Research Article |
|
Corresponding author: Kenji Saitoh ( ksaitoh@affrc.go.jp ) Academic editor: Devin Bloom
© 2016 Kenji Saitoh, Kentaro Shindo, Yasufumi Fujimoto, Kiyotaka Takahashi, Tetsuo Shimada.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Saitoh K, Shindo K, Fujimoto Y, Takahashi K, Shimada T (2016) Mitochondrial genotyping of an endangered bitterling Acheilognathus typus (Cyprinidae). ZooKeys 623: 131-141. https://doi.org/10.3897/zookeys.623.8981
|
Genotyping of endangered species is helpful for establishing and evaluating conservation strategies. Mitochondrial sequence data was analyzed from 541 individuals of a critically endangered fish, Acheilognathus typus from present-day range-wide localities to re-evaluate an in-progress restoration program around Lake Izunuma-Uchinuma, Miyagi, Japan. Acheilognathus typus showed low sequence diversity with only eight haplotypes and π and ĥ values of 0.59129 and 0.00118 respectively. Genetic data suggests A. typus is adapted to pulsed environments and prone to population flush and crash. Genotyping of populations in introduced localities revealed that their source is not from nearby localities.
Bottleneck, Cyprinidae , conservation genetics, fish, heteroplasmy, invasive alien species, restoration
Genotyping of endangered species offers opportunities for establishing conservation strategies, particularly for evaluating conservation unit (
Acheilognathus typus Bleeker, 1863 is a medium-sized bitterling endemic to eastern Honshu Island, Japan. It was a common freshwater fish in shallow lakes, ponds, lowland rivers, and streams several decades ago, but desperately declined after the World War II (
Collecting localities (1–12) and range contraction of Acheilognathus typus. Shaded areas are prefectures with past (light) and recent (dark) records. Major mountain ranges are indicated by Λ. Locality 4 contains two ponds, and 6 contains a creek and five ponds around Lake Izunuma-Uchinuma, close to each other respectively. K and T indicate locations of Lake Kasumigaura and Teganuma Lake where A. typus was abundant in the past.
In this report mitochondrial sequence data was analyzed from 541 individuals of A. typus from the present range-wide localities for re-evaluation of the restoration program. The dataset of this research is also helpful for conservation programs of this critically endangered fish.
The samples included fin-clips of 541 individuals from 18 localities collected from 2001 through 2011 (Table
| # | Locality | Number of individuals |
|---|---|---|
| 1 | Small pond near Kitaakita | 30 |
| 2 | Shiohiki Lagoon | 52 |
| 3 | Small pond near Nishisenboku | 37 |
| 4–1 | Shinzutsumi Pond in Yasumoto near Yokote | 49 |
| 4–2 | Pond near Yokote | 20 |
| 5 | Small pond in Yasawa near Hanamaki | 49 |
| 6–1 | Creek near Lake Izunuma-Uchinuma | 39 |
| 6–2 | Small pond #125 in Izunuma-Uchinuma catchment | 49 |
| 6–3 | Small pond #127 in Izunuma-Uchinuma catchment | 18 |
| 6–4 | Two neighboring small ponds #90 connected with a ditch in Izunuma-Uchinuma catchment | 6 |
| 6–5 | Pond #91 in Izunuma-Uchinuma catchment | 48 |
| 6–6 | Small pond H004 near Lake Izunuma-Uchinuma | 50 |
| 7 | Small pond near Kashimadai | 30 |
| 8 | Pond near Sendai | 4 |
| 9 | Creek near Soma | 42 |
| 10 | River near Iidate | 8 |
| 11 | Creek near Kodaka | 8 |
| 12 | Small pond near Inawashiro | 2 |
DNA was extracted using QuickGene DNA Tissue kit on QuickGene-810 (Kurabo, Neyagawa, Japan). PCR primers were L16019 on the L-strand (GCTACCAAAGCCAGAATTCTAA) (
Indices of nucleotide, haplotype, and population divergence were calculated with Arlequin v.3.5 (
Data for Acheilognathus typus showed low sequence diversity. Three individuals out of 541 in total, however, indicated heteroplasmic sequence traces from both strands with doubled fluorescence peak at one or two sites each (Suppl. material
There were ten variable sites, and eight haplotypes appeared (Hap1-8, Table
|
Nucleotide position Haplotype |
0 0 0 6 |
0 1 5 7 |
0 1 6 4 |
0 2 1 8 |
0 2 2 0 |
0 2 3 2 |
0 2 6 8 |
0 4 4 3 |
0 4 5 0 |
0 4 5 2 |
| Hap1* | T | G | T | A | T | T | G | T | T | A |
| Hap2 | T | G | T | A | T | T | G | C | T | A |
| Hap3 | T | A | T | A | T | T | G | T | T | A |
| Hap4 | T | G | T | A | T | T | A | T | T | A |
| Hap5 | C | G | T | A | T | T | G | T | T | A |
| Hap6 | T | G | T | G | T | T | G | T | T | A |
| Hap7 | T | G | T | A | T | C | G | T | T | A |
| Hap8 | T | G | C | A | C | T | G | T | G | T |
Interrelationships among localities (NJ tree) based on pairwise net nucleotide divergence indicated that introduced stocks (#6-5, 6-6, 8) are close to each other, distant from others and somewhere in between localities in Fukushima (#9, 10) and others (Fig.
The low sequence diversity represented by both π and ĥ values with a simple haplotype network even in the fast evolving control region (Fig.
| # \ Haplotype | Hap1 | Hap2 | Hap3 | Hap4 | Hap5 | Hap6 | Hap7 | Hap8 | D |
|---|---|---|---|---|---|---|---|---|---|
| 1 | 30 | n.a. | |||||||
| 2 | 52 | n.a. | |||||||
| 3 | 34 | 3 | -0.527 | ||||||
| 4-1 | 48 | 1 | -1.105 | ||||||
| 4-2 | 19 | 1* | -1.164 | ||||||
| 5 | 49 | n.a. | |||||||
| 6-1 | 22 | 7 | 10 | 0.887 | |||||
| 6-2 | 12* | 33 | 4* | 0.614 | |||||
| 6-3 | 6 | 12 | 1.166 | ||||||
| 6-4 | 6 | n.a. | |||||||
| 6-5 | 23 | 25 | 1.714 | ||||||
| 6-6 | 29 | 21 | 1.648 | ||||||
| 7 | 17 | 13 | 1.578 | ||||||
| 8 | 2 | 2 | 1.633 | ||||||
| 9 | 9 | 33 | 0.681 | ||||||
| 10 | 8 | n.a. | |||||||
| 11 | 8 | n.a. | |||||||
| 12 | 2 | n.a. | |||||||
| Overall | 366 | 52 | 14 | 92 | 13 | 1 | 1 | 2 | -1.246 |
| Overall (normalized) | 338 | 46 | 11 | 99 | 13 | 1 | 2 | 30 | -0.694 |
Acheilognathus typus is the sister species (
Acheilognathus typus actually showed population crash killing host mussels by excess spawning in a pond (
Fish species that experience frequent population flush and crash events need wider habitats that allow spatially various phases in environmental fluctuation. In such habitats, those fish species like A. typus will sustain as metapopulations in which constituent subpopulations temporarily work as source or sink, and vice versa. Lake Izunuma-Uchinuma (5 km2) of 20 years ago, Lake Kasumigaura (172 km2) of more than 30 years ago, and Teganuma Lake (4 km2) of 45 years ago were such good habitats for A. typus (Fig.
In Lake Izunuma-Uchinuma, invasion and establishment of largemouth bass have inhibited recovery of A. typus population (
Under this circumstance, a good practice for restoring A. typus population may be to propagate them at first in ponds where the bass is absent in the lake catchment. Propagated A. typus then hopefully flows out from the ponds to the lake. The anticipated outflow would be a natural experiment whether A. typus population could establish in the lake where a small stock of the bass still remains.
Re-established stock at locality #6-5 in the lake catchment, however, may be inconvenient for recovery of the past A. typus population in the lake. Haplotype composition of that stock is similar to those in Fukushima (#9, 10) (Fig.
Introduction of A. typus into the ponds #6-6 from #8 and then from #6-6 to #6-5 took place when population at #6-1 declined temporarily. At that time it was not possible to introduce A. typus from #6-1 which was the only known locality near Lake Isunuma-Uchinuma. Pond #8 was then selected for the source of pond #6-6 based on the unverified information that it was introduced from #6-1, but it was misleading.
A lesson from above is importance of intensive survey of habitats, both known and unknown, before introduction. Population at #6-1 recovered in 2011 (Table
KSa conceived this research. KSa analyzed data and drafted the manuscript. YF and TS conceived the entire project including this research and coordinated writing the manuscript. KSh, YF, and KT conducted field survey. All authors read, improved, and approved the manuscript. This research was financially supported by Research and Development Projects for Application in Promoting New Policy of Agriculture Forestry and Fisheries, Japan (#21062). Hideki Sugiyama (Akita Prefectural Institute of Fisheries) and Osamu Inaba (Minamisoma City Museum) helped in the collection of specimens from some localities. Takahiro Ohtsuka (Natl Res Inst Fish Sci) helped us for laboratory works. Michael H. Doosey provided invaluable comments for inprovement of this manuscript. We have no financial conflict of interests about contents of this publication. Introduction of Acheilognathus typus into ponds around Lake Izunuma-Uchinuma was done under the Restoration Project of Acheilognathus typus (2003-) by the Miyagi Prefectural Izunuma-Uchinuma Environmental Foundation.
Table S1, Figure S1
Data type: sample data
Explanation note: Table S1. Normalized haplotype composition of localities.
Figure S1. Sequence traces of both directions with double-peaked sites.