Research Article
Print
Research Article
A new species of Otostigmus (Chilopoda, Scolopendromorpha, Scolopendridae) from China, with remarks on the phylogenetic relationships of Otostigmus politus Karsch, 1881
expand article infoTian-Yun Chen‡§, Chao Jiang§, Lu-Qi Huang§
‡ Guangdong Pharmaceutical University, Guangzhou, China
§ China Academy of Chinese Medical Sciences, Beijing, China

Corresponding author: Chao Jiang ( jiangchao0411@126.com )

Corresponding author: Lu-Qi Huang ( huangluqi01@126.com )

Academic editor: Marzio Zapparoli
© 2023 Tian-Yun Chen, Chao Jiang, Lu-Qi Huang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Chen T-Y, Jiang C, Huang L-Q (2023) A new species of Otostigmus (Chilopoda, Scolopendromorpha, Scolopendridae) from China, with remarks on the phylogenetic relationships of Otostigmus politus Karsch, 1881. ZooKeys 1168: 161-178. https://doi.org/10.3897/zookeys.1168.82750
ZooBank: urn:lsid:zoobank.org:pub:00DB3715-401F-41CC-AEB6-60EF8C1A065B
Open Access

Abstract

Through a combination of morphological and DNA data, a new scolopendrid centipede from southern and southwestern China was revealed: O. tricarinatus sp. nov. The species belong to the politus group but has three sharp tergal keels. Validation of phylogenetic status was performed through molecular analysis of the cytochrome c oxidase subunit I (COI), 16S rRNA, and 28S rRNA sequences from 16 Otostigmus species. Otostigmus tricarinatus sp. nov. was found to be two populations and varied in the number of spines on the ultimate prefemur, the sutures on a sternite, and a pore-free median longitudinal strip in the pore field. The Yunnan-Guizhou plateau population of O. tricarinatus sp. nov. was sister to the clade O. politus politus + O. politus yunnanensis + Guangxi population of O. tricarinatus sp. nov. with strong support from both BI (bayesian inference) and ML (maximum likelihood) analyses (PP = 1, BS = 97%).

Key words

Centipedes, key, phylogeny, politus species group, Yunnan-Guizhou plateau

Introduction

The largest genus in the subfamily Otostigminae (Pocock, 1891), Otostigmus Porat, 1876, has approximately 110 recognised species. Otostigmus is classified into three subgenera: O. (Otostigmus), O. (Parotostigmus) Pocock, 1896, and O. (Dactylotergitius) Verhoeff, 1937 (Schileyko et al. 2020). Lewis (2010) arranged the subgenus O. (Otostigmus) into nine species groups that were based on the following characteristics: the presence or absence of keels on tergites, the number of antennal articles, the number of antennal articles which lacked numerous setae, sternite tuberculation, the number of tarsal spurs on legs, the ultimate leg prefemur characteristics and the coxopleural process of leg-bearing segment 21 with or without a dorsal spine.

Eight species have been recorded in China (Lewis 2003; Song et al. 2005; Niu et al. 2021), all assigned to the subgenus Otostigmus. These species belong to four of the nine groups mentioned by Lewis (2010):

  1. the politus group (including O. p. politus Karsch, 1881; O. p. yunnanensis Lewis, 2003: antennae with 17 or 18 articles, 3 antennal articles glabrous, i.e., lacking numerous setae dorsally, the ultimate leg prefemur with one row of ventrolateral spines, the coxopleural process of leg-bearing segment 21 without a dorsal spine);
  2. the aculeatus group (O. aculeatus Haase, 1881: antennae with 17 articles, 3 antennal articles glabrous dorsally, the ultimate prefemur with two rows of ventrolateral spines, the coxopleural process of leg-bearing segment 21 without a dorsal spine);
  3. the rugulosus group (O. astenus Kohlrausch, 1881; O. martensi Lewis, 1992; O. beroni Lewis, 2001; O. lewisiSong et al., 2005; O. xizangensis (Niu et al. 2021): antennae with 18 articles, 2–2.75 antennal articles glabrous dorsally, coxopleural process of leg-bearing segment 21 with a dorsal spine);
  4. the scaber group (O. scaber Porat, 1876: antennae with 21 articles, 2–2.5 antennal articles glabrous dorsally, the ultimate prefemur with one rows of ventrolateral spines, coxopleural process of leg-bearing segment 21 with a dorsal spine).

In this study we describe a new species, Otostigmus tricarinatus sp. nov., which belongs to the politus group. The phylogenetic status of the new species was validated through the molecular analysis of cytochrome c oxidase subunit I (COI), 16S rRNA, and 28S rRNA sequences which were derived from 18 Otostigmus species.

Materials and methods

Species sampling and morphological examination

Material was collected from different provinces in China (Table 1, Fig. 2). These specimens were preserved in 75% ethanol, and genomic DNA was extracted from the leg tissue. An Olympus E–M10 II camera was used to capture live colour patterns. Holotypes and paratypes of the new species were maintained deposited at the Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, China (CMMI).

Table 1.
Download as
CSV
XLSX

Otostigmus species vouchers and GenBank accession numbers.

No. Species Voucher Locality CO1 16S 28S References
1 O. tricarinatus sp. nov. CMMI 20210315101 Pingbian, Yunnan, China OM791803 OM793128 – This study
2 O. tricarinatus sp. nov. CMMI 20200817001 Maguan, Yunnan, China OM791806 OM793131 OM793116 This study
3 O. tricarinatus sp. nov. CMMI 20220123101 Libo, Guizhou, China OM791804 OM793129 OM793114 This study
4 O. tricarinatus sp. nov. CMMI 20200712010 Guiping, Guangxi, China OM791805 OM793130 OM793115 This study
5 O. tricarinatus sp. nov. CMMI 20200712008 Guiping, Guangxi, China OM791807 OM793132 OM793117 This study
6 O. politus politus Karsch, 1881 CMMI 20211007101 Tianjing, China OM791808 OM793133 OM793118 This study
7 O. scaber Porat, 1876 CMMI 20190824012 Fuzhou, Fujian, China OM791809 OM793134 OM793119 This study
8 O. aculeatus Haase, 1887 CMMI 20190321002 Xiamen, Fujian, China OM791810 OM793135 OM793120 This study
9 O. politus yunnanensis Lewis, 2003 CMMI 20210315103 Pingbian, Yunnan, China OM791812 OM793137 OM793122 This study
10 O. politus yunnanensis Lewis, 2003 CMMI 20210318108 Yingpan, Yunnan, China OM791813 OM793138 OM793123 This study
11 O. beroni Lewis, 2001 CMMI 20180715101 Jilong, Xizang, China OM791814 OM793139 OM793124 This study
12 O. beroni Lewis, 2001 CMMI 20200504001 Jilong, Xizang, China OM791815 OM793140 OM793125 This study
13 O. voprosus Schileyko, 1992 CMMI 20191031008 Jingxiu, Guangxi, China OM791816 OM793141 OM793126 This study
14 O. voprosus Schileyko, 1992 CMMI 20200914002 Xishuangbanna, Yunnan, China OM791817 OM793142 OM793127 This study
15 O. nudus Pocock, 1890 CES091037 Kerala, Periyar, India JX531869 JX531739 JX531809 Joshi and Karanth 2012
16 O. sulcipes Verhoeff, 1937 CUMZ 00534 Phra Cave, Ban Namyen, Myanmar MF167805 MF167738 MF167872 Siriwut et al. 2018
17 O. sulcipes Verhoeff, 1937 CUMZ 00533 LaosChina borders, Luang Namtha, Laos MF167804 MF167737 MF167871 Siriwut et al. 2018
18 O. sulcipes Verhoeff, 1937 CUMZ 00532 Chiang Mai, Khrai, Thailand MF167803 MF167736 MF167870 Siriwut et al. 2018
19 O. spinosus Porat, 1876 CUMZ 00553 Khanom, Nakhon Si Thammarat, Thailand MF167785 MF167718 MF167852 Siriwut et al. 2018
20 O. spinosus Porat, 1876 CUMZ 00552 Thung Khai Botanical Garden, Yantakhao, Trang, Thailand MF167784 MF167717 MF167851 Siriwut et al. 2018
21 O. spinosus Porat, 1876 CMUZ 00232 Ban na ka som, Attapue, Laos MF167783 MF167716 MF167850 Siriwut et al. 2018
22 O. spinicaudus Newport, 1844 MCZ DNA104645 Kasserine District, Tunisia – KF676472 KF676370 Vahtera et al. 2013
23 O. scaber Porat, 1876 CUMZ 00530 Wat Ban Hu, Luang Phrabang, Laos MF167802 MF167735 MF167869 Siriwut et al. 2018
24 O. scaber Porat, 1876 CUMZ 00529 Ban Sop Hun, Mueang Ngoi, Luang Phrabang, Laos MF167801 MF167734 MF167868 Siriwut et al. 2018
25 O. rugulosus Porat, 1876 CUMZ 00537 Phu Phiang, Nan, Thailand MF167787 MF167720 MF167854 Siriwut et al. 2018
26 O. rugulosus Porat, 1876 CUMZ 00536 Sai Yok, Kanchanaburi, Thailand MF167786 MF167719 MF167853 Siriwut et al. 2018
27 O. rugulosus Porat, 1876 CUMZ 00535 Chum Ta Bong, Nakhon Sawan, Thailand MF167782 MF167715 MF167849 Siriwut et al. 2018
28 O. ruficeps Pocock, 1890 CES091342 Kollam, Kerala, India JX531901 JX531771 JX531822 Joshi and Karanth 2012
29 O. politus politus Karsch, 1881 MCZ DNA106768 Dengfeng, Henan, China KF676512 KF676470 KF676368 Vahtera et al. 2012
30 O. multidens Haase, 1887 CUMZ 00527 Pan Faen, Mae Taeng, Chiang Mai, Thailand MF167795 MF167728 MF167862 Siriwut et al. 2018
31 O. multidens Haase, 188 CUMZ 00526 Taphome Stone Castle, Siem Reap, Cambodia MF167793 MF167726 MF167860 Siriwut et al. 2018
32 O. multidens Haase, 188 CUMZ 00523 Gua I–Kan, Kelantan, Malaysia MF167779 MF167712 MF167846 Siriwut et al. 2018
33 O. multidens Haase, 188 MCZ DNA106502 Central Province, Papua New Guinea KF676511 KF676469 KF676367 Vahtera et al. 2013
34 O. astenus Kohlrausch,1878 CUMZ 00521 Ban Sop Laos, Huaphan, Laos MF167800 MF167733 MF167867 Siriwut et al. 2018
35 O. astenus Kohlrausch, 1878 CUMZ 00520 Tham Mi Ka Ram, Mae Taeng, Chiang Mai, Thailand MF167799 MF167732 MF167866 Siriwut et al. 2018
36 O. astenus Kohlrausch, 1878 MCZ DNA102463 Fiji/Vanuatu HM453312 HM453221 HQ402532 Vahtera et al. 2012
37 O. angusticeps Pocock, 1898 MCZ DNA106500 Finisterre Mountains, Papua New Guinea KF676509 – KF676365 Vahtera et al. 2013
38 O. aculeatus Haase, 1887 CUMZ 00519 Ban Pha Wong, Mueang Yommarat, Huaphan, Laos MF167797 MF167730 MF167864 Siriwut et al. 2018
39 O. aculeatus Haase, 1887 CUMZ 00518 Wat Phra–Ong Thom, Siam Riep, Cambodia MF167796 MF167729 MF167863 Joshi and Karanth 2012
40 O. caraibicus Kraepelin, 1903 MCZ DNA105633 Puerto Rico HQ402549 HQ402498 HQ402533 Vahtera et al. 2012
41 O. voprosus Schileyko, 1992 IEBR–Chi 033 Xuan Nha, Son La Province, Vietnam MN861168 – – Vu et al. 2020
42 O. voprosus Schileyko, 1992 IEBR–Chi 032 Thuong Tien, Vietnam MN861166 – – Vu et al. 2020
43 ‘O. amballae Chamberlin, 1913’ IEBR–Chi 036 Me Linh, Vietnam MN861140 – – Vu et al. 2020
44 ‘O. amballae Chamberlin, 1913’ IEBR–Chi 013 Ta Xu, Vietnam MN861139 – – Vu et al. 2020
45 O. angusticeps Pocock, 1898 IZ–130684 Finisterre Mountains, Papua New Guinea KF676509 – KF676365 Vahtera et al. 2013
46 R. lewisi Kurinjal, Kudremukh National Park, Chikkamagaluru district, India MK273239 MK273349 MK273461 Joshi and Edgecombe 2017
47 D. jangii CES08915 Kurinjal, Kudremukh National Park, Chikkamagaluru district, India JX531843 JX531713 JX531789 Joshi and Karanth 2012
48 R. lewisi CES08920 Tadoli, Kudremukh National Park, Chikkamagaluru district, India MK273240 MK273350 MK273462 Joshi and Edgecombe 2018
49 D. jangii CES08922 Tadoli, Kudremukh National Park, Chikkamagaluru district, India JX531845 JX531715 JX531791 Joshi and Karanth 2012
50 A. crotalus MCZ DNA100454 Swaziland AY288742 AY288720 HM453273 Vahtera et al. 2012
51 A. grandidieri MCZ DNA106771 Tanzania KF676514 KF676473 KF676371 Vahtera et al. 2013

The morphological terminology follows Bonato et al. (2010). The taxonomic characteristics were observed using an Olympus SZ16 stereomicroscope. Helicon Focus 6.7.1 was used to create a multi-focused montage of pictures. The ArcMap 10.7.1 software tool was used to produce the maps.

Abbreviations: VL = ventrolateral, VM = ventromedial, M = medial, DM = dorsomedial, CS = corner spine, T = tergite, TT = tergites, SS = sternites, spm = specimen, coll. = collector, LBS = leg bearing segment.

DNA extraction and fragment amplification

Legs from each specimen were used to extract genomic DNA by using a Promega Wizard SV Genomic DNA Purification Kit (Promega, USA). Polymerase chain reaction (PCR) was used to amplify the cytochrome c oxidase subunit I (COI), mitochondrial ribosomal gene 16S, and nuclear ribosomal DNA 28S fragments. Table 2 lists the PCR primers and programs used.

Table 2.
Download as
CSV
XLSX

Primers and programs of PCR.

Loci Primers Sequence 5’– 3’ Program Refences
CO1 LCO1490 GGTCAACAAATCATAAAGATATTGG 5 min at 95 °C; 38 cycles of 20s at 95 °C, 20s at 45 °C and 1 min at 72 °C; 3 min at 72 °C Folmer et al. 1994
Hcoutout GTAAATATATGRTGDGCTC
CO1 LCO1490 GGTCAACAAATCATAAAGATATTGG 2 min at 94 °C; 35 cycles of 15s at 95 °C, 40s at 45–47 °C and 15s at 72 °C; 10 min at 72 °C Folmer et al. 1994; Joshi and Karanth 2011
Hco2198 TAAACTTCAGGGTGACCAAAAAATCA
16S 16Sar CGCCTGTTTATCAAAAACAT 5 min at 95 °C; 35 cycles of 30s at 95 °C, 30s at 55 °C and 1 min at 72 °C; 3 min at 72 °C Xiong and Kocher 1991
16Sb CTCCGGTTTGAACTCAGATC
28S Chilo28SF1 AGCCCAAGTCCCCCTGACC 3 min at 95 °C; 35 cycles of 30s at 95 °C, 30s at 65 °C and 1 min at 72 °C; 3 min at 72 °C This study
Chilo28SR1 TATACTCAGGTCCGACGATCGATT
28S 28Sa GAC CCG TCT TGA AAC ACG GA 2 min at 94 °C; 35 cycles of 15s at 95 °C, 40s at 52 °C and 15s at 72 °C; 10 min at 72 °C Michael et al. 1997; Joshi and Karanth 2011
28Sb TCG GAA GGA ACC AGC TAC

Phylogenetic analysis and genetic distance

The genetic distance between Otostigmus species was calculated using the Kimura 2-parameter model in MEGA X (Kumar et al. 2018). The COI, 16S, and 28S DNA sequences obtained from this study, as well as previous phylogenetic studies acquired from GenBank (Siriwut et al. 2018; Vu et al. 2020; Joshi and Karanth 2012; Vahtera et al. 2012, 2013), were used as part of the phylogenetic analysis (Table 1). Three partitioned genes, COI, 16S, and 28S, were aligned in BIOEDIT 7.1.3.0 (11/4/2011) (Hall 1999), using the CLUSTAL W tool (Thompson et al. 1994). Bayesian inference (BI) and maximum likelihood (ML) methods were used in the construction of phylogenetic trees. Branch support was evaluated through standard statistical testing (bootstrap support and posterior probability). ML analysis was performed using the IQ-TREE 1.6.8 software tool (Nguyen et al. 2015) in the PHYLOSUITE 1.2.2 platform (Zhang et al. 2020) with 500,000 ultrafast bootstraps (Hoang et al. 2018). MODELFINDER (Kalyaanamoorthy et al. 2017) selected GTR+F+I+G4 as the preferred substitution model. Furthermore, MODELFINDER was used to evaluate the best-fit substitution models of BI, with GTR+F+I+G4 being selected as the optimal substitution model. MRBAYES 3.2.6 (Ronquist et al. 2012) was used to run Bayesian analyses. 10,000,000 generations were used, sampling every 1000 generations, and dividing 25% of the trees as burn-in. A split frequency of less than 0.01 was used to determine stationarity, and a consensus tree was constructed using the remaining trees.

Results

Order Scolopendromorpha Pocock, 1895

Family Scolopendridae Leach, 1814

Subfamily Otostigminae Kraepelin, 1903

Genus Otostigmus Porat, 1876

Subgenus Otostigmus Porat, 1876

Type species

Otostigmus carinatus Porat, 1876, by subsequent designation (Pocock 1891: 229).

Remarks

Lewis (2010) counted 58 species in the subgenus Otostigmus. Niu et al. (2021) described O. xizangensis from China; Vu et al. (2022) described O. consonensis Vu, 2022 from Vietnam; Liu et al. (2022) revalidated O. (O.) lewisi. The subgenus Otostigmus now comprises 62 species and is the largest subgenus in Otostigmus.

Otostigmus politus politus Karsch, 1881

Material examined

China: Beijing: Haidian District: Xiangshan Park, 1 spm, CMMI 20210403149, 39.9961°N, 116.1950°E, 370 m asl., 03 April 2021, coll. Tianyun Chen and Zhidong Wang, Fengtai District: 1 spm, CMMI 20190610002, 39.8380°N, 116.3760°E, 50 m asl., 10 June 2019, coll. Chao Jiang; Dongcheng District: Beimencang Hutong, 1 spm, CMMI 20190428001, 39.39°N, 116.42°E, 50 m asl., 28 April 2019, coll. Chao Jiang. Henan Province: Queshan County: 1 spm, CMMI 20210427101, 32.80°N, 114.02°E, 27 April 2021, coll. Jiong Chen. Hubei Province: Shiyan: Wudangshan Mountain, 1 spm, CMMI 20210416111, 32.4307°N, 111.0292°E, 670 m asl., 16 April 2021, coll. Tianyun Chen and Zhidong Wang; Jingmen: Dongbao District, Shengjingshan Mountain, 1 spm, CMMI 20210411115, 31.1215°N, 112.1365°E, 470 m asl., 11 April 2021, coll. Tianyun Chen and Zhidong Wang; Jingshan: Huzhua Mountain, 1 spm, CMMI 20210410114 31.0774°N, 112.8928°E, 200 m asl., 03 April 2021, coll. Tianyun Chen and Zhidong Wang, Kongshandong Cave, 1 spm, CMMI 20210409110, 30.9735°N, 113.0377°E, 190 m asl., 09 April 2021, coll. Tianyun Chen and Zhidong Wang; Xiangyang: Xiangzhou District, Lumensi National Forest Park, 1 spm, CMMI 20190330007, 31.9103°N, 112.2564°E, 130 m asl., 30 March 2019, coll. Chao Jiang. Jiangsu Province: Yancheng: Tinghu District, Yancheng National Rare Birds Nature Reserve, 1 spm, CMMI 20201107168, 33.6035°N, 120.5042°E, 0 m asl., 07 Nov. 2020, coll. Chao Jiang; Lianyungang: Haizhou District, 1 spm, CMMI 20201105125, 34.5988°N, 119.1703°E, 30 m asl., 05 Nov. 2020, coll. Zhidong Wang; Nanjing: Fangshan Mountain, 1 spm, CMMI 20200825106, 31.8953°N, 118.8760°E, 120 m asl., 26 Aug. 2020, coll. Chao Jiang. Shaanxi Province: Zhashui County, Dongshan Forest Park, 1 spm, CMMI 20200903111, 33.6811°N, 109.1090°E, 830 m asl., 03 Sept. 2020, coll. Chao Jiang; Xi’an: Xi’an Qinling Wildlife Park, 1 spm, CMMI 20191002005, 34.0493°N, 108.8627°E, 10 October 2019, coll. Chao Jiang, Yanta District: Qingliang Mountain Forest Park, 1 spm, CMMI 20190906016, 34.1765°N, 108.9267°E, 420 m asl., 06 Sept. 2019, coll. Chao Jiang. Shandong Province: Yantai: Zhifu District: Nanhuansanli, 1 spm, CMMI 20190513004, 37.53°N, 121.41°E, 80 m asl., 13 May 2019, coll. Chao Jiang. Hebei Province: Yi County: Yishuihu Lake, 1 spm, CMMI 20190426001, 39.26°N, 115.22°E, 190 m asl., 26 April 2019, coll. Chao Jiang; Hengshui: Taocheng District, Qianjin Street, 1 spm, CMMI 20190923002, 37.7511°N, 115.6549°E, 10 m asl., 23 Sept. 2019 coll. Chao Jiang. Anhui Province: Huaibei: 1 spm, CMMI 20190418022, 33.9563°N, 116.7984°E, 18 April 2019, coll. Junduo Zhang. Liaoning Province: Chaoyang: Shuangta District: Fenghuangshan Mountain, 1 spm, CMMI 20210908101, 41.5604°N, 120.4787°E, 200 m asl., 08 Sept. 2019, coll. Chao Jiang; Dalian: 1 spm, CMMI 20190418024, 38.9140°N, 121.6148°E, 18 April 2019, coll. Junduo Zhang. Tianjin: Nankai District: Nancuiping Park, 1 spm, CMMI 20211007101, 39.0738°N, 117.1483°E, 0 m asl., 07 October 2021, coll. Chao Jiang. Gansu Province: Dingxi: 1 spm, CMMI 20220123104, 35.6080°N, 104.5923°E, 23 Jan. 2022, coll. Quanyu Ji.

Otostigmus politus yunnanensis Lewis, 2003

Material examined

China: Yunnan Province: Pingbian Miao Autonomous County: back mountain of Pingbian Memorial Park, 3 spms, CMMI20210315102–104, 22.9884°N, 103.6931°E, 1380 m asl., 15 March 2021, coll. Chao Jiang, Pingbian Railway Station, 2 spms, CMMI 20210601110 and CMMI 20210601112, 23.0167°N, 103.6353°E, 1010 m asl., 01 June 2021, coll. Chao Jiang; Jinping Miao, Yao & Dai Autonomous County: Yingpan township, 4 spms CMMI 20210318105–108, 22.8845°N, 102.9319°E, 1435.40 m asl., 18 March 2021, coll. Chao Jiang.

Otostigmus tricarinatus sp. nov.

https://zoobank.org/EE4ADEE9-2119-4729-87B0-AE4919CF6514
Figs 1B, D, 3, 4 Chinese name 三棱耳孔蜈蚣

Material examined

Holotype. CMMI 20210316103, China: Guangxi Zhuang Autonomous Region: Guiping: Xishan Town, 23.1147°N, 109.5947°E, 16 March 2021, coll. Mengxuan Shi.

Paratypes. 1 spm, CMMI 20210316161, same data as holotype; 4 spms CMMI 20200712008–011, same data as holotype, 12 July 2020; 1 spm, CMMI 20220327101, China: Guangxi Zhuang Autonomous Region: Nandan County, 27 March 2022, coll. Yongxiao Luo. 3 spms, CMMI 20220327102–104; Hezhou: Babu District, 24.3751°N, 111.9739°E, 27 March 2022, coll. Xusheng Zhou. Yunnan Province: Maguan county, 1 spm, CMMI 20200817001, 23.01°N, 104.39°E, 17 Aug. 2020, coll. Yanan Li. Pingbian Miao autonomous county, 1 spm, CMMI 20210315101, back mountain of Pingbian Memorial Park, 22.9884°N, 103.6931°E, 1380 m asl., 15 March 2021, coll. Chao Jiang. China: Guizhou Province: Libo County: Jiaou Township, 1 spm, CMMI 20220123101, 25.3017°N, 107.6708°E, 23 Jan. 2022, coll. Quanyu Ji.

Etymology

The name refers to the characteristics of the tergites. The tri- compounded with the Latin carinatus refers to the three sharp keels on the tergites.

Diagnosis

Antennae with 17 articles, basal three glabrous dorsally, the apical article with a well-developed lateral depression. TT 3–20 with three longitudinal keels. SS 2–19(20) with paramedian sutures occupying anterior 20–100% of sternites, a median depression, and two posterolateral depressions. Coxopleural process with 1–3 apical spines and none or one lateral spine, pore-free median longitudinal strip in pore field from the posterior of sternite 21 to the end of coxopleural process. The ultimate leg prefemur typically with 0–7 spines, lacking corner spine.

Figure 1. 

Live specimens of Otostigmus spp. from China A O. p. politus B O. tricarinatus sp. nov. (Guangxi population) C O. p. yunnanensis D O. tricarinatus sp. nov. (Yunnan-Guizhou plateau population).

Figure 2. 

Distribution of O. politus species, O. tricarinatus sp. nov., and O. amballae s.l. in China and Vietnam.

Holotype (CMMI 20210316103) description

Body length 26 mm. Antennae and anterior 1/2 of the cephalic plate, tergites and legs have blue colouration; posterior 1/2 of the cephalic plate, forcipule segment, and sternites have yellow colouration.

Antennae with 17 articles, 3 glabrous dorsally, 2.5 glabrous ventrally, apical article double the length of the penultimate, with a well-developed lateral depression (Fig. 3A). Antennae reach the posterior margin of T2 when reflexed. Forcipular coxosternite slightly wider than long and lacking sutures/sulci. Coxosternal tooth-plates wider than long, with four teeth. Trochanteroprefemoral process bears one apical and one lateral tubercle.

Figure 3. 

Otostigmus tricarinatus sp. nov. (Guangxi population) CMMI 20210316103 (HOLOTYPE) A cephalic plate (dorsal view) B forcipular segment and sternite 1 (ventral view) C Forcipular tooth-plates (ventral view) D SS 12–14 (ventral view) E TT 10–12 (dorsal view) F LBS 21 (ventral view) G LBS 21 (lateral view) H Prefemur of left ultimate leg. Scale bars: 1 mm.

T1 lacks sutures and convex granules, T2 has sparse convex granules, TT3–21 has scattered convex granules. Tergites without paramedian sutures, TT3–20 with three sharp longitudinal keels, T21 with three incomplete longitudinal keels. Lateral margination at TT3–21. SS2–20 with paramedian sutures occupying anterior 80–100% of sternites (Fig. 3D).

The left coxopleural process has one apical and one lateral spine and the right one has two apical and one lateral spine (Fig. 3F, G). Pore-free median longitudinal strip in pore field from the posterior of sternite 21 to the end of coxopleural process. The ultimate legs are long and slender, with the left prefemur having one ventrolateral and one ventromedial spine. Right prefemur with one ventrolateral spine, one ventromedial spine, and one dorsomedial spine. Ultimate leg relatively long with dense setae (Fig. 3H). Dorsal surface of ultimate prefemur with convex granules, lacking corner spine. Legs 1–5 with two and legs 6–20 with one tarsal spur. Legs 1 and 2 with one tibial spur: leg 1 with one prefemoral and one femoral spur.

Variation in paratypes

Body length 16–50 mm (maximum in CMMI 20220123101). Cephalic plate and T1(2) lacking sutures and convex granules, antennae reached posterior margin of T2–3. Antennae only display 2.5 articles that are glabrous dorsally in the specimen CMMI 20220123101.

Lateral margination at TT 2(3)-21. SS2–20 with paramedian sutures occupying anterior 20–100% of sternites. Coxopleural process with 1–3 apical spines, 0–1 lateral spine and lacking a dorsal spine. Ultimate leg prefemur with 0–7 spines: VL 0–1, M 0–3, VM 1–3, DM 1–2, lacking corner spine. Legs 1–3(4 or 5) typically with two tarsal spurs, subsequent legs to 20, with one tarsal spur.

Remarks

Schileyko (1995) described “O. amballae Chamberlin, 1913” on specimens from Vietnam. The morphology of these specimens is different from that of the holotype of O. amballae (see Lewis 2002) and were found to be identical to O. tricarinatus sp. nov. that has three well-developed longitudinal keels in TT3–20, a very short coxopleural process with no dorsal spine, an ultimate prefemur with two ventral spines, and lacking a corner spine. The holotype of O. amballae possesses a low median keel at TT3–20, paramedian sutures each in a sulcus from approximately T13, with two lateral keels on each side of sutures; the coxopleural process is moderately long with a single dorsal spine; the ultimate prefemur with VL3, M3, VM2, DM2, and one corner spine. Lewis (2002) further noted that all specimens assigned to O. amballae by Schileyko (1995) should be reassessed.

The material here assigned to O. tricarinatus sp. nov. refers to two geographically separate groups: the Yunnan-Guizhou plateau population (Fig. 4) and the Guangxi population (Fig. 3). They are different in the following characteristics: 1) 80% paramedian sutures on sternite in the former population compared to 20% paramedian sutures on sternite in the latter; 2) the ultimate leg prefemur with 4–7 spines in the former population compared to 1–4 spines in the latter; 3) the pore-free median longitudinal strip in pore field absent in the former population while found from the posterior of sternite 21 to the end of coxopleural process in the latter population. Furthermore, phylogenetic analysis revealed that Guangxi population is a sister group to O. politus congeners + Yunnan-Guizhou plateau population and has strong node support from both ML and BI analyses (PP = 1, BS = 97%). They are considered to be the same species because no more reliable identification characteristics could find.

Figure 4. 

Otostigmus tricarinatus sp. nov. (Yunnan-Guizhou plateau population) CMMI 20210315101 A cephalic plate (dorsal view) B forcipular segment and sternite 1 (ventral view) C Coxosternal tooth-plates (ventral view) D SS 3–5 (dorsal view) E Tergites 7–9 (ventral view) F Tergite 21 G Sternite 21 and coxopleural process (ventral view) H Prefemur of ultimate leg (ventral view); I Prefemur of ultimate leg (dorsal view). Scale bars: 1 mm.

Distribution

Fig. 2. China: Guangxi Zhuang autonomous region, Yunnan Province, Guizhou Province; Vietnam (Schileyko 1992, 1995, 2007; Vu et al. 2020).

Phylogenetic analysis

We obtained sequences consisting of 658–812 bp COI, 408–423 bp 16S rRNA, and 368–886 bp28S rRNA. The average K2P genetic distance is 20.1% between Otostigmus species, and the range of the K2P distance between Otostigmus species is 17.2% (O. voprosus against O. astenus to 23.1% (O. politus yunnanensis against O. beroni) (Table 3). The intraspecific divergence among Otostigmus taxa varied from 0% to 18.2% (O. aculeatus). The mean distance within O. tricarinatus sp. nov. was 16.0%(Table 4), which is relatively high among Otostigmus species. The interspecific divergence between O. tricarinatus sp. nov. and the other Otostigmus species fell within a range of 18.4% (O. spinosus) to 21.9% (O. angusticeps). The interspecific divergence between O. tricarinatus sp. nov. and O. politus yunnanensis (21.1%) was higher than O. tricarinatus sp. nov. and O. politus politus (19.3%). The high genetic distances found within the Otostigmus species imply that they may have been misidentified or contain cryptic species. Therefore, species delimitation of Otostigmus requires further study with additional samples as well as genetic data from various populations.

Table 3.
Download as
CSV
XLSX

Mean K2P genetic distance between the politus group, aculeatus group and rugulosus group species based on COI sequences.

(1) (2) (3) (4) (5) (6) (7) (8) (9)
O. angusticeps (1)
O. aculeatus (2) 22.2%
O. astenus (3) 18.3% 22.9%
O. beroni (4) 21.8% 23.9% 17.7%
O. politus politus (5) 21.1% 20.7% 20.5% 20.2%
O. politus yunnanensis (6) 22.5% 22.5% 21.8% 23.8% 18.5%
O. rugulosus (7) 22.7% 20.1% 20.1% 21.9% 20.0% 20.6%
O. spinosus (8) 19.6% 19.8% 19.3% 19.1% 18.9% 22.0% 18.8%
O. tricarinatus sp. nov. (9) 22.5% 22.4% 20.5% 21.8% 19.3% 21.1% 21.7% 19.0%
O. voprosus (10) 20.8% 22.9% 17.4% 17.5% 22.1% 21.9% 22.4% 20.0% 21.5%
Table 4.
Download as
CSV
XLSX

Mean K2P genetic distance within the politus group, aculeatus group and rugulosus group species based on COI sequences.

Examined species Mean distance Standard error
O. angusticeps – –
O. aculeatus 18.2% 1.5%
O. astenus 17.5% 1.3%
O. beroni 0.2% 0.1%
O. politus politus 8.4% 1.3%
O. politus yunnanensis 16.9% 1.7%
O. rugulosus 6.5% 0.9%
O. spinosus 15.1% 1.3%
O. tricarinatus sp. nov. 16.0% 1.1%
O. voprosus 15.4% 1.2%

Sequences from the new species, as well as 47 other Otostigminae samples from different species groups, were aligned. Included in the alignment were two COI sequences from samples IEBR–Chi 013 and IEBR–Chi 036 from Vietnam, which were misidentified as “O. amballae Chamberlin, 1913” (Vu et al. 2020). ML and BI analyses were utilised to construct phylogenetic trees for the combined COI+16S+28S dataset. Our results moderately supported the politus group, aculeatus group, and species of the rugulosus group, from both ML and BI analyses (BS > 70% and PP > 0.9) (Fig. 5). The reciprocally monophyletic politus group and aculeatus group were found to have moderate levels of support (PP = 1; BS = 71%). In this study, O. tricarinatus sp. nov. was assigned to the politus group. Otostigmus tricarinatus sp. nov. (Yunnan-Guizhou plateau population) and one sample from Vietnam: Me Linh (IEBR–Chi 013) was determined to be sister to O. politus politus and O. politus yunnanensis, with strong node support (PP = 1 and BS = 97%). Otostigmus tricarinatus sp. nov. (Guangxi population) together with one sample from Vietnam, Ta Xua (IEBR–Chi 036), was observed as having high levels of support for being sister to the clade of O. politus politus + O. politus yunnanensis + O. tricarinatus sp. nov. (Yunnan-Guizhou plateau population) in both BI and ML analyses (PP = 1, BS = 97%).

Figure 5. 

Maximum likelihood phylogenetic tree and Bayesian phylogenetic tree based on combined data for Otostigmus along with posterior probability (PP > 0.9 / BS > 70%) values for each node.

At last, the key for Otostigmus species in China is provided.

Key to species of the Otostigmus in China

1 The ultimate leg prefemur with two rows of ventrolateral spines O. aculeatus
– The ultimate leg prefemur with one row of ventrolateral spines 2
2 Antennae with 19–22 articles 3
– Antennae with 17 or 18 articles 5
3 Tooth-plates with 3+3 teeth; tergites without keels O. astenus
– Tooth-plates with 4+4 teeth; tergites with keels 4
4 TT5–20 with a median keel, coxopleural process curved in females O. xizangensis
– TT3(5)–20 with 7–9 longitudinal keels, coxopleural without curved in females O. scaber
5 Basal 3 antennal articles glabrous dorsally 6
– Basal 2–2.75 antennal articles glabrous dorsally 10
6 Tooth-plates with 3+3 teeth, coxopleural process with a dorsal spine O. voprosus
– Tooth-plates with 4+4 teeth coxopleural process without a dorsal spine 7
7 Ultimate prefemur with 9–16 spines; with corner spine 8
– Ultimate prefemur with 0–7 spines; without corner spine O. tricarinatus sp. nov.
8 Ultimate prefemur with 9–12 spines (3–4VL, 2–3VM, 2–3M, 1–1DM) O. politus politus
– Ultimate prefemur with 15–16 spines (5VL, 4–5VM, 4M, 2DM) O. politus yunnanensis
9 Coxopleural process with 1 apical spine O. martensi
– Coxopleural process with 2 apical spines 10
10 Legs 1–4 or 5 with tibial spur, 2 tarsal spurs on legs 1–16(19) O. beroni
– Legs 1–2 with tibial spur, the distribution of 2 tarsal spurs in legs without regularity O. lewisi

Discussion

Vu et al. (2020) employed a 638 bp COI loci for phylogenetic analysis of Vietnam Otostigmus centipedes and discovered that the “O. amballae” from Vietnam was not monophyletic. We made use of three loci, consisting of COI, 16S, and 28S rRNA, to construct a phylogenetic tree, and verified that the Vietnamese “O. amballae” specimens have sufficient support to form two clades: specimen IEBR–Chi 013 (Vietnam, Ta Xua) form a clade with Guangxi population of the newly discovered species O. tricarinatus sp. nov. and specimen IEBR–Chi 036 (Vietnam, Me Linh) forms another clade with O. tricarinatus sp. nov. (Yunnan-Guizhou plateau population). The morphological characteristics of O. tricarinatus sp. nov. is different from the holotype of O. amballae (Lewis 2002) in terms of keels on the tergite, a corner spine of the ultimate leg prefemur, and a dorsal spine in the coxopleural process. Combined with the phylogenetic results, we propose that all Vietnamese specimens previously assigned to O. amballae Chamberlin, 1913 must be referred to O. tricarinatus sp. nov.

The presence of three well-developed longitudinal keels on TT3–20 is the main morphological character that distinguishes O. tricarinatus sp. nov. from other Otostigmus (Otostigmus) species. The keels on tergites are a widespread morphological characteristic in Otostigminae Kraepelin, 1903, and may be found in the genera/subgenera Alipes, Edentistoma, Otostigmus (Parotostigmus) and O. (Otostigmus). Otostigmus scaber, O. rugulosus Porat, 1876, and O. amballae generally have tergal longitudinal keels (Schileyko 1995; Lewis 2002, 2010; Song et al. 2005). Otostigmus astenus Kohlrausch, 1878 (Lewis 2002), O. geophilinus Haase, 1887, O. cuneiventris Porat, 1893 (Lewis 2015) and O. angusticeps Pocock, 1898 (Lewis 2001, 2014) often have low tergal keels; O. politus politus (Beijing, Tianjin), O. politus yunnanensis (Yunnan) and O. reservatus Schileyko, 1995 (Hainan) have a low longitudinal median keel. The following characters distinguish the new species from O. scaber and O. rugulosus: antennal articles (17 in O. tricarinatus sp. nov. 20–21 in O. scaber, 19–21 in O. rugulosus); tergal paramedian sutures (without tergal paramedian sutures in O. tricarinatus sp. nov., TT5(6)–20 with paramedian sutures in O. scaber and TT4(5)–20 with tergal paramedian sutures in O. rugulosus); tergal longitudinal keels (T3–20 with 3 longitudinal keels in O. tricarinatus sp. nov., TT3(5)–20 with 5–7(9) longitudinal keels in O. scaber, low median ridge or keel from 3(5), low rounded lateral keels on posterior segments 7–17(10–14) in O. rugulosus); coxopleural process spines (O. tricarinatus sp. nov. without a dorsal spine, O. scaber and O. rugulosus with a dorsal spine); coxopleural pore-free median longitudinal strip in pore field (absent in Yunnan-Guizhou plateau population of O. tricarinatus sp. nov., extending 50–75% length in O. scaber, 100% length from the posterior of sternite 21 to the end of coxopleural process in Guangxi population of O. tricarinatus sp. nov. and O. rugulosus); legs with tarsal spines (1–3(4\5) with 2, the subsequent to 20 with 1 in O. tricarinatus sp. nov., 1–9(7\8\10\11) with 2, the subsequent to 19 or 20 with one in O. scaber, 1–11(up to 18) with 2, the subsequent to19 with 1 in O. rugulosus); corner spine (without corner spine in O. tricarinatus sp. nov., with corner spine in O. scaber and O. rugulosus). Table 5 presents the morphological characters of O. tricarinatus sp. nov., O. scaber, O. amballae, and O. rugulosus.

Table 5.
Download as
CSV
XLSX

Comparison of four species with keels (1 Schileyko 1995; 2 Lewis 2002; 3 Song et al. 2005; 4 Lewis 2010; 5 this study).

Characteristics O. scaber Porat, 1876 (1–3) O. tricarinatus sp. nov. (5) O. rugulosus Porat, 1876 (4) O. amballae Chamberlin, 1913 (2)
Length(mm) 14–69 16–50 32–43 38
Antennal articles 20–21 17 19–21 17
Basal antennal articles glabrous 2–2.5 3 dorsally, 2.5 ventrally 2–2.25(2.4) 2.5
Lateral depression on apical antennal article absent present absent present
Teeth on coxosternal tooth-plates 4–5 4 4 4
Teeth on the trochanteroprefemoral process 2–4 2 2 2
Tergite paramedian sutures from 5(6)–20 without 4(5) Complete from tergite 3
Tergite longitudinal keels 3(5)–20 with 5–7(9) longitudinal sutures T3–20 with 3 longitudinal keels low median ridge or keel from 3(5), low rounded lateral keels on posterior segments 7–17(10–14) A low median keel from 3–20, paramedian sutures forming two lateral keels on each side from ca. 13
Tergites marginate starting from 5–7 2 or 3 9(7) 6
Sternal paramedian sutures/sulci 3–19, incomplete sutures 4–19 with 20–80% sutures on anterior part of sternites 30–55% of mid and posterior sternites 55% on posterior sternites 2–20 with low tubercles, 14–20 with round median depression
Coxopleural process spines AP2–3, LP1–3, DP1 AP1–3, LP 0–1 AP2, SAP1–3 LP1, DP1 AP2, LAP1, DP1–2
pore-free median longitudinal strip in pore field extending 50–75% length from the posterior of sternite 21 to the end of coxopleural process from the posterior of sternite 21 to the end of coxopleural process from the posterior of sternite 21 to the end of coxopleural process from the posterior of sternite 21 to the end of coxopleural process
Legs with tarsal spurs 1–9(7, 8, 10, 11) with 2, the subsequent to 19 or 20 with one 1–3(4, 5) with 2, the remainder with 1, 21 without 1–11(up to 18) with 2, 20–21 without Many legs missing. Legs 1 and 2 with two tarsal spines, legs 10 and 13–20 with one
Spines of ultimate prefemur VL3–4(5), VM2–3, DM2–3 VL0–1, M0–3, VM0–3, DM0–2 3–4 rows of VL4, M0–3, M1–2, DM0–2 VL3, M3, VM2, DM2
Corner spine 1 0 1 1

Phylogenetic analysis revealed that O. tricarinatus sp. nov., O. politus politus, O. politus yunnanensis formed a clade constituting the politus group. Otostigmus politus politus and O. politus yunnanensis are reciprocally monophyletic and form a clade which is sister to O. tricarinatus sp. nov. (Yunnan-Guizhou plateau population). Furthermore, O. tricarinatus sp. nov. (Guangxi population) is a sister clade of O. tricarinatus sp. nov. (Yunnan-Guizhou plateau population), O. politus politus, and O. politus yunnanensis. However, O. politus politus, distributed in North China and Korea, is geographically isolated from other politus-group members. The records of O. politus politus from Vietnam with a long ultimate prefemur and spine arrangement were 5–6VL, 5 VM, and 3DM (Schileyko 2007), which resembles O. politus yunnanensis rather than O. politus politus.

Acknowledgements

We thank Shi Mengxuan (Henan University, China) and Ji Quanyu (Hebei University, China) for contributing specimens to this study. We also sincerely thank Drs Arkady A. Schileyko (Moscow Lomonosov State University, Russia) and Gregory D. Edgecombe (Natural History Museum, UK) for their valuable comments to improve the manuscript.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This work was supported by National Nat­ural Science Foundation of China (82073972) and the Fundamental Research Funds for the Central public welfare research institutes (ZZXT2021011). Col­lections were made under the permit of the Fourth National Survey Chinese Material Medical Resources.

Author contributions

Tianyun Chen, performed the experiment; contributed significantly to analysis and manuscript preparation; Chao Jiang, performed the data analyses and wrote the manuscript;

Luqi Huang, helped perform the analysis with constructive discussions.

Author ORCIDs

Tian-Yun Chen https://orcid.org/0000-0001-9761-0996

Chao Jiang https://orcid.org/0000-0003-1841-1169

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

References

  • Bonato L, Edgecombe GD, Lewis JGE, Minelli A, Pereira L, Shelley RM, Zapparoli M (2010) A common terminology for the external anatomy of centipedes (Chilopoda). ZooKeys 69: 17–51. https://doi.org/10.3897/zookeys.69.737
  • Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome C oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3(5): 294–299.
  • Hall T (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  • Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: Improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35(2): 518–522. https://doi.org/10.1093/molbev/msx281
  • Joshi J, Karanth KP (2011) Cretaceous–Tertiary diversification among select scolopendrid centipedes of South India. Molecular Phylogenetics and Evolution 60(3): 287–294. https://doi.org/10.1016/j.ympev.2011.04.024
  • Joshi J, Karanth KP (2012) Coalescent method in conjunction with niche modeling reveals cryptic diversity among centipedes in the Western Ghats of South India. PLoS ONE 7(8): e42225. https://doi.org/10.1371/journal.pone.0042225
  • Joshi J, Edgecombe GD (2017) Tracking the variability of phenotypic traits on a molecular phylogeny: an example from scolopendrid centipedes in peninsular India. Organisms, Diversity & Evolution 17: 393–408. https://doi.org/10.1007/s13127-017-0323-9
  • Kalyaanamoorthy S, Minh BQ, Wong TK, Von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. https://doi.org/10.1038/nmeth.4285
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35(6): 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Lewis JGE (2001) The scolopendrid centipedes in the collection of the National Museum of Natural History in Sofia (Chilopoda: Scolopendromorpha: Scolopendridae). Historia Naturalis Bulgarica 13: 5–51.
  • Lewis JGE (2002) A re-examination of 11 species of Otostigmus from the Indo–Australian region described by RV Chamberlin based on type specimens in the collection of the Museum of Comparative Zoology, Harvard (Chilopoda; Scolopendromorpha; Scolopendridae). Journal of Natural History 36(14): 1687–1706. https://doi.org/10.1080/00222930110067944
  • Lewis JGE (2003) On the identity of the various taxa that have been assigned to Otostigmus (O.) politus Karsch, 1881 and forms related thereto (Chilopoda: Scolopendromorpha). Arthropoda Selecta 12(3–4): 193–206.
  • Lewis JGE (2010) A revision of the rugulosus group of Otostigmus subgenus Otostigmus Porat, 1876 (Chilopoda: Scolopendromorpha: Scolopendridae). Zootaxa 2579(1): 1–29. https://doi.org/10.11646/zootaxa.2579.1.1
  • Lewis JGE (2014) A review of the orientalis group of the Otostigmus subgenus Otostigmus Porat, 1876 (Chilopoda: Scolopendromorpha: Scolopendridae). Zootaxa 3889(3): 388–413. https://doi.org/10.11646/zootaxa.3889.3.3
  • Lewis JGE (2015) On Verhoeff’s Otostigmus subgenus Malaccopleurus, the nudus group of Otostigmus subgenus Otostigmus Porat, 1876, and Digitipes Attems, 1930, with a description of the foetus stadium larva in O. sulcipes Verhoeff, 1937, (Chilopoda: Scolopendromorpha: Scolopendridae). Zootaxa 4039(2): 225–248. https://doi.org/10.11646/zootaxa.4039.2.2
  • Liu X, Li Y, Di Z (2022) The revalidation of Otostigmus (O.) lewisi Song et al., 2005 (Scolopendromorpha, Scolopendridae) based on new material from Jiacha County, China. ZooKeys 1088: 41–52. https://doi.org/10.3897/zookeys.1088.77703
  • Michael FW, James CC, Quentin DW, Ward CW (1997) The strepsiptera problem: phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology. Systematic Biology 46(1): 1–68. https://doi.org/10.1093/sysbio/46.1.1
  • Niu M, Li Y, Di Z (2021) Otostigmus (Otostigmus) xizangensis n. sp., from China and a case of sexual dimorphism in the subgenus Otostigmus (Otostigmus) Porat, 1876 (Chilopoda, Scolopendromorpha, Scolopendridae). Zootaxa 5081(2): 295–300. https://doi.org/10.11646/zootaxa.5081.2.8
  • Nguyen LT, Schmidt HA, Von HA, Minh BQ (2015) IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Pocock RI (1891) Notes on the synonymy of some species of Scolopendridae with descriptions of new genera and species of the group. Annals and Magazine of Natural History 7(6): 221–31. https://doi.org/10.1080/00222939109460598
  • Ronquist F, Teslenko M, Mark P, Ayres DL, Darling A, Höhna S, Larget L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Schileyko AA (1992) Scolopenders of Viet–Nam and some aspects of the system of Scolopendromorpha (Chilopoda Epimorpha). Part 1. Arthropoda Selecta 1(1): 5–19.
  • Schileyko AA (1995) The scolopendromorph centipedes of Vietnam (Chilopoda: Scolopendromorpha). Part 2. Arthropoda Selecta 4(2): 73–87.
  • Schileyko AA (2007) The scolopendromorph centipedes (Chilopoda) of Vietnam, with contributions to the faunas of Cambodia and Laos. Part 3. Arthropoda Selecta 16(2): 71–95.
  • Schileyko AA, Vahtera V, Edgecombe GD (2020) An overview of the extant genera and subgenera of the order Scolopendromorpha (Chilopoda): A new identification key and updated diagnoses. Zootaxa 4825(1): 1–64. https://doi.org/10.11646/zootaxa.4825.1.1
  • Song ZS, Gai YH, Song DX, Zhu MS (2005) On some centipede species of the genus Otostigmus from China (Scolopendromorpha: Scolopendridae). Journal of Hebei University 25(3): 295–304. [Natural Science Edition]
  • Siriwut W, Edgecombe GD, Sutcharit C, Tongkerd P, Panha S (2018) Systematic revision and phylogenetic reassessment of the centipede genera Rhysida Wood, 1862 and Alluropus Silvestri, 1912 (Chilopoda: Scolopendromorpha) in Southeast Asia, with further discussion of the subfamily Otostigminae. Invertebrate Systematics 32: 1005–1049. https://doi.org/10.1071/IS17081
  • Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position–specific gap penalties and weight matrix choice. Nucleic Acids Research 22(22): 4673–4680. https://doi.org/10.1093/nar/22.22.4673
  • Vahtera V, Edgecombe GD, Giribet G (2012) Evolution of blindness in scolopendromorph centipedes (Chilopoda: Scolopendromorpha): insight from an expanded sampling of molecular data. Cladistics 28(1): 4–20. https://doi.org/10.1111/j.1096-0031.2011.00361.x
  • Vahtera V, Edgecombe GD, Giribet G (2013) Phylogenetics of scolopendromorph centipedes: Can denser taxon sampling improve an artificial classification? Invertebrate Systematics 27(5): 578–602. https://doi.org/10.1071/IS13035
  • Vu HT, Nguyen HD, Eguchi K, Nguyen AD, Tran BTT (2020) A review and notes on the phylogenetic relationship of the centipede genus Otostigmus Porat, 1876 (Chilopoda: Scolopendromorpha: Scolopendridae) from Vietnam. Zootaxa 4808(3): 401–438. https://doi.org/10.11646/zootaxa.4808.3.1
  • Vu HT, Eguchi K, Le XS, Nguyen DA, Nguyen AD (2022) A new species and a new record of the genus Otostigmus Porat, 1876 (Chilopoda: Scolopendromorpha: Scolopendridae) in Vietnam. Zootaxa 5129(1): 60–76. https://doi.org/10.11646/zootaxa.5129.1.3
  • Bai X, Thomas DK (1991) Comparison of mitochondrial DNA sequences of seven morphospecies of black flies (Diptera: Simuliidae). Genome 34(2): 306–311. https://doi.org/10.1139/g91-050
  • Zhang D, Gao F, Jakovlić I, Zou H, Zhang J, Li WX, Wang GT (2020) PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources 20(1): 348–355. https://doi.org/10.1111/1755-0998.13096
login to comment