 2233–2551 m (Hsueh 2020). It was unclear whether Nereis sp. B possessed prolonged notopodia in the posterior parapodia as it was incomplete and lacked the posterior end. Despite this, Nereis sp. B is distinct from Nereis tricirrata sp. nov. in that the former possesses more paragnaths than the latter (Area I = 2; II = 21; III = 37; IV = 11–30; V = 0; VI = 5–7; VII-VIII = 74). Finally, it should be noted that the new species bears three slender anal cirri on the pygidium instead of two as usually occurs in nereidid species.

Acknowledgements

We are grateful to the captain and crew of the R/V ‘Haiyangdizhi 10’ for help in collecting the deep-sea samples during the cruise organized by the Guangzhou Marine Geological Survey (Guangzhou, China). We thank Drs Chris Glasby and Torkild Bakken for their valuable comments that improved the manuscript. This study was supported by the National Natural Science Foundation of China (42006127), the Marine Geological Survey Program of China Geological Survey (DD20221706), and the Scientific Research Foundation of Third Institute of Oceanography, MNR (2016043).

References

  • Abe H, Tanaka M, Ueno Y (2017) First report of the non-native freshwater nereidid polychaete Namalycastis hawaiiensis (Johnson, 1903) from a private goldfish aquarium in eastern Japan. Bioinvasions Records 6(3): 217–223. https://doi.org/10.3391/bir.2017.6.3.06
  • Bakken T, Glasby CJ, Santos CSG, Wilson RS (2018) Nereididae Blainville, 1818. In: Westheide W, Purschke G, Böggemann M (Eds) Handbook of Zoology Online. A Natural History of the Phyla of the Animal Kingdom. Annelida, Polychaetes. De Gruyter, Ösnabruck, 1–43.
  • Blake JA (1985) Polychaeta from the Vicinity of Deep-Sea Geothermal Vents in the Eastern Pacific. I. Euphrosinidae, Phyllodocidae, Hesionidae, Nereididae, Glyceridae, Dorvilleidae, Orbiniidae and Maldanidae. Bulletin of the Biological Society of Washington 6: 67–101.
  • Blake JA, Hilbig B (1990) Polychaeta from the vicinity of deep-sea hydrothermal vents in the eastern Pacific. 2. New species and records from the Juan de Fuca and Explorer Ridge systems. Pacific Science 44: 219–253.
  • Boore JL, Brown WM (2000) Mitochondrial genomes of Galathealinum, Helobdella, and Platynereis: sequence and gene arrangement comparisons indicate that Pogonophora is not a phylum and Annelida and Arthropoda are not sister taxa. Molecular Biology and Evolution 17(1): 87–106. https://doi.org/10.1093/oxfordjournals.molbev.a026241
  • Böggemann M (2009) Polychaetes (Annelida) of the abyssal SE Atlantic. Organisms, Diversity & Evolution 9: 251–428.
  • Colgan DJ, McLauchlan A, Wilson GDF, Livingston SP, Edgecombe GD, Macaranas J, Cassis G, Gray MR (1998) Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Australian Journal of Zoology 46(5): 419–437. https://doi.org/10.1071/ZO98048
  • Dahlgren TG, Lundberg J, Pleijel F, Sundberg P (2000) Morphological and molecular evidence of the phylogeny of Nereidiform polychaetes (Annelida). Journal of Zoological Systematics and Evolutionary Research 38(4): 249–253. https://doi.org/10.1046/j.1439-0469.2000.384150.x
  • Day JH (1963) The polychaete fauna of South Africa. Part 8: New species and records from grab samples and dredgings. Bulletin of the British Museum (Natural History). Zoology 10(7): 381–445. https://doi.org/10.5962/bhl.part.20530
  • Edgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32(5): 1792–1797. https://doi.org/10.1093/nar/gkh340
  • Fauchald K (1972) Benthic polychaetous annelids from deep water off western Mexico and adjacent areas in the eastern Pacific Ocean. Allan Hancock Monographs in Marine Biology 7: l–575.
  • Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3(5): 294–299.
  • Gallardo VA (1968) (erroneously dated 1967) Polychaeta from the Bay of Nha Trang, South Vietnam. In: Naga Report 4 Part 3: Scientific results of marine investigations of the South China Sea and the Gulf of Thailand 1959–1961. University of California Press, La Jolla, USA, 35–279.
  • Glasby CJ, Wei NV, Gibb KS (2013) Cryptic species of Nereididae (Annelida: Polychaeta) on Australian coral reefs. Invertebrate Systematics 27(3): 245–264. https://doi.org/10.1071/IS12031
  • Glasby CJ, Lee Y-L, Hsueh P-W (2016) Marine Annelida (excluding clitellates and siboglinids) from the South China Sea. The Raffles Bulletin of Zoology (Supplement 34): 178–234.
  • Hartman O, Fauchald K (1971) Deep-water benthic polychaetous annelids off New England to Bermuda and other North Atlantic Areas. Part II. Allan Hancock Monographs in Marine Biology 6: 1–327.
  • Hui JHL, Kortchagina N, Arendt D, Balavoine G, Ferrier DEK (2007) Duplication of the ribosomal gene cluster in the marine polychaete Platynereis dumerilii correlates with ITS polymorphism. Journal of the Marine Biological Association of the United Kingdom 87(2): 443–449. https://doi.org/10.1017/S002531540705566X
  • Hutchings P, Reid A (1990) The Nereididae (Polychaeta) from Australia – Gymnonereidinae sensu Fitzhugh, 1987: Australonereis, Ceratocephale, Dendronereides, Gymnonereis, Nicon, Olganereis and Websterinereis. Records of the Australian Museum 42(1): 69–100. https://doi.org/10.3853/j.0067-1975.42.1990.107
  • Imajima M (1996) Annelida Polychaeta. Biological Research, Tokyo, Japan, 530 pp. [in Japanese]
  • Imajima M (2009) Deep-sea Benthic polychaetes off Pacific Coast of the northern Honshu, Japan. In: Fujita T (Ed.) National Museum of Nature and Science Monographs 2009: Deep-sea fauna and pollutants off Pacific Coast of northern Japan. National Museum of Nature and Science, Tokyo, Japan, 39–192.
  • Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30(14): 3059–3066. https://doi.org/10.1093/nar/gkf436
  • Kim CB, Moon SY, Gelder SR, Kim W (1996) Phylogenetic relationships of annelids, molluscs, and arthropods evidenced from molecules and morphology. Journal of Molecular Evolution 43: 207–215. https://doi.org/10.1007/BF02338828
  • Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16(2): 111–120. https://doi.org/10.1007/BF01731581
  • Kirkegaard JB (1995) Bathyal and abyssal polychaetes (errant species). Galathea Report 17: 7–56.
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35(6): 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Magesh M, Kvist S, Glasby CJ (2012) Description and phylogeny of Namalycastis jaya sp. n. (Polychaeta, Nereididae, Namanereidinae) from the southwest coast of India. Zookeys 238: 31–43. https://doi.org/10.3897/zookeys.238.4014
  • Norlinder E, Nygren A, Wiklund H, Pleijel F (2012) Phylogeny of scale-worms (Aphroditiformia, Annelida), assessed from 18SrRNA, 28SrRNA, 16SrRNA, mitochondrial cytochrome c oxidase subunit I (COI), and morphology. Molecular Phylogenetics and Evolution 65(2): 490–500. https://doi.org/10.1016/j.ympev.2012.07.002
  • Palumbi SR (1996) Nucleic acids II: The polymerase chain reaction. In: Hillis DM, Moritz C, Mable BK (Eds) Molecular Systematics. Sinauer Associates, Sunderland, MA, 205–247.
  • Passamaneck Y, Halanych KM (2006) Lophotrochozoan phylogeny assessed with LSU and SSU data: Evidence of lophophorate polyphyly. Molecular Phylogenetics and Evolution 40(1): 20–28. https://doi.org/10.1016/j.ympev.2006.02.001
  • Paterson GLJ, Glover AG, Froján CRS, Whitaker A, Budaeva N, Chimonides J, Doner S (2009) A census of abyssal polychaetes. Deep-sea Research Part II 56(19–20): 1739–1746. https://doi.org/10.1016/j.dsr2.2009.05.018
  • Pleijel F, Rouse GW, Sundkvist T, Nygren A (2012) A partial revision of Gyptis (Gyptini, Ophiodrominae, Hesionidae, Aciculata, Annelida), with descriptions of a new tribe, a new genus and five new species. Zoological Journal of the Linnean Society 165: 471–494. https://doi.org/10.1111/j.1096-3642.2012.00819.x
  • Rambaut A (2012) FigTree v1.4. Molecular evolution, phylogenetics and epidemiology. University of Edinburgh, Institute of Evolutionary Biology, Edinburgh.
  • Reish DJ, Anderson FE, Horn KM, Hardege J (2014) Molecular Phylogenetics of the Neanthes acuminata (Annelida: Nereididae) Complex. Memoirs of Museum Victoria 71: 271–278. https://doi.org/10.24199/j.mmv.2014.71.20
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liang L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Ruta C, Nygren A, Rousset V, Sundberg P, Tillier A, Wiklund H, Pleijel F (2007) Phylogeny of Hesionidae (Aciculata, Polychaeta), assessed from morphology, 18S rDNA, 28S rDNA, 16S rDNA and COI. Zoologica Scripta 36: 99–107. https://doi.org/10.1111/j.1463-6409.2006.00255.x
  • Salazar-Vallejo SI, Carrera-Parra LF, Muir AI, de León-González JA, Piotrowski C, Sato M (2014) Polychaete species (Annelida) described from the Philippine and China Seas. Magnolia Press, Auckland, New Zealand, 68 pp.
  • Shen S, Wu B (1993) A new species of Tambalagamia (Polychaeta) from Nansha Islands in South China Sea. Oceanologia et Limnologia Sinica 24(6): 641–644. [in Chinese with English summary]
  • Shimabukuro M, Santos CSG, Alfaro-Lucas JM, Fujiwara Y, Sumida PYG (2017) A new eyeless species of Neanthes (Annelida: Nereididae) associated with a whale-fall community from the deep Southwest Atlantic Ocean. Deep-Sea Research Part II 146: 27–34. https://doi.org/10.1016/j.dsr2.2017.10.013
  • Song X, Gravili C, Ruthensteiner B, Lyu M, Wang J (2018) Incongruent cladistics reveal a new hydrozoan genus (Cnidaria: Sertularellidae) endemic to the eastern and western coasts of the North Pacific Ocean. Invertebrate Systematics 32(5): 1083–1101. https://doi.org/10.1071/IS17070
  • Sun R, Yang D (2004) Annelida. Polychaeta II. Nereidida (Nereimorpha). Nereididae, Syllidae, Hesionidae, Pilargidae, Nephtyidae. Science Press, Beijing, China, 520 pp. [in Chinese]
  • Tosuji H, Bastrop R, Götting M, Park T, Hong J-S, Sato M (2019) Worldwide molecular phylogeny of common estuarine polychaetes of the genus Hediste (Annelida: Nereididae), with special reference to interspecific common haplotypes found in southern Japan. Marine Biodiversity 49: 1385–1402. https://doi.org/10.1007/s12526-018-0917-2
  • Vaidya G, Lohman DJ, Meier R (2011) SequenceMatrix: Concatenation software for the fast assembly of multigene datasets with character set and codon information. Cladistics 27(2): 171–180. https://doi.org/10.1111/j.1096-0031.2010.00329.x
  • Villalobos-Guerrero TF, Bakken T (2018) Revision of the Alitta virens species complex (Annelida: Nereididae) from the North Pacific Ocean. Zootaxa 4483(2): 201–257. https://doi.org/10.11646/zootaxa.4483.2.1
  • Villalobos-Guerrero TF, Carrera-Parra LF (2015) Redescription of Alitta succinea (Leuckart, 1847) and reinstatement of A. acutifolia (Ehlers, 1901) n. comb. based upon morphological and molecular data (Polychaeta: Nereididae). Zootaxa 3919(1): 157–178. https://doi.org/10.11646/zootaxa.3919.1.7
  • Wilson RS (2000) Family Nereididae. In: Beesley PL, Ross GJB, Glasby CJ (Eds) Polychaetes and Allies: The Southern Synthesis. CSIRO Publishing, Melbourne, Australia, 138–141.
  • Won EJ, Rhee JS, Shin KH, Lee JS (2013) Complete mitochondrial genome of the marine polychaete, Perinereis nuntia (Polychaeta, Nereididae). Mitochondrial DNA 24(4): 342–343. https://doi.org/10.3109/19401736.2012.760082

Appendix 1

Table A1.
Download as
CSV
XLSX

DNA sequences with GenBank accession numbers used for the phylogenetic analysis; new sequences in bold.

Species Localities Voucher/isolate CO1 16S 18S References
Alitta succinea USA USNM: lZ: 1286800 KT959389 KT959483 AY210447* 18S from Passamaneck and Halanych 2006
Alitta virens UK (COI, 16S); France (18S) – OW028587 OW028587 Z83754* 18S from Kim et al. 1996
Ceratocephale abyssorum Abyssal SE Atlantic – GQ426683 GQ426618 GQ426585 Böggemann 2009
Ceratocephale loveni Sweden SMNH 83517 – DQ442614 DQ442616 Ruta et al. 2007
Dendronereis aestuarina India – KT964060 – KT900288 Direct submission
Hediste atoka Japan – LC323003 LC323039 LC323073 Tosuji et al. 2019
Hediste diadroma Japan – LC323012 LC323062 LC323646 Tosuji et al. 2019
Hediste diversicolor Japan – LC323076 LC323093 LC381864 Tosuji et al. 2019
Hediste japonica Japan – LC323024 LC323064 LC323647 Tosuji et al. 2019
Laeonereis culveri Brazil – MH264893 MH264663 MW826082 Direct submission
Namalycastis hawaiiensis Narashino, Japan isolate 35–1 LC213726 LC213728 LC213729 Abe et al. 2017
Namalycastis jaya Kerala, India AQJ3 JN790066 JX483869 JX483866 Magesh et al. 2012
Neanthes acuminata California, USA isolate RLF3 KJ539109 KJ538992 – Reish et al. 2014
Neanthes glandicincta Xiamen, China 497 KY094478 KY094478 – Lin et al. 2017
Nereis heterocirrata China – KC800626 KC833492 KC840694 Direct submission
Nereis pelagica Sweden SMNH118992; SMNH 75831 JN852947 AY340470 AY340438 Norlinder et al. 2012
Nereis tricirrata sp. nov. deep SCS TIO–BTS–Poly–137 OP292645 OP292646 OP292647 This study
Nereis vexillosa Alaska (COI); China (16S); Germany (18S) – MF121002 GU362677 DQ790083 Direct submission
Perinereis aibuhitensis China – KC800612 KC833486 KC840692 Direct submission
Perinereis brevicirris China – KC800630 KC833498 – Direct submission
Perinereis cultrifera China – KC800624 KC833495 – Direct submission
Perinereis nuntia Korea – JX644015 JX644015 – Won et al. 2013
Perinereis wilsoni China – KC800631 KC833497 KC840691 Direct submission
Platynereis dumerilii USA (COI & 16S); UK (18S) – AF178678 AF178678 EF117897 COI & 16S from Boore and Brown 2000; 18S Hui et al. 2007
Pseudonereis variegata China – KC800622 KC833493 KC840693 Direct submission
Gyptis pacifica Japan SIO–BIC A2516, A2517 JN631314 JN631322 JN631337 Pleijel et al. 2012
Gyptis brunnea California, USA FP collection JN631313 JN631323 JN631335 Pleijel et al. 2012
login to comment