Research Article
Print
Research Article
Molecular phylogeny of Nipponacmea (Patellogastropoda, Lottiidae) from Japan: a re-evaluation of species taxonomy and morphological diagnosis
expand article infoShinnosuke Teruya‡§, Davin H. E. Setiamarga§|, Tomoyuki Nakano, Takenori Sasaki§
‡ Okinawa Prefectural Deep Sea Water Research Center, Okinawa, Japan
§ The University of Tokyo, Tokyo, Japan
| Department of Applied Chemistry and Biochemistry / Ecosystem Engineering, National Institute of Technology (KOSEN), Wakayama, Japan
¶ Kyoto University, Wakayama, Japan

Corresponding author: Shinnosuke Teruya ( shi.teruya@gmail.com )

Academic editor: Edmund Gittenberger
© 2022 Shinnosuke Teruya, Davin H. E. Setiamarga, Tomoyuki Nakano, Takenori Sasaki.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Teruya S, Setiamarga DHE, Nakano T, Sasaki T (2022) Molecular phylogeny of Nipponacmea (Patellogastropoda, Lottiidae) from Japan: a re-evaluation of species taxonomy and morphological diagnosis. ZooKeys 1087: 163-198. https://doi.org/10.3897/zookeys.1087.78193
ZooBank: urn:lsid:zoobank.org:pub:DB9F75BC-4C7F-4679-B327-43C977C6B31C
Open Access

Abstract

The patellogastropod limpet genus Nipponacmea is widely distributed in Japan and adjacent East Asia. Species identification within Nipponacmea is challenging due to the high variation in shell morphology. In this study, we examined the taxonomy of this genus represented by nine nominal species from 43 localities (including type localities). Results of the molecular phylogenetic analysis revealed that: (1) N. gloriosa, the sole species in this genus inhabiting the subtidal zone, represents the most basal independent branch; (2) the remaining species are divided into two large clades with lower- and higher-apex shell profiles; and (3) the high-apex morphology was derived from the low-apex type. The terminal clades defined using the molecular data were consistent with nine morphospecies and had 100% bootstrap values, strongly supporting the conventional taxonomy of Nipponacmea. Although morphological similarities do not always reflect phylogeny, the set of morphological characters used in the current taxonomy were proven to be adequate for diagnosis. In conclusion, this study provided solid evidence to uphold the monophyly of known species of Nipponacmea in Japan and demonstrated the usefulness of morphological characters for species diagnosis.

Keywords

Lottiidae, morphology, Nipponacmea, phylogeny, taxonomy

Introduction

Limpets belonging to the clade Patellogastropoda are abundant in the intertidal rocky shores globally and are important in marine biology (Branch 1985a, b). Species taxonomy of patellogastropods has historically been based on the morphology of the shell and radula (Pilsbry 1891; Suter 1904; Oliver 1926; Powell 1973; Ponder and Creese 1980). However, identification of the members of this group is difficult due to the simplicity and high variability of shell morphology (Sasaki 1999a, b; Nakano and Spencer 2007; Nakano et al. 2009a). Therefore, corroboration with molecular phylogenetic analysis is required to establish reliable species taxonomy (Koufopanou et al. 1999), and this approach has resulted in the identification of cryptic species or polymorphisms in certain groups (Nakano and Ozawa 2005; Nakano and Spencer 2007; de Aranzamendi et al. 2009; Nakano et al. 2009a; González-Wevar et al. 2011).

Molecular phylogenetic analysis and comparison of morphological characters have previously been performed for limpets with ambiguous taxonomies (Lottia: Simison and Lindberg 2003; Notoacmea: Nakano and Spencer 2007; Nakano et al. 2009a; Patella: Mauro et al. 2003; Patelloida: Nakano and Ozawa 2005; Nacella: de Aranzamendi et al. 2009; González-Wevar et al. 2011; Cellana: Reisser et al. 2011 and 2012). Use of molecular and morphological characters have led to consistent conclusions in most cases in the genera Lottia, Notoacmea, and Patelloida, whereas species monophyly was rejected in Nacella and Cellana (see above references). The genetic distances within and among species are variable across taxonomic groups. Previous studies have revealed that the genetic distances within species based on the cytochrome oxidase I gene (COI) are estimated to be less than 4%; however, the values are highly variable among species, ranging from 4% to 44.4% (Mauro et al. 2003; Nakano and Ozawa 2005; Nakano and Spencer 2007; Nakano et al. 2009a). Therefore, there is no fixed threshold for species delimitation using genetic distances, and species taxonomy must also be based on the level of continuity of the morphological characters.

COI is used most frequently in molecular phylogenetic analyses at the population and species levels (Mauro et al. 2003; Simison and Lindberg 2003; Nakano and Ozawa 2005; Nakano and Spencer 2007; de Aranzamendi et al. 2009; Nakano et al. 2009a; González-Wevar et al. 2011; Reisser et al. 2011). In addition, phylogenetic estimation has been based on the 12S rRNA (Goldstien et al. 2009), 16S rRNA (Simison and Lindberg 2003; Nakano and Ozawa 2005; Goldstien et al. 2009), cytochrome b mitochondrial gene (Cytb) (de Aranzamendi et al. 2009; Goldstien et al. 2009), and the ITS1 region from nuclear DNA (Nakano and Spencer 2007; Nakano et al. 2009a). Previous studies have shown that COI is a fast-evolving gene that is suitable for investigation of the validity of species designations (Hebert et al. 2003).

Species delineations have been completed by comparing shell morphology (de Aranzamendi et al. 2009) and radulae (Simison and Lindberg 2003; Nakano and Ozawa 2005; Nakano and Spencer 2007; Nakano et al. 2009a), and through quantitative analysis of shell morphometry (Mauro et al. 2003; González-Wevar et al. 2011; Reisser et al. 2012). Determining the morphology of the radula is often considered one of the most effective means for species identification of patellogastropods (Lindberg 1998; Sasaki 1999a; Nakano and Ozawa 2005, 2007); however, the radular character can vary considerably in some species (e.g., Notoacmea scapha; Nakano and Spencer 2007). Therefore, species distinction and identification based solely on the radula is not always reliable. Quantitative analysis of shells may not clearly reveal species boundaries since different species of limpets frequently yield similar shapes. Comparative anatomy using features from the entire animal should be used for species recognition in patellogastropods (Lindberg 1988; Sasaki and Okutani 1993, 1994a, b; Sasaki 1999a); however, comprehensive analysis including both anatomical and molecular characteristics has rarely been conducted with this group.

The genus Nipponacmea of the family Lottiidae is widely distributed in East Asia (Nakano and Ozawa 2004, 2007; Nakano and Sasaki 2011), and there are nine known species in Japan (Sasaki 2000, 2017), and at least three more species outside of Japan (Christiaens 1980; Chernyshev and Chernova 2002; Chernyshev 2008; Bouchet 2015, see discussion for details). Before the discovery of specific anatomical characteristics and DNA sequences, the taxonomy of the genus was indistinct (Kira 1954; Habe and Kosuge 1967; Kuroda et al. 1971; Okutani and Habe 1975; Nakamura 1986; Asakura and Nishihama 1987; Takada 1992). Problems in taxonomic classification using morphological characteristics were caused by extensive variation of shell morphology within species. Sasaki and Okutani (1993) observed shell morphology and microstructure as well as anatomy in detail and utilized these features to redefine each species of Nipponacmea. As a result, new characters were found in the soft parts of the body, such as snout pigmentation, foot and cephalic tentacles, radula, radula sac configuration, and ovary color.

Molecular phylogenetic analyses of Nipponacmea have been undertaken by both Nakano and Ozawa (2004, 2007) and Yu et al. (2014). Nakano and Ozawa (2004, 2007) completed a phylogenetic analysis of the entire patellogastropod clade based on the sequences of the COI, 12S rRNA, 16S rRNA, 18S rRNA, and 28S rRNA genes, in which Nipponacmea was supported as a monophyletic lineage, independent of Notoacmea and Tectura. However, the monophyly of each Nipponacmea species could not be tested since only a single individual was used of each. Yu et al. (2014) performed identifications by barcoding and phylogeographic analysis of three Nipponacmea species in China, using the COI, 28S rRNA, and histone H3 genes. Currently, phylogenetic and taxonomic classification has only been attempted for selected Nipponacmea species in Asia.

The purposes of this study were to: (1) assess the taxonomy of Nipponacmea species from Japan using an integrative approach, with distance-based and tree-based methods for molecular data, and testing the utility of morphological diagnostic characters using type specimens and sequenced specimens from type localities or adjacent regions; and (2) phylogenetically analyze the relationships among species.

Materials and methods

Collection of samples

We collected Nipponacmea samples from 43 localities on the Japanese coast (Fig. 1, Table 1). The type localities or nearby areas are included for nine nominal species in this study (see Table 2). In addition, three species of Lottia (L. kogamogai (southern population), L. tenuisculpta, and L. lindbergi) described by Sasaki and Okutani (1994c), were used as outgroups.

Table 1.
Download as
CSV
XLSX

List of localities. See also Fig. 1 for map and Table 2 for list of specimens. All localities are in Japan.

No. Locality Coordinates (Latitude, Longitude)
1 Omachi, Rumoi, Hokkaido 43°56'45"N, 141°37'41"E
2 Shukutsu, Otaru, Hokkaido 43°14'09"N, 141°00'57"E
3 Masadomari, Suttu, Hokkaido 42°49'28"N, 140°11'15"E
4 Genna, Otobe, Hokkaido 42°00'24"N, 140°06'15"E
5 Usujiri, Hokkaido 41°56'11"N, 140°56'57"E
6 Hebiura, Kazamaura, Aomori Prefecture 41°29'42"N, 140°58'55"E
7 Arito, Noheji, Aomori Prefecture 40°54'25"N, 141°10'50"E
8 Tsuchiya, Hiranai, Aomori Prefecture 40°54'13"N, 140°51'46"E
9 Togashiohama, Oga, Akita Prefecture 39°56'40"N, 139°42'14"E
10 Kisakata, Nikaho, Akita Prefecture 39°12'34"N, 139°53'34"E
11 Masakicho, Ofunato, Iwate Prefecture 39°01'23"N, 141°42'36"E
12 Karakuwa, Ishinomaki, Miyagi Prefecture 38°30'47"N, 141°28'45"E
13 Okinoshima, Tateyama, Chiba Prefecture 34°59'27"N, 139°49'51"E
14 Mitsuishi, Manazuru, Kanagawa Prefecture 35°08'25"N, 139°09'41"E
15 Irouzaki, Minamiizu, Shizuoka Prefecture 34°36'47"N, 138°50'57"E
16 Futo, Nishiizu, Shizuoka Prefecture 34°47'36"N, 138°45'26"E
17 Iwashigashima, Yaizu, Shizuoka Prefecture 34°51'30"N, 138°19'40"E
18 Yutocho, Hamamatsu, Shizuoka Prefecture 34°42'13"N, 137°36'48"E
19 Iragocho, Tahara, Aichi Prefecture 34°34'56"N, 137°01'01"E
20 Shionomisaki, Kushimoto, Wakayama Prefecutre 33°26'11"N, 135°45'23"E
21 Mio, Mihamacho, Wakayama Prefecture 33°53'15"N, 135°04'31"E
22 Kada, Wakayama Prefecture 34°16'21"N, 135°03'54"E
23 Oki, Tosashimizu, Kochi Prefecture 32°51'00"N, 132°57'21"E
24 Ajiro, Ainancho, Ehime Prefecture 33°02'00"N, 132°24'19"E
25 Ohira, Oita, Oita Prefecture 33°14'50"N, 131°49'40"E
26 Suwacho, Uozu, Toyama Prefecture 36°48'40"N, 137°23'33"E
27 Yoroi, Kazumi, Hyogo Prefecture 35°39'10"N, 134°34'37"E
28 Tsudacho, Sanuki, Kagawa Prefecture 34°17'16"N, 134°16'04"E
29 Shibukawa, Tamano, Okayama Prefecture 34°27'23"N, 133°53'51"E
30 Hirano, Suo-Oshima, Yamaguchi Prefecture 33°53'59"N, 132°21'51"E
31 Higashifukawa, Nagato, Yamaguchi Prefecture 34°22'32"N, 131°10'33"E
32 Nishinoura, Nishi-ku, Fukuoka Prefecture 33°39'20"N, 130°12'28"E
33 Hiranitago, Higashisonogi, Nagasaki Prefecture 33°00'26"N, 129°56'47"E
34 Kujima, Omura, Nagasaki Prefecture 32°53'42"N, 129°57'11"E
35 Nagatamachi, Nagasaki Prefecture 32°50'00"N, 129°43'01"E
36 Odatoko Bay, Amakusa, Kumamoto Prefecture 32°24'07"N, 130°00'09"E
37 Wakimoto, Akune, Kagoshima Prefecture 32°05'03"N, 130°11'26"E
38 Sagata, Akune, Kagoshima Prefecture 31°59'31"N, 130°10'54"E
39 Okawa, Akune, Kagoshima Prefecture 31°56'47"N, 130°12'58"E
40 Bonotsu, Minamisatsuma, Kagoshima Prefecture 31°16'26"N, 130°13'19"E
41 Kaimon, Ibusuki, Kagoshima Prefecture 31°11'28"N, 130°30'30"E
42 Kishira, Kimotsuki, Kagoshima Prefecture 31°13'41"N, 131°01'04"E
43 Chichijima, Ogasawara Islands 27°05'36"N, 142°11'39"E
44 Koajiro, Misaki, Miura, Kanagawa Prefecture 35°09'27"N, 139°36'40"E
Figure 1. 

Collection localities of the specimens used in this study. The numbers are shown in Table 1.

Animals were preserved in 99% ethanol. Preliminary identification of specimens prior to DNA sequencing was based on shell characters (Sasaki and Okutani 1993; Sasaki 2000, 2017). All voucher specimens were deposited in the Department of Historical Geology and Paleontology at The University Museum, University of Tokyo (UMUT RM31815–31935, 32353–32364).

Table 2.
Download as
CSV
XLSX

List of specimens used in this study. UMUT: The University Museum, The University of Tokyo. *Type locality, ** locality close to type locality.

Species UMUT no. Loc. no. (Fig. 1) Accession no. Figure(s)
COI Cytb 12S 16S
N. boninensis RM31815 43* LC138228 LC142818 LC142951 LC143084 Figs 3N, 7G
RM31816 43* LC138229 LC142819 LC142952 LC143085 Figs 3O, 5C
RM31817 43* LC138230 LC142820 LC142953 LC143086 Figs 3K–M, 6C, 7F
N. concinna RM31818 10 LC138231 LC142821 LC142954 LC143087
RM31819 10 LC138232 LC142822 LC142955 LC143088
RM31820 11 LC138233 LC142823 LC142956 LC143089 Fig. 3U–W
RM31821 11 LC138234 LC142824 LC142957 LC143090
RM31822 17 LC138235 LC142825 LC142958 LC143091
RM31823 19 LC138236 LC142826 LC142959 LC143092 Fig. 7M
RM31824 21 LC138237 LC142827 LC142960 LC143093 Fig. 3X
RM31825 21 LC138238 LC142828 LC142961 LC143094
RM31826 29 LC138239 LC142829 LC142962 LC143095
RM31827 30 LC138240 LC142830 LC142963 LC143096
RM31828 30 LC138241 LC142831 LC142964 LC143097 Fig. 3Y
RM31829 32 LC138242 LC142832 LC142965 LC143098
RM31830 34 LC138243 LC142833 LC142966 LC143099 Fig. 5E
RM31831 34 LC138244 LC142834 LC142967 LC143100 Fig. 7K
RM32353 35* LC138349 LC142939 LC143072 LC143205 Figs 6E, 7L
N. fuscoviridis RM31832 1 LC138245 LC142835 LC142968 LC143101
RM31833 1 LC138246 LC142836 LC142969 LC143102
RM31834 1 LC138247 LC142837 LC142970 LC143103 Fig. 7E
RM31835 1 LC138248 LC142838 LC142971 LC143104
RM31836 1 LC138249 LC142839 LC142972 LC143105
RM31837 4 LC138250 LC142840 LC142973 LC143106
RM31838 4 LC138251 LC142841 LC142974 LC143107
RM31839 4 LC138252 LC142842 LC142975 LC143108
RM31840 8 LC138253 LC142843 LC142976 LC143109
RM31841 10 LC138254 LC142844 LC142977 LC143110
RM31842 10 LC138255 LC142845 LC142978 LC143111
RM31843 10 LC138256 LC142846 LC142979 LC143112
RM31844 10 LC138257 LC142847 LC142980 LC143113
RM31845 10 LC138258 LC142848 LC142981 LC143114
RM31846 10 LC138259 LC142849 LC142982 LC143115 Fig. 3I
RM31847 13 LC138260 LC142850 LC142983 LC143116 Fig. 5B
RM31848 32 LC138261 LC142851 LC142984 LC143117
RM31849 32 LC138262 LC142852 LC142985 LC143118
RM31850 32 LC138263 LC142853 LC142986 LC143119
RM31851 32 LC138264 LC142854 LC142987 LC143120
RM31852 32 LC138265 LC142855 LC142988 LC143121
RM31853 36 LC138266 LC142856 LC142989 LC143122
RM31854 36 LC138267 LC142857 LC142990 LC143123
RM31855 36 LC138268 LC142858 LC142991 LC143124
RM31856 36 LC138269 LC142859 LC142992 LC143125
RM31857 39* LC138270 LC142860 LC142993 LC143126
RM32354 39* LC138350 LC142940 LC143073 LC143206 Figs 6B, 7D
RM31858 42 LC138271 LC142861 LC142994 LC143127 Figs 3F–H, 7C
RM31859 42 LC138272 LC142862 LC142995 LC143128 Fig. 3J
N. gloriosa RM31860 13 LC138273 LC142863 LC142996 LC143129 Figs 3D, 7B
RM31861 14 LC138274 LC142864 LC142997 LC143130 Fig. 5A
RM31862 14 LC138275 LC142865 LC142998 LC143131 Fig. 3E
RM31863 14 LC138276 LC142866 LC142999 LC143132
RM31864 16 LC138277 LC142867 LC143000 LC143133
RM31865 27 LC138278 LC142868 LC143001 LC143134
RM31866 27 LC138279 LC142869 LC143002 LC143135
N. gloriosa RM31867 27 LC138280 LC142870 LC143003 LC143136
RM31868 40 LC138281 LC142871 LC143004 LC143137
RM31869 41 LC138282 LC142872 LC143005 LC143138 Fig. 3A–C
RM32355 41 LC138351 LC142941 LC143074 LC143207 Figs 6A, 7A
N. habei RM31870 2 LC138283 LC142873 LC143006 LC143139 Fig. 5H
RM31871 3 LC138284 LC142874 LC143007 LC143140
RM31872 3 LC138285 LC142875 LC143008 LC143141 Fig. 7U
RM31873 5** LC138286 LC142876 LC143009 LC143142 Figs 4T, 7V
RM32357 5** LC138353 LC142943 LC143076 LC143209 Fig. 7W
RM31874 12 LC138287 LC142877 LC143010 LC143143 Fig. 4P–R
RM31875 13 LC138288 LC142878 LC143011 LC143144 Fig. 4S
RM32356 13 LC138352 LC142942 LC143075 LC143208 Figs 6H, 7X
RM32364 13 LC138360 LC142950 LC143083 LC143216 Fig. 7T
N. nigrans RM31876 1 LC138289 LC142879 LC143012 LC143145
RM31877 3 LC138290 LC142880 LC143013 LC143146
RM31878 3 LC138291 LC142881 LC143014 LC143147
RM31879 3 LC138292 LC142882 LC143015 LC143148
RM31880 3 LC138293 LC142883 LC143016 LC143149
RM31881 4 LC138294 LC142884 LC143017 LC143150
RM31882 4 LC138295 LC142885 LC143018 LC143151
RM31883 7 LC138296 LC142886 LC143019 LC143152
RM31884 11 LC138297 LC142887 LC143020 LC143153
RM31885 12 LC138298 LC142888 LC143021 LC143154
RM31886 15 LC138299 LC142889 LC143022 LC143155 Fig. 4N
RM31887 15 LC138300 LC142890 LC143023 LC143156 Fig. 4K–M
RM32358 20* LC138354 LC142944 LC143077 LC143210 Fig. 7S
RM32359 20* LC138355 LC142945 LC143078 LC143211 Fig. 7R
RM32360 20* LC138356 LC142946 LC143079 LC143212 Fig. 7Q
RM32361 20* LC138357 LC142947 LC143080 LC143213 Fig. 5G
RM32362 20* LC138358 LC142948 LC143081 LC143214 Fig. 6G
RM31888 22 LC138301 LC142891 LC143024 LC143157
RM31889 22 LC138302 LC142892 LC143025 LC143158
RM31890 22 LC138303 LC142893 LC143026 LC143159
RM31891 26 LC138304 LC142894 LC143027 LC143160
RM31892 32 LC138305 LC142895 LC143028 LC143161 Fig. 4F–H
RM31893 33 LC138306 LC142896 LC143029 LC143162
RM31894 33 LC138307 LC142897 LC143030 LC143163
RM31895 33 LC138308 LC142898 LC143031 LC143164 Fig. 4J
RM31896 33 LC138309 LC142899 LC143032 LC143165
RM31897 33 LC138310 LC142900 LC143033 LC143166 Fig. 4O
N. radula RM31898 18 LC138311 LC142901 LC143034 LC143167 Fig. 7N
RM31899 31 LC138312 LC142902 LC143035 LC143168 Fig. 4E
RM31900 31 LC138313 LC142903 LC143036 LC143169 Fig. 5F
RM31901 34 LC138314 LC142904 LC143037 LC143170
RM31902 34 LC138315 LC142905 LC143038 LC143171 Fig. 4D
RM31903 34 LC138316 LC142906 LC143039 LC143172
RM31904 34 LC138317 LC142907 LC143040 LC143173 Figs 4A–C, 7O
RM32363 37* LC138359 LC142949 LC143082 LC143215 Figs 6F, 7P
N. schrenckii RM31905 6 LC138318 LC142908 LC143041 LC143174
RM31906 6 LC138319 LC142909 LC143042 LC143175 Figs 3P–R, 6D, 7I
RM31907 6 LC138320 LC142910 LC143043 LC143176
RM31908 6 LC138321 LC142911 LC143044 LC143177 Figs 3S, 5D
RM31909 9 LC138322 LC142912 LC143045 LC143178
RM31910 9 LC138323 LC142913 LC143046 LC143179
RM31911 9 LC138324 LC142914 LC143047 LC143180
RM31912 14 LC138325 LC142915 LC143048 LC143181
N. schrenckii RM31913 14 LC138326 LC142916 LC143049 LC143182
RM31914 23 LC138327 LC142917 LC143050 LC143183
RM31915 30 LC138328 LC142918 LC143051 LC143184 Fig. 7H
RM31916 35* LC138329 LC142919 LC143052 LC143185 Figs 3T, 7J
N. teramachii RM31917 13 LC138330 LC142920 LC143053 LC143186 Fig. 5I
RM31918 13 LC138331 LC142921 LC143054 LC143187
RM31919 21 LC138332 LC142922 LC143055 LC143188
RM31920 21 LC138333 LC142923 LC143056 LC143189
RM31921 24 LC138334 LC142924 LC143057 LC143190
RM31922 24 LC138335 LC142925 LC143058 LC143191 Fig. 4Y
RM31923 25 LC138336 LC142926 LC143059 LC143192
RM31924 25 LC138337 LC142927 LC143060 LC143193 Fig. 7Z
RM31925 28 LC138338 LC142928 LC143061 LC143194 Fig. 4X
RM31926 28 LC138339 LC142929 LC143062 LC143195 Fig. 7Y
RM31927 30 LC138340 LC142930 LC143063 LC143196
RM31928 30 LC138341 LC142931 LC143064 LC143197 Fig. 6I
RM31929 32 LC138342 LC142932 LC143065 LC143198
RM31930 32 LC138343 LC142933 LC143066 LC143199 Fig. 4U–W
RM31931 38* LC138344 LC142934 LC143067 LC143200
RM31932 38* LC138345 LC142935 LC143068 LC143201
L. kogamogai RM31933 44 LC138346 LC142936 LC143069 LC143202
L. tenuisculpta RM31934 44 LC138347 LC142937 LC143070 LC143203
L. lindbergi RM31935 44 LC138348 LC142938 LC143071 LC143204

DNA extraction, amplification, and sequencing

Total genomic DNA was extracted from the mantle using the cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle 1990). The mtDNA cytochrome c oxidase I (COI), cytochrome b (Cytb), the small-subunit ribosomal RNA (12S rRNA), and the large-subunit ribosomal RNA (16S rRNA) were used as the molecular markers in this study. PCR products of each gene was amplified with universal primers (Table 3). PCR amplification was performed in a reaction volume of 25 μL containing 10 μM Tris HCl at pH 8.3, 50 μM KCL, 1.5 μM MgCl2, 200 μM dNTPs, 0.2 μM of each primer, 2 units of Taq polymerase (Takara), and 1 μL of template DNA. The amplification cycle consisted of an initial denaturation for 3 min at 94 °C, followed by 30 cycles of denaturation for 45 s at 94 °C, annealing for 90 s at a gene-specific annealing temperature (50 °C for COI, 52 °C for Cytb, and 55 °C for the 12S) and extension for 120 s at 72 °C, followed by a 5 min final extension at 72 °C. The PCR products were purified with Illustra ExoStar (GE Healthcare), and used as the template DNA for cycle sequencing reactions from both directions with the DTCS-Quick Start Kit (Beckman Coulter) following standard protocols using the CEQ 2000 XL (Beckman Coulter) automatic sequencer.

Table 3.
Download as
CSV
XLSX

List of PCR primers.

Gene Primer name Sequence (5’→3’) Source
COI LCO1490 (F) GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994)
HCO2198 (R) TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994)
Cytb cobF (F) GGWTAYGTWYTWCCWTGRGGWCARAT Boore and Brown 2000
cobR (R) GCRTAWGCRAAWARRAARTAYCAYTCWGG Boore and Brown 2000
12S 12Sma (F) CTGGGATTAGATACCCTGTTAT Koufopanou et al. (1999)
12Smb (R) CAGAGAGTGACGGGCGATTTGT Koufopanou et al. (1999)
16S 16LRN13398 (F) CGCCTGTTTAACAAAAACAT Koufopanou et al. (1999)
16SRHTB (R) ACGCCGGTTTGAACTCAGATC Koufopanou et al. (1999)

Datasets

All sequences were aligned using MEGA 6.06 (Tamura et al. 2013) and multiple sequence alignments were constructed using MAFFT (Katoh and Toh 2008). Ambiguous regions were removed with Gblocks (Talavera and Castresana 2007) to allow for smaller final blocks and less strict flanking positions.

Phylogenetic analyses

Phylogenetic analyses were conducted using a maximum-likelihood (ML) approach via GARLI v. 2.0 (Zwickl 2006) and a Bayesian approach via MrBayes v3.1.2 (Ronquist and Huelsenbeck 2003) with appropriate substitution models for each partition. MrModeltest v2.3 (Nylander 2004) was applied to obtain appropriate substitution models using the Akaike information criterion (Akaike 1974). The substitution models chosen were GTR+I+G for the 12S rRNA, 16S rRNA and Cytb genes, and HKY+I+G for the COI gene.

ML bootstrap values were calculated from 1000 replicates. MrBayes was utilized with the following settings: six substitution types were employed (nst = 6); rate variation across sites was modeled using a gamma distribution with a proportion of the sites as invariant (rate = invgamma); and finally, the shape, invariable site proportion, state frequency, and substitution rate parameters were estimated.

Bayesian analysis was performed for 4,000,000 generations (for the four genes concatenated), 4,500,000 generations (COI), 4,000,000 generations (Cytb), 3,500,000 generations (12S rRNA), and 6,000,000 generations (16S rRNA) with a sample frequency of 100 and the first 25% generations discarded as the burn-in; convergence was determined when the average standard deviation of the split frequencies value (ASDSF) was below 0.01.

The genetic distances among and within species were calculated using the Kimura-2-Parameter (K2P) in MEGA 6.06.

Morphological characters

Sequenced specimens were dissected under a binocular microscope. After observations of the animal including the snout pigmentation, cephalic tentacles, and foot lateral wall, the visceral mass was dissected to reveal the configuration of the radular sac. Removed radulae were cleaned in diluted commercial bleach, coated with platinum vanadium, and observed with a scanning electron microscope (Keyence VE-8800). The color of the ovary was recorded before ethanol fixation for specimens collected in breeding season, since gonad color fades when stored in ethanol.

Three shell characters were measured for a total of 130 sequenced specimens: shell length (L), shell width (W), and shell height (H). All individuals were measured with a digital caliper (to 0.01 mm). Allometric analyses were performed among species and genetic groups to determine relationships among length, width, and height using Welch’s t-test. Canonical discriminant analysis was performed among species using the three shell characters (L, W, and H). Discriminant functions also calculated the percentage of individuals that were classified correctly. Canonical discriminant analysis was conducted using R software package version 3.1.0 (R Core Team 2014).

Results

Molecular data

A total of 130 Nipponacmea individuals morphologically identified as N. schrenckii (12), N. fuscoviridis (29), N. concinna (15), N. radula (8), N. boninensis (3), N. habei (9), N. teramachii (16), N. nigrans (27), and N. gloriosa (11) were sequenced (Table 2). The lengths of the COI, Cytb, 12S rRNA, and 16S rRNA gene sequences were 648, 410, 443, and 604 bp, respectively. After removal of ambiguous regions and trimming the ends of poor quality sequences, final lengths of 506, 404, 324, and 575 bp were used for the analysis, respectively. The sequences of the four genes were combined into a total of 1809 bp for constructing phylogenetic trees. All nucleotide sequences in this study were deposited in GenBank (Accession numbers LC138228–LC138360, LC14818–LC143216).

Table 4.
Download as
CSV
XLSX

Genetic distances among Nipponacmea species using COI, Cytb, and the 12S rRNA gene. Numbers in bold typeface indicated the intraspecific.

1 2 3 4 5 6 7 8 9 10
COI
1 N. nigrans 0.0–5.5
2 N. habei 21.5–23.7 0.0–0.8
3 N. teramachii 22.1–25.1 21.7–22.9 0.0–0.8
4 N. fuscoviridis 24.9–28.1 22.1–23.1 22.1–23.1 0.0–1.2
5 N. boninensis 23.5–24.7 23.7–24.1 24.1–25.1 19.6–20.8 0.0–0.4
6 N. schrenckii 23.1–25.1 22.5–23.1 23.3–24.5 18.6–19.6 17.8–18.4 0.0–1.0
7 N. concinna 22.9–24.9 24.3–25.3 23.7–24.3 19.4–20.9 19.6–20.2 20.8–21.9 0.0–0.8
8 N. radula 25.1–27.3 23.1–26.9 25.7–26.9 23.3–24.9 18.8–21.7 21.5–23.1 21.7–23.7 0.0–9.9
9 N. gloriosa 26.7–29.2 27.5–28.1 26.3–27.5 26.5–27.5 26.9–27.9 26.5–27.7 24.9–26.3 29.4–32 0.0–0.8
10 L. kogamogai 25.0–27.0 24.5–24.7 24.7–25.1 25.9–26.9 26.9–27.1 25.7–26.3 25.3–25.9 25.3–27.5 28.1–28.5 0.0
Cytb
1 N. nigrans 0.0–4.7
2 N. habei 20.5–22.0 0.0–0.7
3 N. teramachii 24.8–27.0 23.8–24.5 0.0–1.2
4 N. fuscoviridis 23.0–24.8 24.0–24.8 23.3–24.3 0.0–0.5
5 N. boninensis 21.3–22.8 20.5–20.8 21.8–22.5 17.1–17.3 0.0
6 N. schrenckii 24.8–27.0 22.0–22.8 23.0–24.8 19.8–21.0 21.0–21.8 0.0–1.0
7 N. concinna 26.0–27.5 26.2–27.0 23.0–23.8 18.8–19.8 19.1–19.8 21.5–22.3 0.0–0.7
8 N. radula 24.5–30.0 22.0–24.0 21.8–22.5 21.0–21.5 21.0–22.3 18.6–20.0 21.8–22.3 0.0–7.7
9 N. gloriosa 21.8–23.8 20.3–21.3 23.8–25.2 23.3–24.8 24.0–24.5 23.3–24.3 24.5–26.5 23.5–25.0 0–2.5
10 L. kogamogai 26.2–27.0 32.4–32.4 28.2–28.7 28.0–28.2 28.7–28.7 31.2–31.4 29.7–30.2 30.0–30.4 30.2–31.2 0.0
12S rRNA
1 N. nigrans 0.0–1.2
2 N. habei 10.5–11.1 0.0
3 N. teramachii 12.7–13.6 13.0 0.0
4 N. fuscoviridis 15.4–16.0 14.8–15.1 14.2–14.5 0.0–0.3
5 N. boninensis 16.0–16.7 14.8 14.8 5.6–5.9 0.0
6 N. schrenckii 16.0–16.7 14.8 16.4 7.7–8.0 9.0 0.0
7 N. concinna 14.8–15.4 12.7 14.5 8.6–9.0 7.7 9.6 0.0
8 N. radula 20.1–21.3 16.7–17.6 14.5 9.6–11.1 12.0–12.7 12.0–13.0 14.2–14.5 0.0–2.2
9 N. gloriosa 21.6–23.1 21.3–22.5 22.2–23.5 24.4–25.0 23.5–24.1 21.9–22.2 22.2–22.5 25.0–25.9 0.0–1.2
10 L. kogamogai 23.8–24.1 23.1 25.3 25.3–25.6 24.7 25.3 25.3 28.1–28.4 24.4–25 0.0
16S rRNA
1 N. nigrans 0.0–0.7
2 N. habei 9.3–9.5 0.0
3 N. teramachii 8.7–9.4 8.9–9.1 0.0–0.2
4 N. fuscoviridis 12.6–13.4 14.9–15.2 11.1–11.6 0–0.2
5 N. boninensis 11–11.7 14.3–14.3 11.3–11.5 9.3–9.5 0.0
6 N. schrenckii 12.8–13.5 13.8–14.3 12.5–13.2 10.7–11.4 8.2–8.4 0.2–0.3
7 N. concinna 11.2–12.1 11.7–12 10.4–10.9 9.0–9.5 7.9–8.2 8.0–8.4 0.0–0.2
8 N. radula 11.5–12.6 12.7–13.4 11.3–12.3 9.3–9.7 8.7–10.7 8.9–10.7 8.2–9.3 0.0–2.0
9 N. gloriosa 26.1–26.4 22.4–22.7 24.3–24.9 28.1–28.5 24.9–25.2 22.3–23.2 26.4–27.0 25.8–26.1 0.0–0.2
10 L. kogamogai 25.2–25.5 22.8–22.8 26.2–26.5 29.9–30.0 27.9–27.9 28.8–29.5 27.8–28.1 28.5–29.9 28.8–28.8 0.0

Molecular phylogenetic analysis

The resultant phylogenetic tree using the four genes is shown in Fig. 2. The monophyly of the genus Nipponacmea was supported with a bootstrap value (BS) = 100% and posterior probability (PP) = 1.00. There are nine terminal clades, and morphological characters of the sequenced specimens confirmed that these clades corresponded to the Nipponacmea species previously defined by Sasaki and Okutani (1993, 1994a) (see below for more notes on the morphology). The relationships among species indicated that: (1) N. gloriosa is the sister to the remaining lineages, (2) the remaining species form a large clade supported with BS = 99% and PP = 1.00, and (3) the large clade is divided into two subclades, which we have referred to as Clades A and B. The monophyly of Clade A was well supported with BS = 100% and PP = 1.00. The topology within Clade A was: (N. radula, N. concinna, N. schrenckii, (N. boninensis, N. fuscoviridis)). BS values for interspecific relationships within this clade were less than 70%, and its branches were not well supported. The highest value within Clade A was between N. fuscoviridis and N. boninensis (BS = 66%, PP = 0.96). Clade B was supported with BS = 58% and PP = 0.94, and the topology within this group was: (N. teramachii, (N. nigrans, N. habei)). The highest supported values within Clade B were BS = 61% and PP = 0.99 between N. nigrans and N. habei.

Figure 2. 

Maximum likelihood phylogenetic tree generated from 1809 bp constructed from the concatenated COI, Cytb, 12S rRNA, and 16S rRNA gene sequences from Nipponacmea representatives. Numbers above or below the branches are ML bootstrap values and Bayesian posterior probabilities, respectively. See Table 2 for sample numbers.

Separate analyses of the four genes resulted in slightly different phylogenetic relationships that are described below. The divergence within Nipponacmea in the COI tree (Suppl. material 1: Fig. S1) was expressed as: (Clade A, (Clade B, N. gloriosa)), whereas in the tree constructed with combined sequences, N. gloriosa was a sister to the other lineages. The topology within Clade A, unlike what was revealed with the combined sequence tree, was: ((N. fuscoviridis, N. concinna), (N. schrenckii, (N. radula, N. boninensis))), whereas that for Clade B was the same as that of the combined tree. Phylogenetic relationships within Nipponacmea species were different from those of the combined tree in the Cytb analysis (Suppl. material 2: Fig. S2). The topology within Clade A was: (N. boninensis, (N. fuscoviridis, (N. concinna, (N. schrenckii, N. radula)))), while Clade B showed: (N. teramachii, (N. nigrans, (N. habei, N. gloriosa))). Relationships among species were similar to those of the combined tree in the analysis of 12S rRNA gene (Suppl. material 3: Fig. S3). The result of phylogenetic analysis of 16S rRNA gene is shown in Suppl. material 4: Fig. S4. As in the combined tree, N. gloriosa was the sister to the remaining Nipponacmea, Clade A was well supported, and the topology within that clade was the same as that of the tree of combined sequences. In comparison to the combined tree, the monophyly of Clade B was not supported in the analysis of the 16S rRNA.

Figure 3. 

Shell morphology and color pattern of Nipponacmea gloriosa and four species of Clade A A–C N. gloriosa, RM31869, Ibusuki, Kagoshima (41) D N. gloriosa, RM31860, Tateyama, Chiba (13) E N. gloriosa, RM31862, Manazuru, Kanagawa (14) F–H N. fuscoviridis, RM31858, Kimotsuki, Kagoshima (42) I N. fuscoviridis, RM31846, Nikaho, Akita (10) J N. fuscoviridis, RM31859, Kimotsuki, Kagoshima (42) K–M N. boninensis, RM31817, Chichijima Is., Ogasawara (43) N N. boninensis, RM31815, Chichijima Is., Ogasawara (43) O N. boninensis, RM31816, Chichijima Is., Ogasawara (43) P–R N. schrenckii, RM31906, Kazamaura, Aomori (6) S N. schrenckii, RM31908, Kazamaura, Aomori (6) T N. schrenckii, RM31916, Nagatamachi, Nagasaki (35) U–W N. concinna, RM31820, Ofunato, Iwate (11) X N. concinna, RM31824, Mihamacho, Wakayama (21) Y N. concinna, RM31828, Suo-Oshima, Yamaguchi (30). Scale bars: 5 mm.

Although the monophyly of Clade A was well supported, branching order within the clade was not (BS values < 70%). In contrast, the monophyly of clade B was not strongly supported, nor was the monophyly of N. nigrans and N. habei (BS = 54%). Perhaps not surprisingly, separate analyses of the four genes resulted in slightly different trees (Suppl. material 1: Fig. S1, Suppl. material 2: Fig. S2, Suppl. material 3: Fig. S3, Suppl. material 4: Fig. S4).

Figure 4. 

Shell morphology and color pattern of N. radula and three species of clade B A–C N. radula, RM31904, Omura, Nagasaki (34) D N. radula, RM31902, Omura, Nagasaki (34) E N. radula, RM31899, Nagato, Yamaguchi (31) F–H N. nigrans, RM31892, Nishiku, Fukuoka (32) I N. nigrans, RM31888, Kada, Wakayama (22) J N. nigrans, RM31895, Higashisonogi, Nagasaki (33) K–M N. nigrans, RM31887, Minamiizu, Shizuoka (15) N N. nigrans, RM31886, Minamiizu, Shizuoka (15) O N. nigrans, RM31897, Higashisonogi, Nagasaki (33) P–R N. habei, RM31874, Ishinomaki, Miyagi (12) S N. habei, RM31875, Tateyama, Chiba (13) T N. habei, RM31873, Usujiri, Hokkaido (5) U–W N. teramachii, RM31930, Nishiku, Fukuoka (32) X N. teramachii, RM31925, Sanuki, Kagawa (28) Y N. teramachii, RM31922, Ainancho, Ehime (24). Scale bars: 5 mm.

Morphological characters

In this study, we tested the identification of Nipponacmea species based only on sequences, and the results revealed nine phylogenetic groups, which confirmed the nine species currently described. In addition, scientific names were verified by comparison between type and sequenced specimens according to morphological traits. Among numerous possible morphological and anatomical characters, the following six characters were revealed to be most reliable for Nipponacmea species identification (Table 5).

Table 5.
Download as
CSV
XLSX

Diagnostic characters of Nipponacmea species distributed in Japan.

Species Shell sculpture Animal pigmentation Radula sac Radular teeth Ovary
Granules Riblets Snout Cephalic tentacles Foot
N. gloriosa Elongate and thin Fine and sparse Non-pigmented Non-pigmented Non-pigmented Short Blunt Red
N. fuscoviridis Elongate and thin Fine and sparse Non-pigmented Black Non-pigmented Long, posterior and right loops Acute Green
N. boninensis Absent Fine and dense Non-pigmented Black Gray Intermediate Slightly blunt Red
N. schrenckii Elongate and thin Fine and sparse Black Black Black Intermediate Acute Green
N. concinna Rounded Absent Black Black Black Long, posterior and right loops Acute Brown
N. radula Pointed Fine and sparse Gray Black Gray Long, posterior and right loops Acute Brown
N. nigrans Elongate and thcik Thick and dense Gray Black Gray Short Acute Brown
N. habei Elongate and thin Fine and dense Black Black Black Variable from long to short loops Acute to blunt Brown
N. teramachii Elongate and thin Absent Black Black Black Short Acute Brown

(1) Granules: Granules on the shell exterior exhibited five character states: (a) rounded (N. concinna), (b) pointed (N. radula), (c) smooth (N. boninensis), (d) thickly elongated (N. nigrans), and (e) thinly elongated (the remaining species). These results corroborate previous observations by Sasaki and Okutani (1993; fig. 15). The phylogeny suggests granules were differentiated according to species-specific types in Clade A, such as the elongate type seen in N. gloriosa, and Clade B.

(2) Riblets: Exterior riblets were either fine, rough, or absent, depending on species. In Clade A, the riblets were fine and sparse in N. fuscoviridis, N. schrenckii, N. radula, while they were fine and dense in N. boninensis, and absent in N. concinna. In Clade B, the riblets were thick and dense in N. nigrans, fine and dense in N. habei, and absent in N. teramachii. The topology of the molecular phylogenetic trees indicated that the riblets do not reflect phylogeny.

(3) Animal pigmentation: Pigmentation in the snout, cephalic tentacles, and side of the foot was divergent among species, including black, grey, or non-pigmented types (Fig. 5). The snout was not pigmented in N. gloriosa, N. fuscoviridis, or N. boninensis; lightly pigmented in N. radula and N. nigrans; and blackened in the remaining four species. The pigmentation of the snout did not reflect phylogenetic relationships. Only N. gloriosa lacked pigmentation in the cephalic tentacles, whereas the other eight species had darkly pigmented tentacles. The side of the foot was not pigmented in N. gloriosa or N. fuscoviridis, lightly pigmented in N. boninensis, N. radula, and N. nigrans, and finally darkly pigmented in the remaining four species. Relationships between pigmentation patterns and phylogeny were not detected.

Figure 5. 

Pigmentation of side of foot A N. gloriosa, RM31861, Manazuru, Kanagawa (14) B N. fuscoviridis, RM31847, Tateyama, Chiba (13) C N. boninensis, RM31816, Chichijima Is., Ogasawara (43) D N. schrenckii, RM31908, Kazamaura, Aomori (6) E N. concinna, RM31830, Omura, Nagasaki (34) F N. radula, RM31900, Nagato, Yamaguchi (31) G N. nigrans, RM32361, Kushimoto, Wakayama (20) H N. habei, RM31870, Otaru, Hokkaido (2) I N. teramachii, RM31917, Tateyama, Chiba (13). Scale bars: 5 mm.

(4) Radular sac: The configuration of the radular sac was different among the species (Fig. 6). Nipponacmea concinna and N. radula had two loops, the anterior and posterior loops, while the other species formed a single shorter loop. Again, this character did not correspond with the defined phylogenetic relationships.

Figure 6. 

Configuration of radula sac of nine species of Nipponacmea A N. gloriosa, RM32355, Ibusuki, Kagoshima (41) B N. fuscoviridis, RM32354, Akune, Kagoshima (39) C N. boninensis, RM31817, Chichijima Is., Ogasawara (43) D N. schrenckii, RM31906, Kazamaura, Aomori (6) E N. concinna, RM32353, Nagatamachi, Nagasaki (35) F N. radula, RM32363, Akune, Kagoshima (37) G N. nigrans, RM32362, Kushimoto, Wakayama (20) H N. habei, RM32356, Tateyama, Chiba (13) I N. teramachii, RM31928, Suo-Oshima, Yamaguchi (30). Scale bars: 5 mm.

(5) Radular teeth: The lateral teeth were short and blunt in N. gloriosa, long and slightly blunt in N. boninensis, and long and acute in the rest of the species (Fig. 7). The radular morphology of N. habei teeth showed a wider range of variation than that of the remaining species in regard to the acuteness of the middle lateral teeth.

Figure 7. 

Scanning micrographs of radular teeth of of Nipponacmea A N. gloriosa, RM32355, Ibusuki, Kagoshima (41) B N. gloriosa, RM31860, Tateyama, Chiba (13) C N. fuscoviridis, RM31858, Kimotsukicho, Kagoshima (42) D N. fuscoviridis, RM32354, Akune, Kagoshima (39) E N. fuscoviridis, RM31834, Rumoi, Hokkaido (1) F N. boninensis, RM31817, Chichijima Is., Ogasawara (43) G N. boninensis, RM31815, Chichijima Is., Ogasawara (43) H N. schrenckii, RM31915, Suo-Oshima, Yamaguchi (30) I N. schrenckii, RM31906, Kazamaura, Aomori (6) J N. schrenckii, RM31916, Nagatamachi, Nagasaki (35) K N. concinna, RM31831, Omura, Nagasaki (34) L N. concinna, RM32353, Nagatamachi, Nagasaki (35) M N. concinna, RM31823, Tahara, Aichi (19) N N. radula, RM31898, Hamamatsu, Shizuoka (18) O N. radula, RM31904, Omura, Nagasaki (34) P N. radula, RM32363, Akune, Kagoshima (37) Q N. nigrans, RM32360, Kushimoto, Wakayama (20) R N. nigrans, RM32359, Kushimoto, Wakayama (20) S N. nigrans, RM32358, Kushimoto, Wakayama (20) T N. habei, RM32364, Tateyama, Chiba (13) U N. habei, RM31872, Suttu, Hokkaido (3) V N. habei, RM31873, Usujiri, Hokkaido (5) W N. habei, RM32357, Usujiri, Hokkaido (5) X N. habei, RM32356, Tateyama, Chiba (13) Y N. teramachii, RM31926, Sanuki, Kagawa (28) Z N. teramachii, RM31924, Ohira, Oita (25). Scale bars: 50 μm.

(6) Ovary: The color of the ovary can be classified into three categories: green in N. fuscoviridis and N. schrenckii, red in N. boninensis and N. gloriosa, and brown in N. concinna, N. radula, N. teramachii, N. nigrans, and N. habei. The ovaries of all species in Clade B were pigmented brown, whereas those of Clade A were variable and are characterized by one of the three color patterns outlined above.

Morphometric analysis

The relationships among length, width, and height are indicated in Fig. 8 and were similar among species; however, the correlations between length and height, and between width and height differed. The results of Welch’s t-test using the proportion of length and height indicated that the apex height of Clade B (average H/L ratio = 0.27) was significantly higher than that of Clade A (average H/L ratio = 0.22; t = 5.24, P = 0.001). Applying the canonical discriminant analysis, only 51.9% of the original 130 individuals were assigned to the correct species (Fig. 9, Table 6). Therefore, it is difficult to distinguish between the nine genetic species solely from shell morphometry. Nipponacmea nigrans was discriminated best, with 23 out of 27 correctly matched individuals, while N. boninensis was the least discriminated, with 0 out of 3 individuals classified correctly.

Table 6.
Download as
CSV
XLSX

Canonical discriminant analysis for individuals of Nipponacmea species identified with mtDNA sequences.

Observed classification Predicted classification
1 2 3 4 5 6 7 8 9 % correct
1 N. gloriosa 8 0 0 3 0 0 0 0 0 72.7
2 N. fuscoviridis 0 23 0 0 1 1 2 0 2 79.3
3 N. boninensis 0 1 0 1 0 0 0 0 1 0.0
4 N. schrenckii 3 0 0 8 0 0 0 0 1 66.7
5 N. concinna 0 7 0 0 7 0 0 1 0 46.7
6 N. radula 0 4 0 0 2 1 0 1 0 12.5
7 N. nigrans 0 3 0 0 0 0 23 1 0 85.2
8 N. habei 0 1 0 0 0 0 6 2 0 66.7
9 N. teramachii 0 9 0 1 0 0 0 0 6 37.5
Figure 8. 

Relationships among shell length, width, and height.

Figure 9. 

Plot of the results of discriminant function analysis of shell length, width, and height for individuals of Nipponacmea species.

Discussion

Monophyly of species

The monophyly of Japanese Nipponacmea species has not been previously tested using molecular characters; however, it was strongly supported by the data obtained from the present study (Fig. 2). The taxonomy of patellogastropod species based on morphological characters can be frustrated due to polyphenism (Patelloida: Nakano and Ozawa 2005, Notoacmea scapha: Nakano and Spencer 2007; Nakano et al. 2009a) or the existence of cryptic species (Notoacmea species: Nakano and Spencer 2007; Nakano et al. 2009a, Nacella species; de Aranzamendi et al. 2009; González-Wevar et al. 2011). In the present study, neither polyphenism nor cryptic species were found in Nipponacmea.

Table 7.
Download as
CSV
XLSX

Holotype specimens, type localities, and geographic distribution of Nipponacmea species.

Species Holotype Type locality Geographic distribution
N. gloriosa (Habe, 1944) National Museum of Nature and Science,Tsukuba, NSMT-Mo 100675 Urado, Kochi Prefecture Pacific coast from Choshi to Kyushu, the Sea of Japan from Oga Peninsula to Kyushu, and rare in Seto Inland Sea; China.
N. fuscoviridis (Teramachi, 1949) Teramachi Collection in Toba Aquarium, missing Akune, Kagoshima Prefecture Pacific coast and the Sea of Japan from southern Hokkaido to Kyushu, and Ryukyu Islands; Korea, China.
N. boninensis (Asakura & Nishihama, 1987) National Museum of Nature and Science,Tsukuba, NSMT-Mo 64445 Yagyu-san, Chichijima Island, Ogasawara Islands Hachijo Island, Ogasawara Islands, and Northern Mariana Islands (Asuncion and Maug Islands)
N. schrenckii (Lischke, 1868) Unknown Nagasaki City Tsugaru Strait to Kyushu, and Seto Inland Sea; Korea, China.
N. concinna (Lischke, 1870) Unknown Nagasaki City Pacific coast and the Sea of Japan from Hokkaido to Kyushu, and Seto Inland Sea; Korea.
N. radula (Kira, 1961) Osaka Museum of Natural History, Kira Collection 525 Akune, Kagoshima Prefecture Pacific coast from Shizuoka Prefecture to Kyushu, the Sea of Japan from Yamaguchi Prefecture to Kyushu, and Seto Island Sea; Korea, China.
N. nigrans (Kira, 1961) Osaka Museum of Natural History, Kira Collection 540 Shionomisaki, Kii Peninsula Pacific coast and the Sea of Japan from Hokkaido to Kyushu, and Seto Inland Sea; Korea, China, Taiwan.
N. habei Sasaki & Okutani, 1994 National Museum of Nature and Science,Tsukuba, NSMT-Mo 69985 Shiragami-misaki, Matsumae, Hokkaido Pacific coast from Hokkaido to Izu Peninsula, the Sea of Japan from Hokkaido to Niigata Prefecutre
N. teramachii (Kira, 1961) Osaka Museum of Natural History, Kira Collection 554 Akune, Kagoshima Prefecture Pacific coast from Ojika Peninsula to Kyushu, western and northern Kyushu, and Seto Inland Sea; Korea, China.
N. formosa (Christiaens, 1977) Natural History Museum, London, No. 1977167 Northern Taiwan Taiwan
N. vietnamensis Chernyshev, 2008 Zoological Museum of Far East State University, No. 18852 Gulf of Tonkin Vietnam
N. moskalevi Chernyshev & Chernova, 2002 Zoological Museum of Far East State University, No H 2666 Japan Sea, Sukhoputnaya Bay Far East Russia

In this study, the maximum genetic distance within species was noticeably smaller than the minimum among species; therefore, the genetic distances were consistent with morphology-based species taxonomy. The maximum genetic distance within Japanese Nipponacmea species was 9.9% in COI in N. radula (Table 4). The minimum genetic distance was 17.8% in COI between N. boninensis and N. schrenckii. The genetic distances among species in Notoacmea in New Zealand ranged from 3.94% to 44.4% for COI, and distances within species were from 0.00% to 2.96% (Nakano and Spencer 2007; Nakano et al. 2009a). Thus, genetic distances are greatly variable among species in the New Zealand Notoacmea and the Japanese Nipponacmea.

A comparison of holotype and sequenced specimens from type localities (topotypes) is useful to confirm species identity. We investigated holotypes of seven species (N. radula, N. boninensis, N. habei, N. teramachii, N. nigrans, N. gloriosa, and N. formosa), excluding N. schrenckii, N. concinna, and N. fuscoviridis whose type materials are currently missing (Table 6). Morphological comparisons between sequenced specimens and holotypes were possible when considering characters related to shell surface sculpture (riblets and granules). In addition, sequence data of topotypes are important to precisely identify sequenced specimens. In this study, genetic variation was not significant among individuals of the four species collected from their type localities (N. boninensis, N. fuscoviridis, N. nigrans, and N. teramachii). The maximum genetic distances among COI sequences of topotypes of these species were 0.4% for N. boninensis, and 0.2% for N. fuscoviridis, N. nigrans, and N. teramachii. Thus, the molecular phylogeny corroborated the morphology-based taxonomy originally defined in the 1990s.

Phylogenetic relationships among Nipponacmea species

The results of the molecular phylogenetic analysis in this study revealed three major clades (N. gloriosa, Clade A, and Clade B), with N. gloriosa as sister to the other Nipponacmea species. This relationship is consistent with delineations observed based on major differences observed in radular morphology, food preference, and habitat. Nipponacmea gloriosa grazes exclusively on coralline algae, while the other species consume different materials, for example, N. concinna is known to graze on Ulva spp. (Kawakami and Habe 1986). Additionally, N. gloriosa is the only species that inhabits the subtidal zone; the others are restricted to the intertidal zone (Sasaki and Okutani 1993; Sasaki 2000, 2017).

Clade A was robustly supported with high bootstrap values by Nakano and Ozawa (2007) (BS = 99%) as well as in this study (BS = 100%). Branching order within the clade is as follows: N. radula, N. concinna, N. schrenckii, and N. fuscoviridis, with the latter as the most derived species in this clade. Nipponacmea boninensis was recently included in the phylogenetic analysis in this study and formed a clade with N. fuscoviridis. Asakura and Nishihama (1987) compared N. boninensis to N. schrenckii, but Nakano (2007) mentioned similarities between N. boninensis and N. fuscoviridis regarding morphological and ecological characters. In this study, the latter hypothesis was clearly supported.

The monophyly of Clade B was supported with relatively lower bootstrap values than that of Clade A (BS = 80% by Nakano and Ozawa (2007); and BS = 67% in this study). Phylogenetic relationships within Clade B were inconstant among different analyses. In this study, N. teramachii diverges first, and N. nigrans and N. habei are more closely related (BS = 75%). Previous studies revealed that N. nigrans is separated first, and N. habei and N. teramachii form a clade (BS = 80%) (Nakano and Ozawa 2007).

Differences exist in the aims and taxa sampled between our studies and previous research focused on Nipponacmea; however, the results are not contradictory. Compared to previous studies, we improved the phylogenetic analyses and validation of species taxonomy and taxonomic characters by: (1) obtaining novel sequence data from N. boninensis for the first time; (2) using the most diverse taxon sampling for Nipponacmea to date, including multiple specimens (ranging from 3 to 29) for each species, for a total of 130 specimens from 43 localities and 9 species; and (3) obtaining sequence data for Cytb in addition to other three mitochondrial (COI, 12S, and 16S rRNA) genes. The Cytb gene was used in this study since it evolves at higher rates than the 16S and is better for investigation of among-species and among-populations relationships.

Nipponacmea species taxonomy

The species taxonomy of Nipponacmea had long been confused prior to revision by Sasaki and Okutani (1993). The chief cause of this confusion and misidentification was an overemphasis of the importance of shell color pattern. Four to seven species occur sympatrically in temperate Japanese waters, and the distinction and taxonomic rank of these species or subspecies has been contested by various authors (see Sasaki and Okutani 1993 for details). A similar situation also existed in the New Zealand genus Notoacmea, before a phylogenetic analysis and taxonomic revision of this genus was performed by Nakano and Spencer (2007) and Nakano et al. (2009) reporting cryptic species and phenotypic polymorphisms. These anomalies were not found in the present study with Nipponacmea, and the DNA-based clades were consistent with the morphological species recognized by Sasaki and Okutani (1993). Based on the results of phylogenetic analysis, we discuss the validity and current issues concerning the definition of each species below.

(1) Nipponacmea gloriosa: N. gloriosa is the exclusive species living in the subtidal zone that grazes on coralline algae (Sasaki and Okutani 1993; Sasaki 2000, 2017). This species was originally described based on shell morphology, shell color, and radula (Habe 1944). The shell is reddish, while the head, cephalic tentacles, and side of the foot are not pigmented (Table 5). Juveniles of N. gloriosa can be easily distinguished from those of other Nipponacmea species by their reddish-brown radial lines (Sasaki 2006). On morphological grounds, Sasaki and Okutani (1994b) regarded Collisella cellanica from Hong Kong as a junior synonym of N. gloriosa; this species should be investigated using molecular phylogenetic analysis in the future. It is unclear whether N. gloriosa is present outside of Japan in places such as South Korea or Taiwan.

(2) Nipponacmea fuscoviridis: The holotype of N. fuscoviridis (Teramachi, 1949) was apparently held in the Toba Aquarium’s Teramachi Collection, but its location cannot be confirmed. Currently, the identity of this species is based on the topotype specimens collected by Teramachi and preserved in the Kira Collection (Sasaki et al. 2014). For an unclear reason N. fuscoviridis was previously regarded as a subspecies of N. concinna (Kira 1954; Habe and Kosuge 1967; Kuroda et al. 1971; Okutani and Habe 1975). Nipponacmea fuscoviridis is the only species of the genus found in the Ryukyu Islands (Sasaki and Okutani 1993; Sasaki and Nakano 2007), and it is also distributed in South Korea (Min 2001; Noseworthy et al. 2007) and China (Yu et al. 2014).

Two morphologically similar species are known from Taiwan and Vietnam. Christiaens (1980) described Collisella formosa from northern Taiwan based on shell and radula morphology, and Sasaki and Okutani (1994b) suggested that C. formosa belongs to Nipponacmea. We examined the holotype specimen and concluded that N. formosa is most similar to N. fuscoviridis based on color pattern and features of the shell sculpture. The validity of N. formosa should be verified by molecular characters in future studies. Chernyshev (2008) described N. vietnamensis from the Gulf of Tonkin, located in northern Vietnam. Nipponacmea vietnamensis is very similar to N. fuscoviridis, but it has a different shell color and a characteristic reddish ovary (Chernyshev 2008). The distribution of N. formosa and N. vietnamensis is geographically separate, but similarity in morphological features suggest they are phylogenetically close and, therefore, these species should also be compared using molecular makers.

(3) Nipponacmea boninensis: In the original description, N. boninensis was compared to N. schrenckii based on shell and radula morphology (Asakura and Nishihama 1987). However, Nakano (2007) highlighted that N. boninensis is more similar to N. fuscoviridis based on shell color patterns and habitat. In this study, we confirmed that N. boninensis is more closely related to N. fuscoviridis than N. schrenckii genetically. Morphologically this relationship is supported by the outline, apex height, and color pattern of the shell, as well as the pigmentation on the side of the foot, and arrangement of the radular sac (Table 5). The genetic distances indicate that N. boninensis is closely related to N. fuscoviridis according to the Cytb and 12S rRNA genes (17.1% and 5.6%, respectively). Therefore, N. boninensis is clearly differentiated from the other species morphologically and genetically, and should be regarded as an independent species.

Nipponacmea boninensis is an endemic species to the southern Izu Islands (Hachijo Island), Ogasawara Islands, and the northernmost part of the Northern Mariana Islands (Asuncion and Maug Islands: Asakura and Kurozumi 1991: figs 1–3). There are no other Nipponacmea species recorded in the Izu-Ogasawara Islands or southward of this region. Fukuda (1993, 1994, 1995a, b) stated that temperate mollusks in the Ogasawara Islands are conveyed by Kuroshio currents from southern Honshu. In the genus Cellana, ancestral species possibly reached the Ogasawara Islands through the Izu Islands as stepping-stones (Nakano et al. 2009b). Similar to Cellana, the ancestral species of N. boninensis was assumed to have migrated from Honshu to the Ogasawara Islands through the Izu Islands.

(4) Nipponacmea schrenckii: N. schrenckii has the lowest shell apex among Nipponacmea species (Takada 1992). Lischke’s (1868) holotype is apparently lost, but illustrations from the original literature are clear, leading to few challenges concerning the taxonomic status of the species (Table 6; Lischke 1869). Nipponacmea schrenckii also occurs in South Korea (Noseworthy et al. 2007) and China (Huang 2008; Liu 2008), but not in Taiwan.

(5) Nipponacmea concinna: Lischke’s (1870) type is also missing; however, we used the original illustration for identification purposes. Similar to examples of distinct color polymorphism in patellogastropods (Sasaki 1999a, b; Lindberg 2008; Nakano et al. 2010), N. concinna has two color forms (solid and spotted) with occasional intermediate variations (Fig. 3U–Y; Sasaki and Okutani 1993; Sasaki 2000, 2017). The results of this study revealed that these two morphs are intermingled in a single clade; thus, the color forms were proven to be intraspecific variations. The spotted form of N. concinna and N. radula are the most readily confused phenotypes; however, N. concinna can be distinguished by rounded granules and black pigmentation in the snout and the side of the foot. The presence of N. concinna outside of Japan and in South Korea has been confirmed (Min 2001; Noseworthy et al. 2007); however, no specimens have been found in China or Taiwan.

(6) Nipponacmea radula: The distribution of N. radula is limited to the southwest area of Japan, which is a small area compared to that of other Nipponacmea species. However, intraspecific genetic divergence is high for this genus. Nipponacmea radula tends to prefer sheltered environments, and its distribution areas are often isolated. This specialized habitat may lead to the large genetic distances across the entire geographic range of N. radula (within species 9.9% for COI: Table 4). Populations with large genetic distances are completely indistinguishable according to morphological features. The shell height for N. radula is relatively low for the genus, and the color pattern is considerably variable (Fig. 4A–E). In the past, this species was misidentified as N. concinna or regarded as a subspecies of N. concinna (Habe and Kosuge 1967; Nakamura 1986; Takada 1992). Nipponacmea radula was found outside of Japan, in South Korea (Min 2001; Noseworthy et al. 2007) and China (Yu et al. 2014), but not in Taiwan.

(7) Nipponacmea nigrans: The shell height of N. nigrans is relatively high, and the color patterns and shell shape are highly variable (Fig. 3K–T). The individuals from northeastern Japan are more darkly colored, whereas southwestern Japanese populations are lighter. Like N. radula, N. nigrans has been confused with N. concinna (or regarded as a subspecies of N. concinna) (Habe and Kosuge 1967; Kuroda et al. 1971; Nakamura 1986). Collisella mortoni, Christiaens, 1980 is possibly a junior synonym of this species (Sasaki & Okutani, 1994b). Another similar-looking species, N. moskalevi Chernyshev & Chernova, 2002 was described from Sukhoputnaya Bay, Russia based on differences in the sculpture of shell surfaces. In this species, arrangement of the radular sac and radula morphology is similar to that of N. nigrans. Relationships among N. nigrans and N. moskalevi should be tested using molecular makers in future studies. Nipponacmea nigrans also occurs in South Korea (Min 2001), China (Christiaens 1980; Yu et al. 2014), and Taiwan (Teruya pers. obs.).

(8) Nipponacmea habei: This species is distributed mainly in the cold-water region from the Izu Peninsula to southern Hokkaido on the Pacific coast and from Niigata Prefecture to southern Hokkaido in the Sea of Japan (Sasaki and Okutani 1994a; Sasaki 2000, 2017). Nipponacmea habei can be distinguished by its high shell-apex, the lack of a greenish hue inside of the shell, and dark pigmentation.

The arrangement of the radular sac and the morphology of the lateral teeth are more variable in N. habei than in other Nipponacmea species (Sasaki and Okutani 1994a), and molecular analysis confirmed that the variants belong to the same clade. The lateral teeth have two main forms (blunt and acute), but can also have an intermediate morphology. Sasaki and Okutani (1994a) presumed that the geographic distribution of the two radular forms is controlled by oceanic currents and different food biota, and a similar case was reported in Notoacmea scapha in New Zealand (Nakano and Spencer 2007; Nakano et al. 2009a). However, here we could not sufficiently test the hypothesis using molecular phylogenetic analyses due to the small number of localities and sequenced specimens (Fig. 2, Suppl. material 1: Fig. S1, Suppl. material 2: Fig. S2, Suppl. material 3: Fig. S3). Population genetic structure and morphological tendency should be examined in more detail in the future. Nipponacmea habei has not yet been found outside of Japan.

(9) Nipponacmea teramachii: Although the name of this species was originally proposed for a form with white radial rays, the shell color pattern of N. teramachii is highly variable (Fig. 4). Interestingly, N. teramachii juveniles are unexceptionally striated with white radial rays, and most individuals abruptly change their color pattern during ontogeny. According to this juvenile character, N. teramachii can easily be distinguished from other Nipponacmea species (Sasaki and Okutani 1993; Sasaki 2000, 2017). The variants of N. nigrans (e.g., Fig. 4J) with radial rays are similar to N. teramachii, but such specimens can be distinguished by the granules on the exterior shell surface. The habitat of N. teramachii is limited to slightly sheltered environments. The presence of N. teramachii outside of Japan was confirmed in South Korea (Noseworthy et al. 2007), China (Yu et al. 2014), but not in Taiwan.

Validity of morphological characters

Morphology-based studies of patellogastropods have explored various animal characteristics (Lindberg 1981, 1988; Sasaki and Okutani 1993; Ridgway et al. 1998; Sasaki 1998) in addition to the basics of shells and radulae (Pilsbry 1891; Suter 1904; Oliver 1926; Thiele 1929; Powell 1973; Ponder and Creese 1980). Comparison with molecular phylogeny confirmed the utility of shell and soft-part characters in Nipponacmea, as discussed below.

(1) Shell color pattern: the degree of variability in the shell color pattern is different among species, and the patterns are categorized into three types: (i) striking variations (N. radula, N. habei, N. nigrans, and N. teramachii), (ii) faint variations (N. schrenckii, N. gloriosa, N. boninensis, and N. fuscoviridis), and (iii) dimorphisms of solid or spotted patterns (N. concinna). In N. concinna, the distribution of color forms has a geographic bias maintained by unknown factors: the solid type is common to northeastern Japan, while the spotted type is frequently found in southwestern Japan. Northern individuals of N. nigrans and N. habei also tend to have dark colored shells. Another similar example is the Japanese mud snail, Batillaria attramentaria, which exhibits a shell color polymorphism in which darker morphs are distributed in colder regions and lighter morphs are more commonly found in warmer regions (Miura et al. 2007). The authors suggested that shell color polymorphism is caused by climatic selection, which could be the case for the shell color patterns of N. concinna, N. nigrans, and N. habei.

The shell of N. gloriosa is reddish brown and completely different from other Nipponacmea species (Fig. 3A–E). Patellogastropod species associated with coralline algae in the subtidal zone are generally known to have reddish or white shells (e.g., Niveotectura pallida, Tectura emydia, and Erginus sybariticus; Lindberg 2008), and N. gloriosa appears to follow this trend. In this case, the color of the shell might be derived from the pigment of the grazed algae.

(2) Shell sculpture: concerning shell sculpture, ribs and granules on the shell exterior are differentiated among species (Table 5). In multiple limpet groups, species living in sun-exposed rocky surfaces tend to have more prominent sculptures than those in shaded habitats (Vermeij 1973). However, this is not observed in Nipponacmea species. For instance, N. fuscoviridis is attached to the exposed surface during the highest tidal level, but has a delicately sculptured shell, while N. nigrans has the most remarkably ornamented ribs and granules, but prefers relatively sheltered environments, and N. concinna has notable granules, but is nocturnal and prefers shaded areas in the daytime (Sasaki pers. obs.). Hence, we cannot detect any fixed ecological pattern linked to microscopic shell sculpture within Nipponacmea.

(3) Apex height: Takada (1992) indicated quantitatively that there are variations in height among Nipponacmea species. For example, in the ratio of shell length to height, N. schrenckii has the lowest apex and N. nigrans had the highest among Nipponacmea species (fig. 2 in Takada 1992). Japanese species are separated into two groups: N. gloriosa and Clade A constitute the low-apex group, and Clade B comprises the high-apex one.

In Nipponacmea, the shell height is not relevant to the vertical distribution (Sasaki and Okutani 1993: fig. 28) in the tidal zone. It was previously assumed that variation in limpet apex height is correlated with habitat tidal level (Ino 1935; Vermeij 1973), whereby species with a higher shell apex are assumed to store a larger amount of seawater, which might be an adaptation to prevent desiccation (Vermeij 1973; Branch 1975). In this study, we confirmed that the shell height among Nipponacmea species is not correlated with tidal level distributions in the intertidal zone.

The topology of the phylogenetic tree implies that the high-apex group could be derived from the low-apex species, since the most basal species, N. gloriosa, and Clade A share a low apex. In the genus Notoacmea in New Zealand, 13 species formed two major clades; however, they were not based on shell height (Nakano et al. 2009a). Similarly, in the phylogeny of 15 Nacella species, shell height is not correlated with phylogeny (González-Wevar et al. 2011). Thus, shell height in general is not controlled by phylogeny in patellogastropod limpets (Nakano and Sasaki 2011).

(4) Animal pigmentation: we confirmed that the pigmentation of the snout, cephalic tentacle, and side of the foot is different among species (Fig. 5). The side of the foot of three species included in Clade B and N. schrenckii of Clade A tends to be pigmented in black. Ecologically, the dark pigmentation on the foot wall might be effective to avoid visible detection by predators. However, actual ecological significance is uncertain regarding the species-specific animal pigmentation patterns in Nipponacmea.

Nipponacmea gloriosa, which inhabits the subtidal zone, lacks pigmentation, and the pale coloration of this animal is possibly a consequence of its habitat. The limpets inhabiting the subtidal zone are unexceptionally pale (e.g., Niveotectura pallida, Tectura emydia, and Erginus sybariticus; Lindberg 2008). For species that inhabit the range from the middle to upper intertidal zone, animal pigmentation is unrelated to tidal level preference in Nipponacmea. For example, both N. concinna and N. fuscoviridis prefer higher tidal levels, but the former species is darkly pigmented, while the latter lacks pigmentation. Thus, it is not straightforward to correlate animal pigmentation patterns and habitats.

(5) Radular sac: the configuration of the radular sac has been regarded as a useful character for identification of Nipponacmea species (Sasaki and Okutani 1993; Sasaki 1999a, b). The looping of this pouch is categorized into four types: (i) a short single loop (N. gloriosa), (ii) an intermediate length loop (N. schrenckii, N. boninensis, N. nigrans, and N. teramachii), (iii) a long radular sac with two loops (N. concinna, N. fuscoviridis, and N. radula), and finally (iv) a variable type ranging from long to short loops (N. habei) (Sasaki and Okutani 1993). In addition to differences among species, vertical distribution in the intertidal zone appears to correlate with radular sac length in Nipponacmea, whereby the lengths are longer in species inhabiting the higher intertidal zone and shorter in those in the lower intertidal zone.

(6) Radula: the radula morphology is useful for classifying patellogastropod species (Habe 1944; Macpherson 1955; Moskalev 1970; Ponder and Creese 1980; Lindberg 1981; Lindberg and McLean 1981; Sasaki and Okutani 1993). Clarifying the relationship between food and the radula is important for understanding radula morphology (Lindberg 1988). Among Nipponacmea species, N. concinna is known to graze on green algae (Ulva spp.) (Kawakami and Habe 1986), and N. gloriosa is a specialist grazer on coralline algae. The limpets gazing on coralline algae tend to have blunt radula (e.g., Niveotectura pallida and Patelloida signatoides), whereas the other Nipponacmea species are more likely to reveal acute radulae; however, the teeth of N. boninensis and N. habei are slightly blunt for an unknown reason. At present, the relationship between radular teeth morphology and feeding habits is unclear for non-coralline algae grazers, since there is a lack of detailed data concerning their feeding preferences.

(7) Ovary: the ovaries of Nipponacmea species were categorized into three types: (i) green (N. fuscoviridis and N. schrenckii); (ii) red (N. boninensis and N. gloriosa); or (iii) brown (N. concinna, N. radula, N. teramachii, N. nigrans, and N. habei). In relation to the phylogeny, the ovaries of all species in Clade B are pigmented brown, whereas those of Clade A are variable.

In gastropods, the color of the ovary might be constrained according to taxonomic group (e.g., green in vetigastropods such as Haliotis and Turbo). However, the ovaries of patellogastropods have diversified into various colors. For example, the ovary is brown in Patelloida lanx and green in its congener P. conulus (Sasaki pers. obs.). The cause for ovary diversification and the ecological significance of color differences in the Patellogastropoda is unknown.

Future studies

In this study, we confirmed that current species identified of the Japanese Nipponacmea are corroborated by the results from molecular phylogenetic analyses including topotype sequence data, comparative anatomy, and the reinvestigation of type specimens. This study represents an important step towards the revision of the entire group of Asian Nipponacmea. Currently, studying Japanese species is important for two reasons: (1) 9 of 12 nominal species in the genus have been described from Japan, and (2) all Japanese species have older species names and nomenclatural priority over more recently described non-Japanese species. Nipponacmea formosa in Taiwan, N. vietnamensis in Vietnam, and N. moskalevi in Russia must be verified according to morphology, molecular phylogeny, and ecological traits in future studies. In conclusion, a more comprehensive reinvestigation of the genus Nipponacmea must be undertaken using taxonomic, phylogenetic, and phylogeographic analyses over a wide geographic range covering Japan, Korea, Russian Far East, China, Taiwan, and Vietnam.

Acknowledgements

We would like to thank Hirofumi Kubo, Jun Nawa, Kazuyoshi Endo, Kei Sato, Keisuke Shimizu, Kozue Nishida, Masanori Okanishi, Masashi Yamaguchi, Naoki Hashimoto, Rei Ueshima, Rie Nakano, Shigeaki Kojima, Takanobu Tsuihiji, Takashi Okutani, Takuma Haga, Tomoyasu Yamazaki, Yoshihisa Kurita, You Usami, Yusuke Takeda for assistance in sampling and useful suggeston. Also we thank Nobuyuki Suzuki, Hiroaki Fukumori, Rie Sakai, Ryo Nakayama, Saki Kamiyama, Takashi Muranaka, Tatsuki Tsuhako, Toshiaki Shitamitu, Youhei Otaki, Youichi Maeda who helped us to collect samples. This work was supported by Grants-in-Aid for Scientific Research (KAKENHI) no. 14J09937 to S. Teruya and 26291077, 19K21646 and 20H01381 to T. Sasaki from the Japan Society for Promotion of Science.

References

  • Asakura A, Nishihama S (1987) Studies on the biology and ecology of the intertidal animals of Chichijima Island in the Ogasawara Islands – II. Description, distribution, size structure in the population and allometric growth of the limpet, Notoacmea schrenckii boninensis n. subsp. Venus 46: 182–193.
  • Boore JL, Brown WM (2000) Mitochondrial genomes of Galathealinum, Helobdella, and Platynereis: sequence and gene arrangement comparisons indicate that Pogonophora is not a phylum and Annelida and Arthropoda are not sister taxa. Molecular Biology and Evolution 17: 87–106. https://doi.org/10.1093/oxfordjournals.molbev.a026241
  • Branch GM (1985b) Limpets: their role in littoral and sublittoral community dynamics. In: Moore PG, Seed R (Eds) The Ecology of Rocky Coasts. Hodder and Stoughton, London, 97–116.
  • Chernyshev AV, Chernova TV (2002) Nipponacmea moskalevi sp. nov. (Gastropoda, Lottiidae), a new species of limpets from the Japan Sea. Ruthenica 12: 19–22.
  • Chernyshev AV (2008) Nipponacmea vietnamensis sp. nov. (Gastropoda: Lottiidae), a new species of limpets from the Gulf of Tonkin (South China Sea). The Bulletin of the Russian Far East Malacological Society 12: 116–121.
  • Christiaens J (1980) The limpets of Hong Kong with descriptions of seven new species and subspecies. In: Morton (Ed.) Malacofauna of Hong Kong and Southern China, vol. 1. Hong Kong University Press, Hong Kong, 61–84.
  • de Aranzamendi MC, Gardenal NC, Martin JP (2009) Limpets of the genus Nacella (Patellogastropoda) from the southwestern Atlantic: species identification based on molecular data. Journal of Molluscan Studies 75: 241–251. https://doi.org/10.1093/mollus/eyp025
  • Folmer O, Black M, Hoen W, Lutz RA, Vrijenhoek CR (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.
  • Fukuda H (1993) Marine Gastropoda (Mollusca) of the Ogasawara (Bonin) Islands. Part 1. Archaeogastropoda and Neotaenioglossa. Ogasawaran Research 19: 1–85.
  • Fukuda H (1994) Marine Gastropoda (Mollusca) of the Ogasawara Islands (Bonin) Islands. Part 2: Neogastropoda, Heterobranchia and fossil species, with faunal accounts. Ogasawara Research 20: 1–126.
  • Fukuda H (1995a) Marine Gastropoda (Mollusca) of the Ogasawara Islands (Bonin) Islands. Part 3: Additional records. Ogasawara Research 21: 1–142.
  • Fukuda H (1995b) Marine Gastropoda and phylogeography of the Ogasawara Islands. In: Asakura A (Ed.) Voyage of Northern Mariana Islands. Bunichisogo Shuppan, Tokyo, 264–278.
  • Goldstien SJ, Gemmell NJ, Schiel DR (2009) Colonisation and connectivity by intertidal limpets among New Zealand, Chatham and sub-Antarctic Islands. I. Genetic connections. Marine Ecology Progress Series 388: 111–119. https://doi.org/10.3354/meps08046
  • González-Wevar CA, Nakano T, Cañete JI, Poulin E (2011) Concerted genetic, morphological and ecological diversification in Nacella limpets in the Magellanic Province. Molecular Ecology 20: 1936–1951. https://doi.org/10.1111/j.1365-294X.2011.05065.x
  • Habe T, Kosuge S (1967) Common Shells of Japan in Color. Hoikushya, Osaka, 223 pp. [+ 64 pls] [In Japanese]
  • Habe T (1944) On the family Lottiidae (= Acmaeidae) from Japan. Venus 13: 171–187. [In Japanese; original title translated]
  • Hebert PDN, Ratnasingham S, Dewaard JR (2003) Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London – Series B: Biological Sciences 270: S96–S99. https://doi.org/10.1098/rsbl.2003.0025
  • Huang ZG (2008) Marine species and their distribution in China. China Ocean Press, Beijing.
  • Ino T (1935) Shell variation of Cellana toreuma (Reeve) in relation to the environment. Bulletin of the Japanese Society of Scientific Fisheries 4: 31–36. https://doi.org/10.2331/suisan.4.31
  • Katoh K, Toh H (2008) Recent developments in the MAFFT multiple sequence alignment program. Briefings in Bioinformatics 9: 286–298. https://doi.org/10.1093/bib/bbn013
  • Kawakami H, Habe T (1986) Browsing Scar of Notoacmaea concinna (Lischke). Chiribotan 17: 32.
  • Kimura M (1980) A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111–120. https://doi.org/10.1007/BF01731581
  • Kira T (1959) Colored Illustrations of the Shells of Japan (Vol. I). Hoikusha Publishing, Osaka, 239 pp. [In Japanese]
  • Koufopanou V, Reid DG, Ridgway SA, Thomas RH (1999) A molecular phylogeny of patellid limpets (Gastropoda: Patellidae) and its implications for the origins of their antitropical distribution. Molecular Phylogenetics and Evolution 11: 138–156. https://doi.org/10.1006/mpev.1998.0557
  • Kuroda T, Habe T, Oyama K (1971) The Sea Shells of Sagami Bay. Maruzen, Tokyo, 1281 pp. [121 pls]
  • Lindberg DR, Mclean JH (1981) Tropical Eastern Pacific limpets of the family Acmaeidae (Mollusca, Archaeogastropoda): generic criteria and descriptions of six new species from the mainland and the Galápagos Islands. Proceedings of the California Academy of Sciences, fourth series 42: 323–339.
  • Lindberg DR (1979) Problacmea moskalevi Golikov and Kussakin, a new addition to the eastern Pacific limpet fauna. The Veliger 22: 57–61.
  • Lindberg DR (1981) Invertebrates of the San Francisco Bay Estuary System: Mollusca, Family Acmaeidae. The Boxwood Press, Pacific Grove, California, 120 pp.
  • Lindberg DR (1988) The Patellogastropoda. Malacological Review Supplement 4: 35–63.
  • Lischke CE (1868) Diagnosen neuer meeres Conchylien von Japan. Malakozoologisches Blatter 15: 218–222.
  • Lischke CE (1869) Japanische Meeres-Conchylien 1. Theodor Fischer, Cassel, 192 pp. [14 pls]
  • Lischke CE (1871) Japanische Meeres-Conchylien 2. Theodor Fischer, Cassel, 184 pp. [14 pls]
  • Liu RY (2008) Checklist of marine biota of China seas. Science Press, Beijing, 1267 pp.
  • Mauro A, Arculeo M, Parrinello N (2003) Morphological and molecular tools in identifying the Mediterranean limpets Patella caerulea, Patella aspera and Patella rustica. Journal of Experimental Marine Biology and Ecology 295: 131–143. https://doi.org/10.1016/S0022-0981(03)00291-0
  • Min DK (2001) Korean Mollusks with Color Illustration. Shell House, Seoul, 333 pp. [In Korean]
  • Miura O, Nishi S, Chiba S (2007) Temperature-related diversity of shell colour in the intertidal gastropoda Batillaria. Journal of Molluscan Studies 73: 235–240. https://doi.org/10.1093/mollus/eym019
  • Nakamura H (1986) Family Acmaeidae. In: Okutani T (Ed.) Molluscs (Color illustrated encyclopedia). Sekaibunka-sha, Tokyo, 38–40. [In Japanese]
  • Nakano T, Ozawa T (2004) Phylogeny and historical biogeography of limpets of the order Patellogastropoda based on mitochondrial DNA sequences. Journal of Molluscan Studies 70: 31–41. https://doi.org/10.1093/mollus/70.1.31
  • Nakano T, Ozawa T (2005) Systematic revision of Patelloida pygmaea (Dunker, 1860) (Gastropoda: Lottiidae), with a description of a new species. Journal of Molluscan Studies 71: 357–370. https://doi.org/10.1093/mollus/eyi039
  • Nakano T, Ozawa T (2007) Worldwide phylogeography of limpets of the order Patellogastropoda: molecular, morphological and paleontological evidence. Journal of Molluscan Studies 73: 79–99. https://doi.org/10.1093/mollus/eym001
  • Nakano T, Sasaki T (2011) Recent advances in molecular phylogeny, systematics and evolution of patellogastropod limpets. Journal of Molluscan Studies 77: 203–217. https://doi.org/10.1093/mollus/eyr016
  • Nakano T (2007) Distribution of patellogastropod limpets in the Ogasawara Islands, Japan. Chiribotan 37: 174–179. [In Japanese]
  • Nakano T, Marshall BA, Kennedy M, Spencer HG (2009a) The phylogeny and taxonomy of New Zealand Notoacmea and Patelloida species (Mollusca: Patellogastropoda: Lottiidae) inferred from DNA sequences. Molluscan Research 29: 33–59.
  • Nakano T, Sasaki T, Kase T (2010) Color polymorphism and historical biogeography of the Japanese patellogastropod limpet Cellana nigrolineata (Reeve) (Gastropoda: Nacellidae). Zoological Science 27: 811–820. https://doi.org/10.2108/zsj.27.811
  • Nakano T, Yamazaki T, Kurokawa M, Yamaguchi K, Kuwasawa K (2009b) The origin of the endemic patellogastropod limpets of the Ogasawara Islands in the northwestern Pacific. Journal of Molluscan Studies 75: 87–90. https://doi.org/10.1093/mollus/eyn036
  • Noseworthy RG, Lim N-R, Choi K-S (2007) A Catalogue of the Mollusks of Jeju Island, South Korea. Korean Journal of Malacology 23: 65–104.
  • Nylander JAA (2004) MrModeltest, version 2.3. Program distributed by the author. Evolutionary Biology Centre, Uppsala University, Uppsala.
  • Okutani T, Habe T (1975) Mollusca I, Chiefly from Japan. Gakken, Tokyo, 301 pp. [In Japanese]
  • Oliver WRB (1926) Australasian Patelloidinae. Transactions of the New Zealand Institute 56: 547–582.
  • Pilsbry HA (1891) Manual of Conchology, Structural and Systematic, with Illustrations of the Species. Vol. 13. Acmaeidae, Lepetidae, Patellidae, Titiscaniidae. Academy of Natural Sciences, Philadelphia, 195 pp.
  • Ponder WF, Creese RG (1980) A revision of the Australian species of Notoacmea, Collisella and Patelloida (Mollusca: Gastropoda: Acmaeidae). Journal of Malacological Society of Australia 4: 167–208. https://doi.org/10.1080/00852988.1980.10673927
  • Powell AWB (1973) The Patellid Limpets of the World (Patellidae). Indo-Pacific Mollusca 3: 75–206.
  • R Core Team (2014) R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna.
  • Reisser CMO, Marchall BA, Gardner JPA (2012) A morphometric approach supporting genetic results in the taxonomy of the New Zealand limpets of the Cellana strigilis complex (Mollusca: Patellogastropoda: Nacellidae). Invertebrate Systematics 26: 193–203. https://doi.org/10.1071/IS11042
  • Reisser CMO, Wood AR, Bell JJ, Gardner JPA (2011) Connectivity, small islands and large distances: the Cellana strigilis limpet complex in the Southern Ocean. Molecular Ecology 20: 3399–3413. https://doi.org/10.1111/j.1365-294X.2011.05185.x
  • Ridgway SA, Reid DG, Taylor JD, Branch GM, Hodgson AN (1998) A cladistic phylogeny of the family Patellidae (Mollusca: Gastropoda). Philosophical Transactions of the Royal Society London, Series B 353: 1645–1671. https://doi.org/10.1098/rstb.1998.0316
  • Sasaki T, Nakano T (2007) The Southernmost Record of Nipponacmea fuscoviridis (Patellogastropoda: Lottiidae) from Iriomote Island, Okinawa. Venus 66: 99–102.
  • Sasaki T, Okutani T (1993) New genus Nipponacmea (Gastropoda, Lottiidae): a revision of Japanese limpets hitherto allocated in Notoacmea. Venus 52: 1–40.
  • Sasaki T, Okutani T (1994a) Description of a new lottiid limpet, Nipponacmea habei, with special reference to morphology and distribution of two intraspecific populations. Venus 53: 1–20.
  • Sasaki T, Okutani T (1994b) Type specimens of four lottiid limpets described by J. Christiaens (1980) from Hong Kong. Venus 53: 129–132.
  • Sasaki T, Okutani T (1994c) An analysis on ‘Collisella heroldi’ complex (Gastropoda: Lottiidae), with description of three new species. Venus 53: 251–285.
  • Sasaki T (1998) Comparative anatomy and phylogeny of the recent Archaeogastropoda (Mollusca: Gastropoda). University Museum University of Tokyo Bulletin 38: 1–223.
  • Sasaki T (1999a) A review on systematics of patellogastropoda limpets (Mollusca: Gastropoda) in Japan. In: Okutani T, Ota S, Ueshima R (Eds) Recent Advances in Marine Invertebrate Zoology. Tokai University Press, Tokyo, 101–119. [In Japanese]
  • Sasaki T (1999b) The present state and problems of the taxonomy of Japanese Patellogastropoda limpets. Part 2. Lottiidae. Chiribotan 29: 37–46. [In Japanese]
  • Sasaki T (2000) Patellogastropoda. In: Okutani T (Ed.) Marine Mollusks in Japan. Tokai University Press, Tokyo, 24–33.
  • Sasaki T (2017) Patellogastropoda. In: Okutani T (Ed.) Marine Mollusks in Japan. 2nd edn. Tokai University Press, Kanagawa, 738–744. [pls 12–16]
  • Sasaki T (2006) The protoconch and early teleoconch of Nipponacmea gloriosa (Patellogastropoda: Lottiidae). Chiribotan 37: 72–73.
  • Sasaki T, Ishida S, Nakano T, Teruya S (2014) Patellogastropoda in the Kira Collection deposited in the Osaka Museum of Natural History. Chiribotan 45: 62–71. [In Japanese]
  • Simison WB, Lindberg DR (1999) Morphological and molecular resolution of a putative cryptic species complex: a case study of Notoacmea fascicularis (Menke, 1851) (Gastropoda: Patellogastropoda). Journal of Molluscan Studies 65: 99–109. https://doi.org/10.1093/mollus/65.1.99
  • Simison WB, Lindberg DR (2003) On the identity of Lottia strigatella (Carpenter, 1864) (Patellogastropoda: Lottiidae). The Veliger 46: 1–19.
  • Suter H (1904) Mollusca. In: Hutton FW (Ed.) Index faunae Novae Zealandiae. Dulau, London, 57–95.
  • Takada T (1992) Multivariate analysis of shell morphology of Notoacmea spp. in Amakusa. Venus 51: 175–185.
  • Takahashi G, Okamoto M (1969) Catalogue of Molluscan Shells of Fukuoka Prefecture. Published by the authors, Fukuoka, 154 pp. [In Japanese]
  • Talavera G, Castresana J (2007) Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Systematic Biology 56: 564–577. https://doi.org/10.1080/10635150701472164
  • Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution 30: 2725–2729. https://doi.org/10.1093/molbev/mst197
  • Teramachi A (1949) An attempt to find a new collection field of shells in Prov. Satsuma, with a description of a new limpet, Notoacmea fuscoviridis. Venus 15: 90–93. [In Japanese]
  • Thiele J (1929) Handbuch der systematischen Weichtierkunde. 1. Gustav Fischer, Jena, 376 pp.
  • Vermeij GJ (1973) Mophological patterns in high-intertidal gastropods: adaptive strategies and their limitations. Marine Biology 20: 319–346. https://doi.org/10.1007/BF00354275
  • Yu SS, Wang J, Wang QL, Huang XW, Dong YW (2014) DNA barcoding and phylogeographic analysis of Nipponacmea limpets (Gastropoda: Lottiidae) in China. Journal of Molluscan Studies 80: 420–429. https://doi.org/10.1093/mollus/eyu034
  • Zwickl DJ (2006) Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. PhD Thesis. University of Texas at Austin, 115 pp.

Supplementary materials

Supplementary material 1 

Figure S1

Shinnosuke Teruya, Davin H. E. Setiamarga, Tomoyuki Nakano, Takenori Sasaki

Data type: Phylogenetic tree

Explanation note: Fig. S1. Maximum likelihood phylogenetic tree of COI. Numbers above or below the branches are ML bootstrap and Bayesian posterior probabilities, respectively.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (726.65 kb)
Supplementary material 2 

Figure S2

Shinnosuke Teruya, Davin H. E. Setiamarga, Tomoyuki Nakano, Takenori Sasaki

Data type: Phylogenetic tree

Explanation note: Fig. S2. Maximum likelihood phylogenetic tree of Cytb. Numbers above or below the branches are ML bootstrap and Bayesian posterior probabilities, respectively.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (718.67 kb)
Supplementary material 3 

Figure S3

Shinnosuke Teruya, Davin H. E. Setiamarga, Tomoyuki Nakano, Takenori Sasaki

Data type: Phylogenetic tree

Explanation note: Fig. S3. Maximum likelihood phylogenetic tree of 12S rRNA. Numbers above or below the branches are ML bootstrap and Bayesian posterior probabilities, respectively.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (1.23 MB)
Supplementary material 4 

Figure S4

Shinnosuke Teruya, Davin H. E. Setiamarga, Tomoyuki Nakano, Takenori Sasaki

Data type: Phylogenetic tree

Explanation note: Fig. S4. Maximum likelihood phylogenetic tree of 16S rRNA. Numbers above or below the branches are ML bootstrap and Bayesian posterior probabilities, respectively.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (665.47 kb)
login to comment