Research Article |
|
Corresponding author: Shinnosuke Teruya ( shi.teruya@gmail.com ) Academic editor: Edmund Gittenberger
© 2022 Shinnosuke Teruya, Davin H. E. Setiamarga, Tomoyuki Nakano, Takenori Sasaki.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Teruya S, Setiamarga DHE, Nakano T, Sasaki T (2022) Molecular phylogeny of Nipponacmea (Patellogastropoda, Lottiidae) from Japan: a re-evaluation of species taxonomy and morphological diagnosis. ZooKeys 1087: 163-198. https://doi.org/10.3897/zookeys.1087.78193
|
The patellogastropod limpet genus Nipponacmea is widely distributed in Japan and adjacent East Asia. Species identification within Nipponacmea is challenging due to the high variation in shell morphology. In this study, we examined the taxonomy of this genus represented by nine nominal species from 43 localities (including type localities). Results of the molecular phylogenetic analysis revealed that: (1) N. gloriosa, the sole species in this genus inhabiting the subtidal zone, represents the most basal independent branch; (2) the remaining species are divided into two large clades with lower- and higher-apex shell profiles; and (3) the high-apex morphology was derived from the low-apex type. The terminal clades defined using the molecular data were consistent with nine morphospecies and had 100% bootstrap values, strongly supporting the conventional taxonomy of Nipponacmea. Although morphological similarities do not always reflect phylogeny, the set of morphological characters used in the current taxonomy were proven to be adequate for diagnosis. In conclusion, this study provided solid evidence to uphold the monophyly of known species of Nipponacmea in Japan and demonstrated the usefulness of morphological characters for species diagnosis.
Lottiidae, morphology, Nipponacmea, phylogeny, taxonomy
Limpets belonging to the clade Patellogastropoda are abundant in the intertidal rocky shores globally and are important in marine biology (
Molecular phylogenetic analysis and comparison of morphological characters have previously been performed for limpets with ambiguous taxonomies (Lottia:
COI is used most frequently in molecular phylogenetic analyses at the population and species levels (
Species delineations have been completed by comparing shell morphology (
The genus Nipponacmea of the family Lottiidae is widely distributed in East Asia (
Molecular phylogenetic analyses of Nipponacmea have been undertaken by both
The purposes of this study were to: (1) assess the taxonomy of Nipponacmea species from Japan using an integrative approach, with distance-based and tree-based methods for molecular data, and testing the utility of morphological diagnostic characters using type specimens and sequenced specimens from type localities or adjacent regions; and (2) phylogenetically analyze the relationships among species.
We collected Nipponacmea samples from 43 localities on the Japanese coast (Fig.
List of localities. See also Fig.
| No. | Locality | Coordinates (Latitude, Longitude) |
|---|---|---|
| 1 | Omachi, Rumoi, Hokkaido | 43°56'45"N, 141°37'41"E |
| 2 | Shukutsu, Otaru, Hokkaido | 43°14'09"N, 141°00'57"E |
| 3 | Masadomari, Suttu, Hokkaido | 42°49'28"N, 140°11'15"E |
| 4 | Genna, Otobe, Hokkaido | 42°00'24"N, 140°06'15"E |
| 5 | Usujiri, Hokkaido | 41°56'11"N, 140°56'57"E |
| 6 | Hebiura, Kazamaura, Aomori Prefecture | 41°29'42"N, 140°58'55"E |
| 7 | Arito, Noheji, Aomori Prefecture | 40°54'25"N, 141°10'50"E |
| 8 | Tsuchiya, Hiranai, Aomori Prefecture | 40°54'13"N, 140°51'46"E |
| 9 | Togashiohama, Oga, Akita Prefecture | 39°56'40"N, 139°42'14"E |
| 10 | Kisakata, Nikaho, Akita Prefecture | 39°12'34"N, 139°53'34"E |
| 11 | Masakicho, Ofunato, Iwate Prefecture | 39°01'23"N, 141°42'36"E |
| 12 | Karakuwa, Ishinomaki, Miyagi Prefecture | 38°30'47"N, 141°28'45"E |
| 13 | Okinoshima, Tateyama, Chiba Prefecture | 34°59'27"N, 139°49'51"E |
| 14 | Mitsuishi, Manazuru, Kanagawa Prefecture | 35°08'25"N, 139°09'41"E |
| 15 | Irouzaki, Minamiizu, Shizuoka Prefecture | 34°36'47"N, 138°50'57"E |
| 16 | Futo, Nishiizu, Shizuoka Prefecture | 34°47'36"N, 138°45'26"E |
| 17 | Iwashigashima, Yaizu, Shizuoka Prefecture | 34°51'30"N, 138°19'40"E |
| 18 | Yutocho, Hamamatsu, Shizuoka Prefecture | 34°42'13"N, 137°36'48"E |
| 19 | Iragocho, Tahara, Aichi Prefecture | 34°34'56"N, 137°01'01"E |
| 20 | Shionomisaki, Kushimoto, Wakayama Prefecutre | 33°26'11"N, 135°45'23"E |
| 21 | Mio, Mihamacho, Wakayama Prefecture | 33°53'15"N, 135°04'31"E |
| 22 | Kada, Wakayama Prefecture | 34°16'21"N, 135°03'54"E |
| 23 | Oki, Tosashimizu, Kochi Prefecture | 32°51'00"N, 132°57'21"E |
| 24 | Ajiro, Ainancho, Ehime Prefecture | 33°02'00"N, 132°24'19"E |
| 25 | Ohira, Oita, Oita Prefecture | 33°14'50"N, 131°49'40"E |
| 26 | Suwacho, Uozu, Toyama Prefecture | 36°48'40"N, 137°23'33"E |
| 27 | Yoroi, Kazumi, Hyogo Prefecture | 35°39'10"N, 134°34'37"E |
| 28 | Tsudacho, Sanuki, Kagawa Prefecture | 34°17'16"N, 134°16'04"E |
| 29 | Shibukawa, Tamano, Okayama Prefecture | 34°27'23"N, 133°53'51"E |
| 30 | Hirano, Suo-Oshima, Yamaguchi Prefecture | 33°53'59"N, 132°21'51"E |
| 31 | Higashifukawa, Nagato, Yamaguchi Prefecture | 34°22'32"N, 131°10'33"E |
| 32 | Nishinoura, Nishi-ku, Fukuoka Prefecture | 33°39'20"N, 130°12'28"E |
| 33 | Hiranitago, Higashisonogi, Nagasaki Prefecture | 33°00'26"N, 129°56'47"E |
| 34 | Kujima, Omura, Nagasaki Prefecture | 32°53'42"N, 129°57'11"E |
| 35 | Nagatamachi, Nagasaki Prefecture | 32°50'00"N, 129°43'01"E |
| 36 | Odatoko Bay, Amakusa, Kumamoto Prefecture | 32°24'07"N, 130°00'09"E |
| 37 | Wakimoto, Akune, Kagoshima Prefecture | 32°05'03"N, 130°11'26"E |
| 38 | Sagata, Akune, Kagoshima Prefecture | 31°59'31"N, 130°10'54"E |
| 39 | Okawa, Akune, Kagoshima Prefecture | 31°56'47"N, 130°12'58"E |
| 40 | Bonotsu, Minamisatsuma, Kagoshima Prefecture | 31°16'26"N, 130°13'19"E |
| 41 | Kaimon, Ibusuki, Kagoshima Prefecture | 31°11'28"N, 130°30'30"E |
| 42 | Kishira, Kimotsuki, Kagoshima Prefecture | 31°13'41"N, 131°01'04"E |
| 43 | Chichijima, Ogasawara Islands | 27°05'36"N, 142°11'39"E |
| 44 | Koajiro, Misaki, Miura, Kanagawa Prefecture | 35°09'27"N, 139°36'40"E |
Animals were preserved in 99% ethanol. Preliminary identification of specimens prior to DNA sequencing was based on shell characters (
List of specimens used in this study.
Total genomic DNA was extracted from the mantle using the cetyltrimethylammonium bromide (CTAB) method (
| Gene | Primer name | Sequence (5’→3’) | Source |
|---|---|---|---|
| COI | LCO1490 (F) | GGTCAACAAATCATAAAGATATTGG |
|
| HCO2198 (R) | TAAACTTCAGGGTGACCAAAAAATCA |
|
|
| Cytb | cobF (F) | GGWTAYGTWYTWCCWTGRGGWCARAT |
|
| cobR (R) | GCRTAWGCRAAWARRAARTAYCAYTCWGG |
|
|
| 12S | 12Sma (F) | CTGGGATTAGATACCCTGTTAT |
|
| 12Smb (R) | CAGAGAGTGACGGGCGATTTGT |
|
|
| 16S | 16LRN13398 (F) | CGCCTGTTTAACAAAAACAT |
|
| 16SRHTB (R) | ACGCCGGTTTGAACTCAGATC |
|
All sequences were aligned using MEGA 6.06 (
Phylogenetic analyses were conducted using a maximum-likelihood (ML) approach via GARLI v. 2.0 (
ML bootstrap values were calculated from 1000 replicates. MrBayes was utilized with the following settings: six substitution types were employed (nst = 6); rate variation across sites was modeled using a gamma distribution with a proportion of the sites as invariant (rate = invgamma); and finally, the shape, invariable site proportion, state frequency, and substitution rate parameters were estimated.
Bayesian analysis was performed for 4,000,000 generations (for the four genes concatenated), 4,500,000 generations (COI), 4,000,000 generations (Cytb), 3,500,000 generations (12S rRNA), and 6,000,000 generations (16S rRNA) with a sample frequency of 100 and the first 25% generations discarded as the burn-in; convergence was determined when the average standard deviation of the split frequencies value (ASDSF) was below 0.01.
The genetic distances among and within species were calculated using the Kimura-2-Parameter (K2P) in MEGA 6.06.
Sequenced specimens were dissected under a binocular microscope. After observations of the animal including the snout pigmentation, cephalic tentacles, and foot lateral wall, the visceral mass was dissected to reveal the configuration of the radular sac. Removed radulae were cleaned in diluted commercial bleach, coated with platinum vanadium, and observed with a scanning electron microscope (Keyence VE-8800). The color of the ovary was recorded before ethanol fixation for specimens collected in breeding season, since gonad color fades when stored in ethanol.
Three shell characters were measured for a total of 130 sequenced specimens: shell length (L), shell width (W), and shell height (H). All individuals were measured with a digital caliper (to 0.01 mm). Allometric analyses were performed among species and genetic groups to determine relationships among length, width, and height using Welch’s t-test. Canonical discriminant analysis was performed among species using the three shell characters (L, W, and H). Discriminant functions also calculated the percentage of individuals that were classified correctly. Canonical discriminant analysis was conducted using R software package version 3.1.0 (
A total of 130 Nipponacmea individuals morphologically identified as N. schrenckii (12), N. fuscoviridis (29), N. concinna (15), N. radula (8), N. boninensis (3), N. habei (9), N. teramachii (16), N. nigrans (27), and N. gloriosa (11) were sequenced (Table
Genetic distances among Nipponacmea species using COI, Cytb, and the 12S rRNA gene. Numbers in bold typeface indicated the intraspecific.
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | |
|---|---|---|---|---|---|---|---|---|---|---|
| COI | ||||||||||
| 1 N. nigrans | 0.0–5.5 | |||||||||
| 2 N. habei | 21.5–23.7 | 0.0–0.8 | ||||||||
| 3 N. teramachii | 22.1–25.1 | 21.7–22.9 | 0.0–0.8 | |||||||
| 4 N. fuscoviridis | 24.9–28.1 | 22.1–23.1 | 22.1–23.1 | 0.0–1.2 | ||||||
| 5 N. boninensis | 23.5–24.7 | 23.7–24.1 | 24.1–25.1 | 19.6–20.8 | 0.0–0.4 | |||||
| 6 N. schrenckii | 23.1–25.1 | 22.5–23.1 | 23.3–24.5 | 18.6–19.6 | 17.8–18.4 | 0.0–1.0 | ||||
| 7 N. concinna | 22.9–24.9 | 24.3–25.3 | 23.7–24.3 | 19.4–20.9 | 19.6–20.2 | 20.8–21.9 | 0.0–0.8 | |||
| 8 N. radula | 25.1–27.3 | 23.1–26.9 | 25.7–26.9 | 23.3–24.9 | 18.8–21.7 | 21.5–23.1 | 21.7–23.7 | 0.0–9.9 | ||
| 9 N. gloriosa | 26.7–29.2 | 27.5–28.1 | 26.3–27.5 | 26.5–27.5 | 26.9–27.9 | 26.5–27.7 | 24.9–26.3 | 29.4–32 | 0.0–0.8 | |
| 10 L. kogamogai | 25.0–27.0 | 24.5–24.7 | 24.7–25.1 | 25.9–26.9 | 26.9–27.1 | 25.7–26.3 | 25.3–25.9 | 25.3–27.5 | 28.1–28.5 | 0.0 |
| Cytb | ||||||||||
| 1 N. nigrans | 0.0–4.7 | |||||||||
| 2 N. habei | 20.5–22.0 | 0.0–0.7 | ||||||||
| 3 N. teramachii | 24.8–27.0 | 23.8–24.5 | 0.0–1.2 | |||||||
| 4 N. fuscoviridis | 23.0–24.8 | 24.0–24.8 | 23.3–24.3 | 0.0–0.5 | ||||||
| 5 N. boninensis | 21.3–22.8 | 20.5–20.8 | 21.8–22.5 | 17.1–17.3 | 0.0 | |||||
| 6 N. schrenckii | 24.8–27.0 | 22.0–22.8 | 23.0–24.8 | 19.8–21.0 | 21.0–21.8 | 0.0–1.0 | ||||
| 7 N. concinna | 26.0–27.5 | 26.2–27.0 | 23.0–23.8 | 18.8–19.8 | 19.1–19.8 | 21.5–22.3 | 0.0–0.7 | |||
| 8 N. radula | 24.5–30.0 | 22.0–24.0 | 21.8–22.5 | 21.0–21.5 | 21.0–22.3 | 18.6–20.0 | 21.8–22.3 | 0.0–7.7 | ||
| 9 N. gloriosa | 21.8–23.8 | 20.3–21.3 | 23.8–25.2 | 23.3–24.8 | 24.0–24.5 | 23.3–24.3 | 24.5–26.5 | 23.5–25.0 | 0–2.5 | |
| 10 L. kogamogai | 26.2–27.0 | 32.4–32.4 | 28.2–28.7 | 28.0–28.2 | 28.7–28.7 | 31.2–31.4 | 29.7–30.2 | 30.0–30.4 | 30.2–31.2 | 0.0 |
| 12S rRNA | ||||||||||
| 1 N. nigrans | 0.0–1.2 | |||||||||
| 2 N. habei | 10.5–11.1 | 0.0 | ||||||||
| 3 N. teramachii | 12.7–13.6 | 13.0 | 0.0 | |||||||
| 4 N. fuscoviridis | 15.4–16.0 | 14.8–15.1 | 14.2–14.5 | 0.0–0.3 | ||||||
| 5 N. boninensis | 16.0–16.7 | 14.8 | 14.8 | 5.6–5.9 | 0.0 | |||||
| 6 N. schrenckii | 16.0–16.7 | 14.8 | 16.4 | 7.7–8.0 | 9.0 | 0.0 | ||||
| 7 N. concinna | 14.8–15.4 | 12.7 | 14.5 | 8.6–9.0 | 7.7 | 9.6 | 0.0 | |||
| 8 N. radula | 20.1–21.3 | 16.7–17.6 | 14.5 | 9.6–11.1 | 12.0–12.7 | 12.0–13.0 | 14.2–14.5 | 0.0–2.2 | ||
| 9 N. gloriosa | 21.6–23.1 | 21.3–22.5 | 22.2–23.5 | 24.4–25.0 | 23.5–24.1 | 21.9–22.2 | 22.2–22.5 | 25.0–25.9 | 0.0–1.2 | |
| 10 L. kogamogai | 23.8–24.1 | 23.1 | 25.3 | 25.3–25.6 | 24.7 | 25.3 | 25.3 | 28.1–28.4 | 24.4–25 | 0.0 |
| 16S rRNA | ||||||||||
| 1 N. nigrans | 0.0–0.7 | |||||||||
| 2 N. habei | 9.3–9.5 | 0.0 | ||||||||
| 3 N. teramachii | 8.7–9.4 | 8.9–9.1 | 0.0–0.2 | |||||||
| 4 N. fuscoviridis | 12.6–13.4 | 14.9–15.2 | 11.1–11.6 | 0–0.2 | ||||||
| 5 N. boninensis | 11–11.7 | 14.3–14.3 | 11.3–11.5 | 9.3–9.5 | 0.0 | |||||
| 6 N. schrenckii | 12.8–13.5 | 13.8–14.3 | 12.5–13.2 | 10.7–11.4 | 8.2–8.4 | 0.2–0.3 | ||||
| 7 N. concinna | 11.2–12.1 | 11.7–12 | 10.4–10.9 | 9.0–9.5 | 7.9–8.2 | 8.0–8.4 | 0.0–0.2 | |||
| 8 N. radula | 11.5–12.6 | 12.7–13.4 | 11.3–12.3 | 9.3–9.7 | 8.7–10.7 | 8.9–10.7 | 8.2–9.3 | 0.0–2.0 | ||
| 9 N. gloriosa | 26.1–26.4 | 22.4–22.7 | 24.3–24.9 | 28.1–28.5 | 24.9–25.2 | 22.3–23.2 | 26.4–27.0 | 25.8–26.1 | 0.0–0.2 | |
| 10 L. kogamogai | 25.2–25.5 | 22.8–22.8 | 26.2–26.5 | 29.9–30.0 | 27.9–27.9 | 28.8–29.5 | 27.8–28.1 | 28.5–29.9 | 28.8–28.8 | 0.0 |
The resultant phylogenetic tree using the four genes is shown in Fig.
Maximum likelihood phylogenetic tree generated from 1809 bp constructed from the concatenated COI, Cytb, 12S rRNA, and 16S rRNA gene sequences from Nipponacmea representatives. Numbers above or below the branches are ML bootstrap values and Bayesian posterior probabilities, respectively. See Table
Separate analyses of the four genes resulted in slightly different phylogenetic relationships that are described below. The divergence within Nipponacmea in the COI tree (Suppl. material
Shell morphology and color pattern of Nipponacmea gloriosa and four species of Clade A A–C N. gloriosa, RM31869, Ibusuki, Kagoshima (41) D N. gloriosa, RM31860, Tateyama, Chiba (13) E N. gloriosa, RM31862, Manazuru, Kanagawa (14) F–H N. fuscoviridis, RM31858, Kimotsuki, Kagoshima (42) I N. fuscoviridis, RM31846, Nikaho, Akita (10) J N. fuscoviridis, RM31859, Kimotsuki, Kagoshima (42) K–M N. boninensis, RM31817, Chichijima Is., Ogasawara (43) N N. boninensis, RM31815, Chichijima Is., Ogasawara (43) O N. boninensis, RM31816, Chichijima Is., Ogasawara (43) P–R N. schrenckii, RM31906, Kazamaura, Aomori (6) S N. schrenckii, RM31908, Kazamaura, Aomori (6) T N. schrenckii, RM31916, Nagatamachi, Nagasaki (35) U–W N. concinna, RM31820, Ofunato, Iwate (11) X N. concinna, RM31824, Mihamacho, Wakayama (21) Y N. concinna, RM31828, Suo-Oshima, Yamaguchi (30). Scale bars: 5 mm.
Although the monophyly of Clade A was well supported, branching order within the clade was not (BS values < 70%). In contrast, the monophyly of clade B was not strongly supported, nor was the monophyly of N. nigrans and N. habei (BS = 54%). Perhaps not surprisingly, separate analyses of the four genes resulted in slightly different trees (Suppl. material
Shell morphology and color pattern of N. radula and three species of clade B A–C N. radula, RM31904, Omura, Nagasaki (34) D N. radula, RM31902, Omura, Nagasaki (34) E N. radula, RM31899, Nagato, Yamaguchi (31) F–H N. nigrans, RM31892, Nishiku, Fukuoka (32) I N. nigrans, RM31888, Kada, Wakayama (22) J N. nigrans, RM31895, Higashisonogi, Nagasaki (33) K–M N. nigrans, RM31887, Minamiizu, Shizuoka (15) N N. nigrans, RM31886, Minamiizu, Shizuoka (15) O N. nigrans, RM31897, Higashisonogi, Nagasaki (33) P–R N. habei, RM31874, Ishinomaki, Miyagi (12) S N. habei, RM31875, Tateyama, Chiba (13) T N. habei, RM31873, Usujiri, Hokkaido (5) U–W N. teramachii, RM31930, Nishiku, Fukuoka (32) X N. teramachii, RM31925, Sanuki, Kagawa (28) Y N. teramachii, RM31922, Ainancho, Ehime (24). Scale bars: 5 mm.
In this study, we tested the identification of Nipponacmea species based only on sequences, and the results revealed nine phylogenetic groups, which confirmed the nine species currently described. In addition, scientific names were verified by comparison between type and sequenced specimens according to morphological traits. Among numerous possible morphological and anatomical characters, the following six characters were revealed to be most reliable for Nipponacmea species identification (Table
| Species | Shell sculpture | Animal pigmentation | Radula sac | Radular teeth | Ovary | |||
|---|---|---|---|---|---|---|---|---|
| Granules | Riblets | Snout | Cephalic tentacles | Foot | ||||
| N. gloriosa | Elongate and thin | Fine and sparse | Non-pigmented | Non-pigmented | Non-pigmented | Short | Blunt | Red |
| N. fuscoviridis | Elongate and thin | Fine and sparse | Non-pigmented | Black | Non-pigmented | Long, posterior and right loops | Acute | Green |
| N. boninensis | Absent | Fine and dense | Non-pigmented | Black | Gray | Intermediate | Slightly blunt | Red |
| N. schrenckii | Elongate and thin | Fine and sparse | Black | Black | Black | Intermediate | Acute | Green |
| N. concinna | Rounded | Absent | Black | Black | Black | Long, posterior and right loops | Acute | Brown |
| N. radula | Pointed | Fine and sparse | Gray | Black | Gray | Long, posterior and right loops | Acute | Brown |
| N. nigrans | Elongate and thcik | Thick and dense | Gray | Black | Gray | Short | Acute | Brown |
| N. habei | Elongate and thin | Fine and dense | Black | Black | Black | Variable from long to short loops | Acute to blunt | Brown |
| N. teramachii | Elongate and thin | Absent | Black | Black | Black | Short | Acute | Brown |
(1) Granules: Granules on the shell exterior exhibited five character states: (a) rounded (N. concinna), (b) pointed (N. radula), (c) smooth (N. boninensis), (d) thickly elongated (N. nigrans), and (e) thinly elongated (the remaining species). These results corroborate previous observations by
(2) Riblets: Exterior riblets were either fine, rough, or absent, depending on species. In Clade A, the riblets were fine and sparse in N. fuscoviridis, N. schrenckii, N. radula, while they were fine and dense in N. boninensis, and absent in N. concinna. In Clade B, the riblets were thick and dense in N. nigrans, fine and dense in N. habei, and absent in N. teramachii. The topology of the molecular phylogenetic trees indicated that the riblets do not reflect phylogeny.
(3) Animal pigmentation: Pigmentation in the snout, cephalic tentacles, and side of the foot was divergent among species, including black, grey, or non-pigmented types (Fig.
Pigmentation of side of foot A N. gloriosa, RM31861, Manazuru, Kanagawa (14) B N. fuscoviridis, RM31847, Tateyama, Chiba (13) C N. boninensis, RM31816, Chichijima Is., Ogasawara (43) D N. schrenckii, RM31908, Kazamaura, Aomori (6) E N. concinna, RM31830, Omura, Nagasaki (34) F N. radula, RM31900, Nagato, Yamaguchi (31) G N. nigrans, RM32361, Kushimoto, Wakayama (20) H N. habei, RM31870, Otaru, Hokkaido (2) I N. teramachii, RM31917, Tateyama, Chiba (13). Scale bars: 5 mm.
(4) Radular sac: The configuration of the radular sac was different among the species (Fig.
Configuration of radula sac of nine species of Nipponacmea A N. gloriosa, RM32355, Ibusuki, Kagoshima (41) B N. fuscoviridis, RM32354, Akune, Kagoshima (39) C N. boninensis, RM31817, Chichijima Is., Ogasawara (43) D N. schrenckii, RM31906, Kazamaura, Aomori (6) E N. concinna, RM32353, Nagatamachi, Nagasaki (35) F N. radula, RM32363, Akune, Kagoshima (37) G N. nigrans, RM32362, Kushimoto, Wakayama (20) H N. habei, RM32356, Tateyama, Chiba (13) I N. teramachii, RM31928, Suo-Oshima, Yamaguchi (30). Scale bars: 5 mm.
(5) Radular teeth: The lateral teeth were short and blunt in N. gloriosa, long and slightly blunt in N. boninensis, and long and acute in the rest of the species (Fig.
Scanning micrographs of radular teeth of of Nipponacmea A N. gloriosa, RM32355, Ibusuki, Kagoshima (41) B N. gloriosa, RM31860, Tateyama, Chiba (13) C N. fuscoviridis, RM31858, Kimotsukicho, Kagoshima (42) D N. fuscoviridis, RM32354, Akune, Kagoshima (39) E N. fuscoviridis, RM31834, Rumoi, Hokkaido (1) F N. boninensis, RM31817, Chichijima Is., Ogasawara (43) G N. boninensis, RM31815, Chichijima Is., Ogasawara (43) H N. schrenckii, RM31915, Suo-Oshima, Yamaguchi (30) I N. schrenckii, RM31906, Kazamaura, Aomori (6) J N. schrenckii, RM31916, Nagatamachi, Nagasaki (35) K N. concinna, RM31831, Omura, Nagasaki (34) L N. concinna, RM32353, Nagatamachi, Nagasaki (35) M N. concinna, RM31823, Tahara, Aichi (19) N N. radula, RM31898, Hamamatsu, Shizuoka (18) O N. radula, RM31904, Omura, Nagasaki (34) P N. radula, RM32363, Akune, Kagoshima (37) Q N. nigrans, RM32360, Kushimoto, Wakayama (20) R N. nigrans, RM32359, Kushimoto, Wakayama (20) S N. nigrans, RM32358, Kushimoto, Wakayama (20) T N. habei, RM32364, Tateyama, Chiba (13) U N. habei, RM31872, Suttu, Hokkaido (3) V N. habei, RM31873, Usujiri, Hokkaido (5) W N. habei, RM32357, Usujiri, Hokkaido (5) X N. habei, RM32356, Tateyama, Chiba (13) Y N. teramachii, RM31926, Sanuki, Kagawa (28) Z N. teramachii, RM31924, Ohira, Oita (25). Scale bars: 50 μm.
(6) Ovary: The color of the ovary can be classified into three categories: green in N. fuscoviridis and N. schrenckii, red in N. boninensis and N. gloriosa, and brown in N. concinna, N. radula, N. teramachii, N. nigrans, and N. habei. The ovaries of all species in Clade B were pigmented brown, whereas those of Clade A were variable and are characterized by one of the three color patterns outlined above.
The relationships among length, width, and height are indicated in Fig.
Canonical discriminant analysis for individuals of Nipponacmea species identified with mtDNA sequences.
| Observed classification | Predicted classification | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | % correct | |
| 1 N. gloriosa | 8 | 0 | 0 | 3 | 0 | 0 | 0 | 0 | 0 | 72.7 |
| 2 N. fuscoviridis | 0 | 23 | 0 | 0 | 1 | 1 | 2 | 0 | 2 | 79.3 |
| 3 N. boninensis | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0.0 |
| 4 N. schrenckii | 3 | 0 | 0 | 8 | 0 | 0 | 0 | 0 | 1 | 66.7 |
| 5 N. concinna | 0 | 7 | 0 | 0 | 7 | 0 | 0 | 1 | 0 | 46.7 |
| 6 N. radula | 0 | 4 | 0 | 0 | 2 | 1 | 0 | 1 | 0 | 12.5 |
| 7 N. nigrans | 0 | 3 | 0 | 0 | 0 | 0 | 23 | 1 | 0 | 85.2 |
| 8 N. habei | 0 | 1 | 0 | 0 | 0 | 0 | 6 | 2 | 0 | 66.7 |
| 9 N. teramachii | 0 | 9 | 0 | 1 | 0 | 0 | 0 | 0 | 6 | 37.5 |
The monophyly of Japanese Nipponacmea species has not been previously tested using molecular characters; however, it was strongly supported by the data obtained from the present study (Fig.
Holotype specimens, type localities, and geographic distribution of Nipponacmea species.
| Species | Holotype | Type locality | Geographic distribution |
|---|---|---|---|
| N. gloriosa (Habe, 1944) | National Museum of Nature and Science,Tsukuba, NSMT-Mo 100675 | Urado, Kochi Prefecture | Pacific coast from Choshi to Kyushu, the Sea of Japan from Oga Peninsula to Kyushu, and rare in Seto Inland Sea; China. |
| N. fuscoviridis (Teramachi, 1949) | Teramachi Collection in Toba Aquarium, missing | Akune, Kagoshima Prefecture | Pacific coast and the Sea of Japan from southern Hokkaido to Kyushu, and Ryukyu Islands; Korea, China. |
| N. boninensis (Asakura & Nishihama, 1987) | National Museum of Nature and Science,Tsukuba, NSMT-Mo 64445 | Yagyu-san, Chichijima Island, Ogasawara Islands | Hachijo Island, Ogasawara Islands, and Northern Mariana Islands (Asuncion and Maug Islands) |
| N. schrenckii (Lischke, 1868) | Unknown | Nagasaki City | Tsugaru Strait to Kyushu, and Seto Inland Sea; Korea, China. |
| N. concinna (Lischke, 1870) | Unknown | Nagasaki City | Pacific coast and the Sea of Japan from Hokkaido to Kyushu, and Seto Inland Sea; Korea. |
| N. radula (Kira, 1961) | Osaka Museum of Natural History, Kira Collection 525 | Akune, Kagoshima Prefecture | Pacific coast from Shizuoka Prefecture to Kyushu, the Sea of Japan from Yamaguchi Prefecture to Kyushu, and Seto Island Sea; Korea, China. |
| N. nigrans (Kira, 1961) | Osaka Museum of Natural History, Kira Collection 540 | Shionomisaki, Kii Peninsula | Pacific coast and the Sea of Japan from Hokkaido to Kyushu, and Seto Inland Sea; Korea, China, Taiwan. |
| N. habei Sasaki & Okutani, 1994 | National Museum of Nature and Science,Tsukuba, NSMT-Mo 69985 | Shiragami-misaki, Matsumae, Hokkaido | Pacific coast from Hokkaido to Izu Peninsula, the Sea of Japan from Hokkaido to Niigata Prefecutre |
| N. teramachii (Kira, 1961) | Osaka Museum of Natural History, Kira Collection 554 | Akune, Kagoshima Prefecture | Pacific coast from Ojika Peninsula to Kyushu, western and northern Kyushu, and Seto Inland Sea; Korea, China. |
| N. formosa (Christiaens, 1977) | Natural History Museum, London, No. 1977167 | Northern Taiwan | Taiwan |
| N. vietnamensis Chernyshev, 2008 | Zoological Museum of Far East State University, No. 18852 | Gulf of Tonkin | Vietnam |
| N. moskalevi Chernyshev & Chernova, 2002 | Zoological Museum of Far East State University, No H 2666 | Japan Sea, Sukhoputnaya Bay | Far East Russia |
In this study, the maximum genetic distance within species was noticeably smaller than the minimum among species; therefore, the genetic distances were consistent with morphology-based species taxonomy. The maximum genetic distance within Japanese Nipponacmea species was 9.9% in COI in N. radula (Table
A comparison of holotype and sequenced specimens from type localities (topotypes) is useful to confirm species identity. We investigated holotypes of seven species (N. radula, N. boninensis, N. habei, N. teramachii, N. nigrans, N. gloriosa, and N. formosa), excluding N. schrenckii, N. concinna, and N. fuscoviridis whose type materials are currently missing (Table
The results of the molecular phylogenetic analysis in this study revealed three major clades (N. gloriosa, Clade A, and Clade B), with N. gloriosa as sister to the other Nipponacmea species. This relationship is consistent with delineations observed based on major differences observed in radular morphology, food preference, and habitat. Nipponacmea gloriosa grazes exclusively on coralline algae, while the other species consume different materials, for example, N. concinna is known to graze on Ulva spp. (
Clade A was robustly supported with high bootstrap values by
The monophyly of Clade B was supported with relatively lower bootstrap values than that of Clade A (BS = 80% by
Differences exist in the aims and taxa sampled between our studies and previous research focused on Nipponacmea; however, the results are not contradictory. Compared to previous studies, we improved the phylogenetic analyses and validation of species taxonomy and taxonomic characters by: (1) obtaining novel sequence data from N. boninensis for the first time; (2) using the most diverse taxon sampling for Nipponacmea to date, including multiple specimens (ranging from 3 to 29) for each species, for a total of 130 specimens from 43 localities and 9 species; and (3) obtaining sequence data for Cytb in addition to other three mitochondrial (COI, 12S, and 16S rRNA) genes. The Cytb gene was used in this study since it evolves at higher rates than the 16S and is better for investigation of among-species and among-populations relationships.
The species taxonomy of Nipponacmea had long been confused prior to revision by
(1) Nipponacmea gloriosa: N. gloriosa is the exclusive species living in the subtidal zone that grazes on coralline algae (
(2) Nipponacmea fuscoviridis: The holotype of N. fuscoviridis (Teramachi, 1949) was apparently held in the Toba Aquarium’s Teramachi Collection, but its location cannot be confirmed. Currently, the identity of this species is based on the topotype specimens collected by Teramachi and preserved in the Kira Collection (
Two morphologically similar species are known from Taiwan and Vietnam.
(3) Nipponacmea boninensis: In the original description, N. boninensis was compared to N. schrenckii based on shell and radula morphology (
Nipponacmea boninensis is an endemic species to the southern Izu Islands (Hachijo Island), Ogasawara Islands, and the northernmost part of the Northern Mariana Islands (Asuncion and Maug Islands: Asakura and Kurozumi 1991: figs 1–3). There are no other Nipponacmea species recorded in the Izu-Ogasawara Islands or southward of this region.
(4) Nipponacmea schrenckii: N. schrenckii has the lowest shell apex among Nipponacmea species (
(5) Nipponacmea concinna: Lischke’s (1870) type is also missing; however, we used the original illustration for identification purposes. Similar to examples of distinct color polymorphism in patellogastropods (
(6) Nipponacmea radula: The distribution of N. radula is limited to the southwest area of Japan, which is a small area compared to that of other Nipponacmea species. However, intraspecific genetic divergence is high for this genus. Nipponacmea radula tends to prefer sheltered environments, and its distribution areas are often isolated. This specialized habitat may lead to the large genetic distances across the entire geographic range of N. radula (within species 9.9% for COI: Table
(7) Nipponacmea nigrans: The shell height of N. nigrans is relatively high, and the color patterns and shell shape are highly variable (Fig.
(8) Nipponacmea habei: This species is distributed mainly in the cold-water region from the Izu Peninsula to southern Hokkaido on the Pacific coast and from Niigata Prefecture to southern Hokkaido in the Sea of Japan (
The arrangement of the radular sac and the morphology of the lateral teeth are more variable in N. habei than in other Nipponacmea species (
(9) Nipponacmea teramachii: Although the name of this species was originally proposed for a form with white radial rays, the shell color pattern of N. teramachii is highly variable (Fig.
Morphology-based studies of patellogastropods have explored various animal characteristics (
(1) Shell color pattern: the degree of variability in the shell color pattern is different among species, and the patterns are categorized into three types: (i) striking variations (N. radula, N. habei, N. nigrans, and N. teramachii), (ii) faint variations (N. schrenckii, N. gloriosa, N. boninensis, and N. fuscoviridis), and (iii) dimorphisms of solid or spotted patterns (N. concinna). In N. concinna, the distribution of color forms has a geographic bias maintained by unknown factors: the solid type is common to northeastern Japan, while the spotted type is frequently found in southwestern Japan. Northern individuals of N. nigrans and N. habei also tend to have dark colored shells. Another similar example is the Japanese mud snail, Batillaria attramentaria, which exhibits a shell color polymorphism in which darker morphs are distributed in colder regions and lighter morphs are more commonly found in warmer regions (
The shell of N. gloriosa is reddish brown and completely different from other Nipponacmea species (Fig.
(2) Shell sculpture: concerning shell sculpture, ribs and granules on the shell exterior are differentiated among species (Table
(3) Apex height:
In Nipponacmea, the shell height is not relevant to the vertical distribution (
The topology of the phylogenetic tree implies that the high-apex group could be derived from the low-apex species, since the most basal species, N. gloriosa, and Clade A share a low apex. In the genus Notoacmea in New Zealand, 13 species formed two major clades; however, they were not based on shell height (
(4) Animal pigmentation: we confirmed that the pigmentation of the snout, cephalic tentacle, and side of the foot is different among species (Fig.
Nipponacmea gloriosa, which inhabits the subtidal zone, lacks pigmentation, and the pale coloration of this animal is possibly a consequence of its habitat. The limpets inhabiting the subtidal zone are unexceptionally pale (e.g., Niveotectura pallida, Tectura emydia, and Erginus sybariticus;
(5) Radular sac: the configuration of the radular sac has been regarded as a useful character for identification of Nipponacmea species (
(6) Radula: the radula morphology is useful for classifying patellogastropod species (
(7) Ovary: the ovaries of Nipponacmea species were categorized into three types: (i) green (N. fuscoviridis and N. schrenckii); (ii) red (N. boninensis and N. gloriosa); or (iii) brown (N. concinna, N. radula, N. teramachii, N. nigrans, and N. habei). In relation to the phylogeny, the ovaries of all species in Clade B are pigmented brown, whereas those of Clade A are variable.
In gastropods, the color of the ovary might be constrained according to taxonomic group (e.g., green in vetigastropods such as Haliotis and Turbo). However, the ovaries of patellogastropods have diversified into various colors. For example, the ovary is brown in Patelloida lanx and green in its congener P. conulus (Sasaki pers. obs.). The cause for ovary diversification and the ecological significance of color differences in the Patellogastropoda is unknown.
In this study, we confirmed that current species identified of the Japanese Nipponacmea are corroborated by the results from molecular phylogenetic analyses including topotype sequence data, comparative anatomy, and the reinvestigation of type specimens. This study represents an important step towards the revision of the entire group of Asian Nipponacmea. Currently, studying Japanese species is important for two reasons: (1) 9 of 12 nominal species in the genus have been described from Japan, and (2) all Japanese species have older species names and nomenclatural priority over more recently described non-Japanese species. Nipponacmea formosa in Taiwan, N. vietnamensis in Vietnam, and N. moskalevi in Russia must be verified according to morphology, molecular phylogeny, and ecological traits in future studies. In conclusion, a more comprehensive reinvestigation of the genus Nipponacmea must be undertaken using taxonomic, phylogenetic, and phylogeographic analyses over a wide geographic range covering Japan, Korea, Russian Far East, China, Taiwan, and Vietnam.
We would like to thank Hirofumi Kubo, Jun Nawa, Kazuyoshi Endo, Kei Sato, Keisuke Shimizu, Kozue Nishida, Masanori Okanishi, Masashi Yamaguchi, Naoki Hashimoto, Rei Ueshima, Rie Nakano, Shigeaki Kojima, Takanobu Tsuihiji, Takashi Okutani, Takuma Haga, Tomoyasu Yamazaki, Yoshihisa Kurita, You Usami, Yusuke Takeda for assistance in sampling and useful suggeston. Also we thank Nobuyuki Suzuki, Hiroaki Fukumori, Rie Sakai, Ryo Nakayama, Saki Kamiyama, Takashi Muranaka, Tatsuki Tsuhako, Toshiaki Shitamitu, Youhei Otaki, Youichi Maeda who helped us to collect samples. This work was supported by Grants-in-Aid for Scientific Research (KAKENHI) no. 14J09937 to S. Teruya and 26291077, 19K21646 and 20H01381 to T. Sasaki from the Japan Society for Promotion of Science.
Figure S1
Data type: Phylogenetic tree
Explanation note: Fig. S1. Maximum likelihood phylogenetic tree of COI. Numbers above or below the branches are ML bootstrap and Bayesian posterior probabilities, respectively.
Figure S2
Data type: Phylogenetic tree
Explanation note: Fig. S2. Maximum likelihood phylogenetic tree of Cytb. Numbers above or below the branches are ML bootstrap and Bayesian posterior probabilities, respectively.
Figure S3
Data type: Phylogenetic tree
Explanation note: Fig. S3. Maximum likelihood phylogenetic tree of 12S rRNA. Numbers above or below the branches are ML bootstrap and Bayesian posterior probabilities, respectively.
Figure S4
Data type: Phylogenetic tree
Explanation note: Fig. S4. Maximum likelihood phylogenetic tree of 16S rRNA. Numbers above or below the branches are ML bootstrap and Bayesian posterior probabilities, respectively.