Research Article |
Corresponding author: Xia Wan ( wanxia@ahu.edu.cn ) Academic editor: Andrey Frolov
© 2022 Li Yang Zhou, Zhi Hong Zhan, Xue Li Zhu, Xia Wan.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Zhou LY, Zhan ZH, Zhu XL, Wan X (2022) Multilocus phylogeny and species delimitation suggest synonymies of two Lucanus Scopoli, 1763 (Coleoptera, Lucanidae) species names. ZooKeys 1135: 139-155. https://doi.org/10.3897/zookeys.1135.89257
|
Phylogenetic relationsships of four nominal Lucanus Scopoli, 1763 species, L. swinhoei Parry, 1874, L. continentalis Zilioli, 1998, L. liuyei Huang & Chen, 2010, and L. wuyishanensis Schenk, 1999, are assessed based on mitochondrial (16S rDNA, COI) and nuclear (28S rDNA, Wingless) genes. The genetic distance is 0.0072 between L. swinhoei and L. continentalis, and 0.0094 between L. wuyishanensis and L. liuyei. Three species-delimitation approaches (ABGD, PTP, and GMYC) consistently showed L. swinhoei + L. continentalis and L. wuyishanensis + L. liuyei as two MOTUs. A new synonymy, L. liuyei = L. wuyishanensis, is proposed. Synonymy of L. swinhoei over L. continentalis is confirmed.
genetic distance, Lucanidae, morphology, new synonymy, phylogenetic analysis, species delimitation
Morphological evidence suggests that the evolution and differences of the mandible of stag-beetles are closely related to environmental heterogeneity (
The genus Lucanus Scopoli, 1763 is recognized as the most typical representative of Lucanidae, and Lucanus species (and subspecies) are especially abundant in eastern regions of Asia (including China, India, Laos, Vietnam, and Myanmar), with the majority inhabiting southern China (
Lucanus wuyishanensis Schenk, 1999 and Lucanus liuyei Huang & Chen, 2010 are typical representatives of Lucanus. All collecting data indicate that L. wuyishanensis is mainly distributed in southeast China (Zhejiang, Jiangxi, Fujian). Its allied species, L. liuyei in south-central China (Guangxi, Guizhou, Hunan), is morphologically similar to L. wuyishanensis but has a different geographic distribution.
In addition, the taxonomic relationship between Lucanus swinhoei Parry, 1874 and Lucanus continentalis Zilioli, 1998 has long been controversial.
This study assesses the taxonomic relationships between the species pairs L. continentalis and L. swinhoei, and L. wuyishanensis and L. liuyei, by using multi-locus data, revisiting for the first time the relationships among these four species from a molecular phylogenetic perspective.
All specimens of Lucanus were netted or light-trap collected for this study and store in ethanol, including 54 samples of the ingroup (21 L. wuyishanensis collected from Zhejiang, Fujian, Jiangxi province; 17 L. liuyei from Guangxi, Guizhou, Hunan province; five L. swinhoei from Taiwan; 11 L. continentalis from Fujian and Zhejiang province), and 10 samples of the outgroup (one each of L. parryi Boileau, 1899, L simithii Parry, 1862, L. fryi Boileau, 1911, L. klapperichi Bomans, 1989, and six L. fujianensis Schenk, 2008). Voucher specimens and their extracted genomic DNA are deposited in the research collection at the Museum of Anhui University, China. (Suppl. material
The map with collection localities was generated using ArcGIS v. 10.3 (http://www.esri.com/sofware/arcgis) based on the geospatial data from the National Geomatics Center of China (Fig.
The specimens were preserved in 99.7% ethanol at −20 °C. Total genomic DNA was extracted from a small portion of the muscle using DNeasy Blood and Tissue Extraction kit according to the manufacturer’s recommendations. The primers used to amplify 28S rDNA and Wingless were adapted from
Gene | Primer | Sequence (5´–3´) | References |
---|---|---|---|
COI | LuCOIF1 | ATAATCATTGCTGTTCCAAC | Present study |
LuCOIR1 | TATCTATGTTCAGCRGGRGGT | Present study | |
16S rDNA | Lu16SF1 | CTCGAATTTTRGAGGGC | Present study |
Lu16SR1 | AATCCAACATCGAGGTC | Present study | |
28S rDNA | 28SDD | GGGACCCGTCTTGAAACAC |
|
28SFF | TTACACACTCCTTAGCGGAT |
|
|
Wing-less | Wg550F | ATGCGTCAGGARTGYAARTGYCAYGGYATGTC |
|
WgAbRZ | CACTTNACYTCRCARCACCARTG |
|
|
Wg578F WgAbR | TGCACNGTGAARACYTGCTGGATG ACYTCGCAGCACCARTGGAA |
|
PCR amplification reactions for the three loci (COI, 16S rDNA, 28S rDNA) were performed in a 25 μL volume containing 1 μL of each primer (forward and reverse) at 10 μM, 2 μL of template DNA solution, 12.5 μL of 2× EasyTaq SuperMix (+ dye), and 8.5 μL of sterile double-distilled water to make up the final volume of 25 μL. WG was amplified by nested PCR, first PCR containing 1 μL of each primer (forward and reverse) at 10 μM, 1 μL of template DNA solution, 7.5 μL of 2× EasyTaq SuperMix (+ dye), and 4.5 μL of sterile double-distilled water, and finally use the 1 μL first amplification product as a template, including 1 μL of each primer (forward and reverse) at 10 μM, 12.5 μL of 2× EasyTaq SuperMix (+ dye), and 9.5 μL of sterile double-distilled water. The polymerase chain reaction amplifications were performed under the following conditions: initial denaturation at 94 °C for 2 min, followed by 35–37 cycles of denaturation at 94 °C for 40 seconds, annealing at 52–60 °C for 50 seconds, and elongation at 70 °C for 1 min, and then a final extension step at 72 °C for 7 min, stored at 4 °C at room temperature. Amplifications were purified using Template DNA Amplify Kit (Ensure Biologicals).
Sequencing was performed using the ABI PRISM BigDye Terminator v. 3.1 Cycle Sequencing Kit (Life Technologies, USA), and cycle sequencing reactions were performed on ABI PRISM 3730xl automated sequencers (Life Technologies, USA) at Sangon Biotech Company, China. All sequences generated in this study were submitted to GenBank under accession numbers (Suppl. material
Sequences of forward and reverse strands were assembled using GENEIOUS PRIME 2019.1.1 (https://www.geneious.com) and then aligned using MEGA 11. Genetic divergences among taxa were estimated using MEGA 11 (
Phylogenetic inferences were conducted using four gene markers based on maximum likelihood inference (ML), and Bayesian inference (BI). The BI tree was implemented in MRBAYES 3.2.6 (
When defining species relationships by using molecular-set data, there are a variety of analytical approaches available. The Automatic Barcode Gap Discovery (ABGD) analysis was performed in this study for COI using a web interface (https://bioinfo.mnhn.fr/abi/public/abgd/abgdweb.html), which detects a gap in divergence distribution, which corresponds to differences between intraspecific and interspecific distances. When the gap exists, the process works well for species delimitation (
ABGD Automatic Barcode Gap Discovery;
BBP Bayesian posterior probability;
BI Bayesian inference;
GMYC General Mixed Yule Coalescent;
K2P distance, Kimura 2-parameter distance;
ML maximum likelihood;
MBL maximum likelihood bootstrap;
MOTU molecular operational taxonomic unit;
PCR Polymerase Chain Reaction;
PTP Poisson Tree Processes.
External morphological characteristics of two clades are compared in the table (Suppl. material
Lucanus wuyishanensis and L. liuyei differ slightly in body size, maintaining an overall range of 28–53 mm. Major males indicate the following features: mandible weekly incurved at basal 1/3, straight at the middle then strongly incurved at apical 1/4; the major inner mandibular tooth located 2/3 from the apical mandibular fork, sharp, triangular protruding forward and inflated on both sides, four separated small inner mandibular teeth attached below the major inner mandibular tooth, four or five unclear, minor inner mandibular teeth continuously located along the midlength of basal mandibles; four small inner mandibular teeth densely distributed between the major tooth and the apical fork. Medium-sized males indicate the following features: major inner mandibular tooth somewhat triangular, weekly inflated on both sides; more than four unclear, minor inner mandibular teeth continuously located along the midlength of basal mandibles, and more than four small inner mandibular teeth densely distributed between the major tooth and the apical fork. Minor males indicate the following features: major inner mandibular tooth weekly developed, single-point and not triangular; less than two separated small inner mandibular teeth attached below the major inner mandibular tooth; more than three unclear, minor inner mandibular teeth continuously located on 1/2 of basal mandible; more than two small inner mandibular teeth densely distributed between the major tooth and the apical fork.
A concentrated matrix with 2489 aligned positions for data was obtained comprising COI, 16S rDNA, 28S rDNA, and Wingless genes. The phylogenetic analyses using both BI and ML inferences recovered overall a consistent topology (Fig.
Phylogenetic inferences based on four genes (COI, 16S rDNA, Wingless, and 28S rDNA) by maximum-likelihood inference (MLI) and Bayesian inference (BI) with posterior probability. Both posterior probabilities of MLI (above/left of branch) and bootstrapping values of BI (below/right of branch) are shown at nodes.
Genetic distances (K2P-distances) were calculated for all taxa using COI genes (Table
L. liuyei | L. wuyishanensis | L. continentalis | L. swinhoei | L. fujianensis | L. klapperichi | L. fryi | L. smithii | L. parryi | |
---|---|---|---|---|---|---|---|---|---|
L. liuyei | |||||||||
L. wuyishanensis | 0.0094 | ||||||||
L. continentalis | 0.1949 | 0.1924 | |||||||
L. swinhoei | 0.1906 | 0.1872 | 0.0072 | ||||||
L. fujianensis | 0.2131 | 0.2142 | 0.1617 | 0.1592 | |||||
L. klapperichi | 0.1946 | 0.1977 | 0.1925 | 0.1872 | 0.1929 | ||||
L. fryi | 0.2067 | 0.2086 | 0.2321 | 0.2280 | 0.1885 | 0.1955 | |||
L. smithii | 0.2246 | 0.2245 | 0.2150 | 0.2176 | 0.2230 | 0.2434 | 0.1962 | ||
L. parryi | 0.2280 | 0.2306 | 0.2193 | 0.2164 | 0.2054 | 0.1840 | 0.1774 | 0.1987 |
Species delimitation is shown in Fig.
Lucanus swinhoei Parry, 1874: 370.
Lucanus continentalis
Zilioli, 1998: 145, synonymy by
China • 1 male; Zhejiang Province, Yunhe County; 18 Jul. 2019; ZH Zhan leg. • 3 males; same locality as for preceding; 5 Jul. 2021 • 3 males; Zhejiang Province, Baishanzu County; 23 Jul. 2015 • 2 males; Zhejiang Province, Longquan County; 6 Jul. 2019 • 1 male; Fujian Province, Shanghang County; 12 Jul. 2021; LY Zhou leg. 1 male; same locality as for preceding; 22 Jul. 2011; Q Zhang and YY Cao leg. • 2 males; Taiwan Island, Nantou County; 12 Jun. 2019; JZ Lin leg. • 2 males; same locality as for preceding; 6 Jun. 2020.
Males of L. swinhoei could be distinguished from related species by following characters: 1) mandibles incurved at basal 1/3, straight along the midlength and incurved apically; 2) apical teeth bifurcated; major mandibular tooth located at basal 1/3, triangular, not flat on both sides; 3) elytra metallic luster at disc and along the suture, reddish to brownish; less punctate and without any yellowish setae. The females of most species in Lucanus are not easy to distinguish due to their significant similarities in morphology. Typical female of L. swinhoei could be identified by the following subtle differences: elytra without a marked pubescence, metasternum not densely hairy and the canthi not markedly outside of the eyes.
China (Zhejiang, Fujian, Taiwan Island).
Lucanus wuyishanensis Schenk, 1999: 114.
Lucanus liuyei Huang & Chen, 2010: 93–94, syn. nov.
China • 2 males; Jiangxi Province, Pingxiang County; 15 Jun. 2017; ZH Zhan leg. • 4 males; Jiangxi Province, same locality as for preceding; 03 Jun. 2021; Q Qi leg. • 6 males; Zhejiang Province, Mount Longquanshan; 18 July. 2019. • 1 male; Fujian Province, Mount Wuyishan; 18 Jul. 2011. • 2 males; Fujian Province, Mount Wuyishan; 14 Jul. 2011; Q Zhang and YY Cao leg. • 4 males; Fujian Province, same locality as for preceding; 12 Jun. 2020; ZH Zhan leg. • 2 males; Fujian Province, same locality as for preceding; 20 Jun. 2021; ZL Zhou leg. • 1 male; Guangxi Province, Mount Maoershans; 20 Jul. 2011. • 3 males; same locality as for preceding; 20 Jul. 2017; Q Qi leg. • 2 male, 1 female; same locality as for preceding; 20 Jul. 2021; ZH Zhan leg. • 2 male, 2 female; Guizhou Province, Mount Fanjingshan; 20 Jun. 2017; ZH Zhan leg. • 2 males; same locality as for preceding; 08 Jul. 2015; LX Zhu leg. • 1 male; Hunan Province, Zhangjiajie County; 20 Jun. 2015 • 4 males; same locality as for preceding; 21 May 2019; ZH Zhan leg.
Males of L. wuyishanensis could be distinguished from related species by the following characters: 1) mandibles weekly incurved at basal 1/3, straight extending to the mid-length and strongly incurved at 1/4 anteriorly; 2) two separated, small, inner mandibular teeth attached below the major inner mandibular tooth; 2–4 small inner mandibular teeth densely distributed between the major tooth and the apical fork; 3) elytra reddish to brownish, usually bicolored with head and pronotum; oval, widest at the apical 1/4, strongly narrow at basal. Females of L. wuyishanensis are also similar in appearance to those of other Lucanus members. There are the following slight differences: dorsal surface covered with a vestiture of small and significant, yellowish-amber setae; head surface punctate heavily, mandible snout, strongly incurved anteriorly.
China (Sichuan, Guangxi, Guizhou, Fujian, Hunan, Jiangxi).
Phylogenetic inferences by applying ML and BI analyses showed consistent patterns, which show that the Lucanus klapperichi clade is sister to the clade (L. wuyishanensis + L. liuyei) (MLB = 94%, BPP = 1). Lucanus wuyishanensis and L. liuyei collected from different provinces were all clustered in a highly supported clade. The subclade L. swinhoei + L. continentalis is nested in the same clade (MLB = 100%, BPP = 1; Fig.
The genus Lucanus is susceptible to several pressures, such as habitat selection, sexual selection, and food resources, and only occurs in wooded alpine areas above 800 m with more demanding environmental conditions and tiny ecological niches (
All our results indicate that L. continentalis is a junior subjective synonym of L. swinhoei and that L. liuyei as a junior subjective synonym of L. wuyishanensis. It is also clear, that in case of closely related species of the genus, an integrative approach utilizing both morphological and molecular data should be used. Molecular data can provide insight into the status of the forms with weak morphological differences. It is especially important for Lucanus and majority of other stag beetles because molecular traits are not prone to allometric variability.
We express our heartfelt gratitude to the Insect Evolution Research Group at Anhui University, especially JiaoJiao Yuan, MiaoMiao Wang, and Yingying, for their valuable and insightful suggestions. This work was supported by research grants from the National Natural Science Foundation of China (no. 31872276 and 31572311).
A list of specimens’ voucher information and GenBank accession numbers used in this study
Data type: occurences, phylogenetic (excel document)
Explanation note: The table contains the name of the organism, the sample storage number, the location of the sample collection, latitude and longitude, and GenBank accession numbers.
Morphological comparisons between phylogenetic clades
Data type: morphological (word document)
The mean genetic distance among populations in each collection area (K2P-distances)
Data type: genetic distance (word document)
Explanation note: Interspecific pairwise comparison using K2P-distances based on COI among populations in each collection area.