Research Article
Print
Research Article
The mitochondrial genome of the land snail Cernuella virgata (Da Costa, 1778): the first complete sequence in the family Hygromiidae (Pulmonata, Stylommatophora)
expand article infoJun-Hong Lin, Weichuan Zhou§, Hong-Li Ding|, Pei Wang§, Hong-Mu Ai|
‡ Fujian Agriculture and Forestry University College of Plant Protection, Fujian Agriculture and Forestry University, Fuzhou, China
§ Inspection and Quarantine Technical Centre, Fujian Entry-Exit Inspection & Quarantine Bureau, Fuzhou, China
| College of Plant Protection, Fujian Agriculture and Forestry University, Fuzhou, China
Open Access

Abstract

The land snail Cernuella virgata (da Costa, 1778) is widely considered as a pest to be quarantined in most countries. In this study, the complete mitochondrial genome of C. virgata is published. The mitochondrial genome has a length of 14,147 bp a DNA base composition of 29.07% A, 36.88% T, 15.59% C and 18.46% G, encoding 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes and two ribosomal RNA (rRNA) genes. The complete nucleotide composition was biased toward adenine and thymine, A+T accounting for 69.80%. Nine PCGs and 14 tRNA genes are encoded on the J strand, and the other four PCGs and eight tRNA genes are encoded on the N strand. The genome also includes 16 intergenic spacers. All PCGs start strictly with ATN, and have conventional stop codons (TAA and TAG). All tRNAs fold into the classic cloverleaf structure, except tRNAArg, tRNASer(UCN), tRNASer(AGN) and tRNAPro. The first three lack the dihydrouridine arm while the last lacks the TψC arm. There are 502 bp long noncoding regions and 418bp long gene overlaps in the whole mitochondrial genome, accounting for 3.54% and 2.95% of the total length respectively. Phylogenetic analyses based on the sequences of the protein coding genes revealed a sister group relationship between the Hygromiidae and the Helicidae.

Keywords

DNA sequencing, phylogeny, plant quarantine, secondary structure, white snail

Introduction

The land snail Cernuella virgata (da Costa, 1778), also known as the Mediterranean white snail or Common white snail, is endemic to the Mediterranean and western Europe, and has been introduced to America, Australia and Morocco (Barker 2004). The snail is omnivorous, feeding on detritus and plant matter, such as bark, stems and leaves of various green plants. Not only does it destroy agricultural crops, such as beans, cereal, various fruits and vegetables, it also can spread zoonotic food-borne parasitic diseases. For example, the species acts as intermediate host for the terrestrial trematode parasite Brachylaima cribbi (Kerney and Cameron 1979; Butcher and Grove 2006). Because of its remarkable adaptability and the severe damage it causes to agriculture, the natural environment and humans, the snail is considered a serious pest in the USA, Australia, Japan, Chile and other countries (Dennis 1996; Barker 2004; USDA 2008; MOA and AQSIQ 2012). One ship carrying barley from Australia was refused entry and berthing by Chile because of the presence of this snail causing huge economic losses (USDA 2008). It is also one of the more important quarantine terrestrial mollusks in America. To prevent invasion and proliferation, the U.S. government has invested considerable human and financial resources to eradicate the snails in Washington, Michigan and North Carolina (USDA 2008). Recently, Chinese ports have intercepted snails in barley, rapeseed and other consignments from abroad. Owing to its great harm, the snail was listed in “The People’s Republic of China entry plant quarantine pest list” by the government in 2012 to prevent its introduction (MOA and AQSIQ 2012).

The metazoan mitochondrial (mt) genome usually comprise 37 genes and some noncoding regions, such as 13 protein coding genes (PCGs) (COICOIII, Cytb, ND1ND6, ND4L, ATP6 and ATP8), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes and the AT-rich region or control region (Wolstenholme 1992; Boore 1999). It has been extensively used to study the origin of species, phylogeography and population genetic structure and so on due to its small genome size, fast evolution, uniparental inheritance and lack of extensive recombination (Saccone et al. 1999; Elmerot et al. 2002). To date, only nine species from the order Stylommatophora have been determined as dispersing in Helicidae (Terrett et al. 1995; Groenenberg et al. 2012; Gaitán-Espitia et al. 2013), Bradybaenidae (Yamazaki et al. 1997; Deng et al. 2014), Clausiliidae (Hatzoglou et al. 1995), Succineidae (White et al. 2011), Achatinidae (He et al. 2014) and Camaenidae (Wang et al. 2014). However, there are no reports on the mt genome of the family Hygromiidae. In this work, the complete mt genome of the snail C. virgata was obtained firstly using primer walking and shotgun sequencing techniques based on PCR. Studying the mitochondrial genome of C. virgata can not only offer more worthwhile information for phylogeny but also be applied to molecular alignment and identification in international plant quarantine measures.

Materials and methods

Specimen collection and DNA isolation

Adult snail was intercepted from barley shipments imported to China from southern Australia on 1 March 2012 and stored at -20 °C in the Key Laboratory of Molluscan Quarantine and Identification of AQSIQ, Fujian Entry-Exit Inspection & Quarantine Bureau, Fuzhou, Fujian, China (FJIQBC). Voucher specimens (FJIQBC000123) were deposited in FJIQBC. Total genomic DNA was obtained from approximately 50 mg fresh foot tissue, using the DNeasy Blood and Tissue kit (Qiagen) according to the manufacturer’s instructions.

DNA sequencing

The entire genome was successfully amplified by polymerase chain reaction (PCR) in overlapping fragments with four pairs of mitochondrial universal primers chosen from previous works (Palumbi et al. 1991; Folmer et al. 1994; Merritt et al. 1998; Hugall et al. 2002) and four pairs of perfectly matched primers designed from sequenced short fragments with Primer Premier 5.0 (Table 1). Short PCRs (< 2 kb) were performed using Takara Taq DNA polymerase (TaKaRa, Dalian, China), with the following cycling conditions: 30s at 94 °C, followed by 35 cycles of 10s at 94 °C, 50s at 40 °C or 45 °C, and 1 min at 72 °C. The final elongation step was continued for 10 min at 72 °C. Long range PCRs (> 4 kb) were performed using Takara Long Taq DNA polymerase (TaKaRa, Dalian, China) under the following cycling conditions: 1 min at 94 °C, followed by 40 cycles of 10s at 98 °C, 50s at 60 °C, 4−8 min at 68 °C, and the final elongation step at 72 °C for 6 min. The PCR products were checked by spectrophotometry and 1.0% agarose gel electrophoresis.

Primer pairs used for PCR amplification.

No. of fragment Primer name Nucleotide sequence (5’ – 3’) and location Size (bp) Reference
1 LCO-1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994
HCO-2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. 1994
2 F1231 GAACGGGTTAGTTTGTTTGTCT(490–511) 1763 Present study
R1231 TAGGGTCTTCTCGTCTATTATGGT(2229–2252) Present study
3 16Sar-L CGCCTGTTTATCAAAAACAT Palumbi et al. 1991
16Sbr-H CCGGTCTGAACTCAGATCACGT Palumbi et al. 1991
4 123F116 TGTAACCATAATAGACGAGAAGACC(2225–2249) 4545 Present study
123R1b TAGGAGCAAAAAATACTACCAGAAA(6745–6769) Present study
5 144F TGAGSNCARATGTCNTWYTG Merritt et al. 1998
272R GCRAANAGRAARTACCAYTC Merritt et al. 1998
6 123Fb CTTTTCACCCCTACTTTAC(6683–6701) 1044 Present study
123RII ACTCCCTTTCAGGTGTTAT(7708–7726) Present study
7 FCOII AAATAATGCTATTTCATGAYCAYG Hugall et al. 2002
RCOII GCTCCGCAAATCTCTGARCAYTG Hugall et al. 2002
8 F1233 AGTTACATTGGCCCTCCCTAGTCTTCGC(7560–7587) 6930 Present study
R1233 GTAAACGGTTCAACCTGTACCAGCTCCC(315–342) Present study

The BigDye Terminator Sequencing Kit (Applied Biosystems, San Francisco, CA, USA) and the ABI PRIMERTM 3730XL DNA Analyzer (PE Applied Biosystems) were used to sequence short fragments from both directions after purification. For the long fragments, the shotgun libraries of C. virgata were constructed, and the positive clones were then sequenced using the above kit and sequenator with vector-specific primers BcaBest primer M13-47 and BcaBest Primer RV-M.

Genome annotation and inference of secondary structure

To control sequencing errors, each partial sequence was evaluated at least twice. Annotations and editing procedures of the mitochondrial genomes of C. virgata were performed in MEGA5.0. Mitochondrial PCGs and rRNA genes were identified by BLAST searches at NCBI against other Eupulmonata sequences (Wang et al. 2014; He et al. 2014; Deng et al. 2014; Yang et al. 2014). The limits of both protein coding and rRNA genes were adjusted manually based on location of adjacent genes, and the presence of start and stop codons. The tRNA genes were located using DOGMA (Wyman et al. 2004) and tRNAscan-SE v.1.21(Lowe and Eddy 1997), while others that could not be determined by DOGMA and tRNAscan-SE were identified by comparison with other land snails (Terrett et al. 1995; Yamazaki et al. 1997; Groenenberg et al. 2012; Gaitán-Espitia et al. 2013; Wang et al. 2014).

The base composition and codon usage were analyzed with MEGA 5.0 (Tamura et al. 2007). AT skew and GC skew were used to describe strand asymmetry according to the formulae AT = [A−T]/[A+T] and GC = [G−C]/[G+C] (Perna and Kocher 1995).

Phylogenetic analyses

Phylogenetic analyses were performed based on 15 complete mt genomes of gastropods from GenBank (Table 2) using maximum likelihood (ML) method. Two species from Basommatophora and Opisthobranchia were selected as outgroups. A DNA alignment with 10,362 bp length was inferred from the amino acid alignment of 13 PCGs using MEGA 5.0 (Tamura et al. 2007). The selection of best-fit-substitution model for ML estimation was performed using MEGA 5.0 with corrected Akaike information criterion (AIC). Node supports for ML analyses were calculated through 1000 bootstrap replicates. All other settings were kept as default.

Summary of samples used in this study.

Subclass /order Family Species Accession number Reference
Stylommatophora Hygromiidae Cernuella virgata KR736333 Present study
Camaenidae Camaena cicatricosa KM365408 Wang et al. 2014
Camaena sp. KT001074 Ding et al. 2015 (submitted)
Bradybaenidae Euhadra herklotsi Z71693Z71701 Yamazaki et al. 1997
Mastigeulota kiangsinensis KM083123 Deng et al. 2014
Aegista diversifamilia KR002567.1 Huang et al. 2015
Dolicheulota formosensis KR338956.1 Huang et al. 2015
Helicidae Cornu aspersum JQ417195 Gaitán-Espitia et al. 2013
Cepaea nemoralis CMU23045 Terrett et al. 1995
Cylindrus obtusus JN107636 Groenenberg et al. 2012
Succineidae Succinea putris JN627206 White et al. 2011
Clausiliidae Albinaria caerulea X83390 White et al. 2011
Achatinidae Achatina fulica NC024601 He et al. 2014
Basommatophora Lymnaeidae Galba pervia JN564796 Liu et al. 2012
Opisthobranchia Aplysiidae Aplysia californica AY569552 Knudsen et al. 2006

Results

Genome structural features

The entire circular genome was 14,147 bp in length (GenBank: KR736333), containing 13 PCGs, 22 tRNA genes and two rRNA genes (Figure 1). Twenty-four genes were encoded on the majority coding strand (J strand) while 13 genes were encoded on the minority coding strand (N strand) (tRNAGln, tRNALeu(UUR), tRNAAsn, tRNAArg, tRNAGlu, tRNAMet, tRNASer(UCN), tRNAThr, ATP6, ATP8, ND3, COIII and SrRNA) (Table 3). The nucleotide composition of the whole genome was biased toward adenine and thymine, accounting for 69.80% of base composition (Table 4). Gene overlaps with a total of 418 bp have been found at 14 gene junctions; the longest overlap (85 bp) existed between ND5 and ND1. In addition, 502 nucleotides were dispersed in 16 intergenic spacers, the largest of which was 149 bp long between tRNATrp and tRNAGly. Additionally, two long spacers of 77 bp and 76 bp each were found between ND4L and ND1, tRNASer(UCN) and tRNASer(AGN), respectively. There were seven close gene junctions with no intergenic spacers or overlap (Table 3).

Figure 1.

The mt genome of Cernuella virgata. The tRNA genes are labeled based on the IUPACIUB single letter amino acid codes. Genes with underline illustrate the direction of transcription from 3’ to 5’, and without underline revealing from 5’ to 3’. Numbers and overlapping lines within the circle indicate PCR fragments amplified for sequencing (see Table 1).

Organization of the Cernuella virgata mt genome.

Gene Direction Location Size (bp) Anticodon Start codon Stop codon Intergenic nucleotides
COI F 1–1497 1497 ATT TAA 26
tRNAVal F 1494–1554 61 1524–1526 TAC –4
lrRNA F 1555–2567 1013 0
tRNALeu(CUN) F 2568–2628 61 2597–2599 TAG 0
tRNAPro F 2629–2685 57 2655–2657 TGG 0
tRNAAla F 2687–2748 62 2718–2720 TGC 1
ND6 F 2767–3222 456 ATA TAA 18
ND5 F 3227–4888 1662 ATT TAA 4
ND1 F 4804–5769 966 ATG TAG –85
ND4L F 5847–6215 369 ATT TAA 77
CytB F 6151–7167 1017 ATA TAG –65
tRNAAsp F 7157–7214 58 7188–7190 GTC –11
tRNACys F 7215–7276 62 7245–7247 GCA 0
tRNAPhe F 7283–7341 59 7313–7315 GAA 6
COII F 7387–8031 645 ATT TAA 45
tRNATyr F 8015–8083 69 8046–8048 GTA –17
tRNATrp F 8071–8132 62 8102–8104 TCA –13
tRNAGly F 8282–8341 60 8311–8313 TCC 149
tRNAHis F 8338–8398 61 8369–8371 GTG –4
tRNAGln R 8400–8457 58 8427–8429 TTG 1
tRNALeu(UUR) R 8457–8513 57 8485–8487 TAA –1
ATP8 R 8485–8754 270 ATG TAA –29
tRNAAsn R 8743–8804 62 8771–8773 GTT –12
ATP6 R 8807–9472 666 ATG TAA 2
tRNAArg R 9458–9517 60 9489–9491 TCG –15
tRNAGlu R 9518–9578 61 9547–9549 TTC 0
SrRNA R 9579–10277 699 0
tRNAMet R 10278–10343 66 10306–10308 CAT 0
ND3 R 10304–10735 432 ATA TAA –40
tRNASer(UCN) R 10691–10743 53 10723–10725 TGA –45
tRNASer(AGN) F 10820–10880 61 10844–10846 GCT 76
ND4 F 10904–12178 1275 ATT TAG 23
tRNAThr R 12182–12246 65 12210–12212 TGT 3
COIII R 12170–13051 882 ATG TAA –77
tRNAIle F 13068–13127 60 13096–13098 GAT 16
ND2 F 13182–14060 879 ATA TAG 54
tRNALys F 14062–14121 60 14090–14092 TTT 1

Protein coding genes

The total length of all PCGs was 10, 977 bp, accounting for 77.59% of the entire mt genome (Table 4). All PCGs started strictly with the Start Codon ATN (four with ATG, five with ATT, and four with ATA) and ended with the conventional stop codons TAA or TAG. (Table 3).

Nucleotide composition and skewness of the Cernuella virgata mt genome.

Proportion of nucleotides
Feature %A %T %G %C %A+T AT Skew GC Skew No. of nucleotides
Whole genome 29.07 36.88 18.46 15.59 69.80 –0.12 0.08 14147
Protein coding genes 26.39 39.31 18.43 15.87 69.26 –0.20 0.07 10977
Protein coding genes (J) 26.08 39.96 18.70 15.26 69.17 –0.21 0.10 8739
Protein coding genes (N) 27.61 36.77 17.38 18.23 69.67 –0.14 –0.02 2034
tRNA genes 31.46 34.23 18.73 15.58 71.41 –0.04 0.09 1335
tRNA genes (J) 29.82 34.77 20.30 15.10 70.77 –0.08 0.15 788
tRNA genes (N) 33.82 33.46 16.45 16.27 72.54 0.01 0.01 547
rRNA genes 32.83 35.63 17.00 14.54 72.42 –0.04 0.08 1712

Codon usage could reveal nucleotide bias. NNA and NNU as codons were used frequently in most PCGs. Additionally, the codons TTT (phenylalanine), TTA (leucine) and ATT (isoleucine) composing A and T were used widely (Figure 2).

Figure 2.

Relative synonymous codon usage (RSCU) in the Cernuella virgata mt genome. Codon families are provided on the x axis.

Transfer RNA genes

The length of tRNA genes ranged from 53 to 69 bp.The 22 tRNA genes typically found in metazoan mt genomes were also discovered in C. virgata; eleven of them were determined by tRNAscan-SE and eight of them were determined by DOGMA. Another three tRNA genes that could not be detected by the above two programs were identified and passed through comparisons with known patterns of previous research Fourteen tRNA genes were encoded on the J strand and the remainder on the N strand. Most tRNA genes could be folded into classic clover leaf structures except for tRNAArg, tRNASer(UCN) and tRNASer(AGN), which lack the dihydrouridine arm. The gene tRNAPro has a loop in its TψC arm (Figure 3).

Figure 3.

Inferred secondary structures of 22 tRNA genes in Cernuella virgata. Dashes (-) indicate Watson-Crick base pairing and bullets (•) indicate G-U base pairing.

In some tRNA genes, non-Watson-Crick matches and aberrant loops had been found. For example, a total of 41 unmatched base pairs existed in some tRNAs, and 18 of them were G-U non-classical pairs, most of which existed in Discriminator nucleotide, anticodon arm and Dihydrouridine arm (Figure 3).

Ribosomal RNA genes

The rRNA genes of C. virgata encompassed the lrRNA and srRNA genes with a length of 1,013 bp and 699 bp, repsectively. The former was situated between tRNAVal and tRNALeu(CUN) and the latter was located between tRNAGlu and tRNAMet (Table 3).

Noncoding regions

In the mitochondrial genome of C. virgata, there are 16 noncoding regions with total 502 bp length, accounting for 3.54%. The longest was 149bp, between tRNATrp and tRNAGly. The shortest was 1 bp existing three regions, respectively locating tRNAPro and tRNAAla, tRNAHis and tRNAGln, ND2 and tRNALys (Table 3).

Phylogenetic reconstruction

The ML tree (Figure 4) presented nine major clades containing the families Helicidae, Hygromiidae, Camaenidae, Bradybaenidae, Succineidae, Clausiliidae, Achatinidae, Lymnaeidae and Aplysiidae. The four bradybaenid species and three helicid species each formed a clade and a sister pair. In addition, we found that Camaenidae and Bradybaenidae each were monophyletic and also in a sister group relationship with each other.

Figure 4.

Phylogenetic tree inferred by maximum likelihood (ML) method based on 13 protein genes. The tree is rooted with Aplysis californica and Galba pervia. Numbers on the nodes represent bootstrap values.

Discussion

The length of mt genome of C. virgata was 304 bp longer than Camaena cicatricosa and 97 bp longer than Cornu aspersum. All gene directions showed similarity to the sequenced mt genome of C. cicatricosa, but gene order was different, especially with respect to the positions between CYTB and ATP8 genes (Gaitán-Espitia et al. 2013; Wang et al. 2014). The overall mt genome of C. virgata was loose particularly, with more and longer intergenic spacers.

In the study of mt genome of C. cicatricosa, GTG is the start codon of the COII gene, and COI and ND6 genes of C. aspersum start with TTG (Gaitán-Espitia et al. 2013; Wang et al. 2014). From previous studies we can see that most start signals of land snails were consistent with C. virgata factually, but ATC, TTA, TTG, CTT, TCG and CGA as start signals have been found (Raay and Crease 1994; Crease 1999; Yamazaki et al. 1997; Yu et al. 2007; Groenenberg et al. 2012; Gaitán-Espitia et al. 2013; Wang et al. 2014). Conventional stop codons TAA and TAG have been found in all PCGs of C. virgata, which corresponds to C. cicatricosa (Wang et al. 2014). However, COII, CYTB, ND3 and ATP8 genes of C. aspersum from the family Helicidae ended with T, and this phenomenon has also been discovered in other snails as well (Terrett et al. 1995; Hatzoglou et al. 1995; Yamazaki et al. 1997; White et al. 2011; Groenenberg et al. 2012; Wang et al. 2012; Gaitán-Espitia et al. 2013). Some authors suggested that this nucleotide exchange was caused by post-transcriptional polyadenylation (Ojala et al. 1981; Cha et al. 2007).

Usually, in the tRNA, the Acceptor arm (7 bp) and Anticodon arm (5 bp) were conservative in size (Kinouchi et al. 2000). However, the length of Acceptor arm of tRNALeu(CUN) in C. virgata was distinctive, with only 4 bp in size. The Anticodon arm of tRNASer(AGN) (8 bp) and all Anticodon loops (7 nucleotides) was coincident with the snail C. cicatricosa (Wang et al. 2014). The remaining arms and loops changed apparently in size comparing to that of other land snails (Hatzoglou et al. 1995; Groenenberg et al. 2012; Wang et al. 2014). Some non-Watson-Crick matches existed in all tRNA, including G-U pairs, A-C mismatch, U-C mismatch etc. Tomita et al. (2001) raised that these mismatches may can be rectified by post-transcriptional RNA-editing mechanism to hold tRNA function.

Noncoding regions are assumed to splice recognition sites during the process of transcription (He et al. 2005). In the previous sequenced complete mt genome of the order Stylommatophora, the noncoding regions range from 1 bp to 65 bp (Hatzoglou et al. 1995; Terrett et al. 1995; Yamazaki et al. 1997; White et al. 2011; Groenenberg et al. 2012; Gaitán-Espitia et al. 2013; Deng et al. 2014; Wang et al. 2014) except Achatina fulica with 551 bp length (He et al. 2014). In metazoan mt genomes, these noncoding regions are normal. The longest one can be called control region or AT-rich region (Boore 1999). Usually, changes in length of the whole mt genome are mainly caused by difference of the control region (Zhang and Hewitt 1997). However, the control region may not be aligned accurately in gastropods (Groenenberg et al. 2012) except in A. fulica which included a 551 bp putative control region (POR) between COI and tRNAVal (He et al. 2014). Another ten sequenced stylommatophoran species may possess short putative control region located in different places (Hatzoglou et al. 1995; Terrett et al. 1995; Yamazaki et al. 1997; White et al. 2011; Groenenberg et al. 2012; Gaitán-Espitia et al. 2013; Deng et al. 2014; Wang et al. 2014; Huang et al. 2015; 2015). The PORs of C. virgata, Mastigeulota kiangsinensis and Dolicheulota formosensis are situated adjacent to tRNATrp, at 149 bp, 216 bp and 245 bp respectively. The PORs of C. cicatricosa (29 bp) and Succinea putris (48 bp) were located between COIII and tRNAIle. Two other helicid species had PORs located between COIII and tRNASer with lengths of 158–186 bp, whereas the PORs of Albinaria caerulea (65 bp), Aegista diversifamilia (93 bp), Cylindrus obtusus (395 bp) and Euhadra herklotsi (78 bp) were specific, respectively between ND3 and tRNASer, tRNAMet and tRNASer, ND5 and tRNAAla, tRNASe r (UCN) and tRNASer(AGN). The absence of a control region was consistent with other gastropods (Deng et al. 2014; Wang et al. 2014; Yang et al. 2014). In the present study, the longest noncoding region was 149 bp, which was the second longest one by far.

Three species in the Helicidae were sister groups and consistent with previous works (Gaitán-Espitia et al. 2013). However, the systematics of Camaenidae, Helicidae and Bradybaenidae are complicated and have not been fully resolved; systematic and phylogenetic studies based on analyses of morphological and molecular markers have produced inconsistent results (Scott 1996; Cuezzo 2003; Wade et al. 2007; Hirano et al. 2014). More complete taxon sampling need to be prepared to assess the phylogenetic relationship of these three families.

Acknowledgments

We sincerely thank professor De-Niu Chen of Institute of Zoology, Chinese Academy of Science for helpful comments on the manuscript. We thank the reviewers and the subject editor for their very helpful suggestions on the manuscript. This research is supported by National Natural Science Foundation of China (31372162), Natural Science Foundation in Fujian Province (2015J05076) and Public Science and Technology Research Funds Projects of General Administration of Quality Supervision, Inspection and Quarantine of the People’s Republic of China (201410076, 2015IK042).

References

  • Boore JL (1999) Animal mitochondrial genomes. Nucleic Acids Research 27(8): 1767–1780. doi: 10.1093/nar/27.8.1767
  • Boore JL (2006) The complete sequence of the mitochondrial genome of Nautilus macromphalus (Mollusca: Cephalopoda). BMC Genomics 7: 182. doi: 10.1186/1471-2164-7-182
  • Butcher AR, Grove DI (2006) Seasonal variation in rates of sporocyst and metacercarial infection by Brachylaima cribbi in helicid and hygromiid land snails on the Yorke Peninsula, South Australia. Australian Journal of Zoology 53(6): 375–382. doi: 10.1071/ZO05054
  • Cha SY, Yoon HJ, Lee EM, Yoon MH, Hwang JS, Jin BR, Han YS, Kim I (2007) The complete nucleotide sequence and gene organization of the mitochondrial genome of the bumblebee, Bombus ignitus (Hymenoptera: Apidae). Gene 392: 206–220. doi: 10.1016/j.gene.2006.12.031
  • Crease TJ (1999) The complete sequence of the mitochondrial genome of Dapnia pulex (Cladocera: Crustacea). Gene 233: 89–99. doi: 10.1016/S0378-1119(99)00151-1
  • Deng PJ, Wang WM, Huang XC, Wu XP, Xie GL, Ouyang S (2016) The complete mitochondrial genome of Chinese land snail Mastigeulota kiangsinensis (Gastropoda: Pulmonata: Bradybaenidae). Mitochondrial DNA 27(2): 1084–1085. doi: 10.3109/19401736.2014.953083
  • Dennis H (1996) Snails: A Quarantine Concern for Export Citrus to the USA. Entomology Unit, SARDI, Australia.
  • Elmerot C, Arnason U, Gojobori T (2002) The mitochondrial genome of the pufferfish, Fugu rubripes, and ordinal teleostean relationships. Gene 295(2): 163–172. doi: 10.1016/s0378-1119(02)00688-1
  • Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.
  • Gaitán-Espitia JD, Scheihing R, Poulin E, Artacho P, Nespolo RF (2013) Mitochondrial phylogeography of the land snail Cornu aspersum: tracing population history and the impact of human-mediated invasion in austral South America. Evolutionary Ecology Research 15: 1–18.
  • Grande C, Templado J, Cervera JL, Zardoya R (2002) The complete mitochondrial genome of the nudibranch Roboastra europaea (Mollusca: Gastropoda) supports the monophyly of opisthobranchs. Molecular Biology and Evolution 19(10): 1672–1685. doi: 10.1093/oxfordjournals.molbev.a003990
  • Groenenberg DSJ, Pirovano W, Gittenberger E, Schilthuizen M (2012) The complete mitogenome of Cylindrus obtusus (Helicidae, Ariantinae) using Illumina next generation sequencing. BMC Genomics 13: 114. doi: 10.1186/1471-2164-13-114
  • Hatzoglou E, Rodakis GC, Lecanidou R (1995) Complete sequence and gene organization of the mitochondrial genome of the land snail Albinaria coerulea. Genetics 140(4): 1353–1366.
  • He Y, Jones J, Armstrong M, Lamberti F, Moens M (2005) The mitochondrial genome of Xiphinema americanum sensu stricto (Nematoda: Enoplea): Considerable economization in the length and structural features of encoded genes. Journal of Molecular Evolution 61: 819–833. doi: 10.1007/s00239-005-0102-7
  • He ZP, Dai XB, Zhang S, Zhi TT, Lun ZR, Wu ZD, Yang TB (2014) Complete mitochondrial genome of the giant African snail, Achatina fulica (Mollusca: Achatinidae): a novel location of putative control regions (CR) in the mitogenome within Pulmonate species. Mitochondrial DNA 27(2): 1–2.
  • Hirano T, Kameda Y, Kimura K, Chiba S (2014) Substantial incongruence among the morphology, taxonomy, and molecular phylogeny of the land snails Aegista, Landouria, Trishoplita, and Pseudobuliminus (Pulmonata: Bradybaenidae) occurring in East Asia. Molecular Phylogenetics and Evolution 70: 171–181. doi: 10.1016/j.ympev.2013.09.020
  • Hugall A, Moritz C, Moussalli A, Stanisic J (2002) Reconciling paleodistribution models and comparative phylogeography in the Wet Tropics rainforest land snail Gnarosophia bellendenkerensis (Brazier 1875). PNAS 99(9): 6112–6117. doi: 10.1073/pnas.092538699
  • Kerney MP, Cameron RAD (1979) A field guide to the land snails of Britain and northwestern Europe. London, Collins, 288 pp.
  • Kinouchi M, Kanaya S, Ikemura T, Kudo Y (2000) Detection of tRNA based on the cloverleaf secondary structure. Genome Information 11: 301–302.
  • Lowe TM, Eddy SR (1997) TRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Research 25: 955–964. doi: 10.1093/nar/25.5.0955
  • Merritt TJS, Shi L, Chase MC, Rex MA, Etter RJ, Quattro JM (1998) Universal cytochrome b primers facilitate intraspecific studies in molluscan taxa. Molecular Marine Biology and Biotechnology 7: 7–11.
  • MOA, AQSIQ (2012) The List of Quarantine Pests of the People’s Republic of China of the Entry of Plants. Beijing, China.
  • Ojala D, Montoya J, Attardi G (1981) tRNA punctuation model of RNA processing in human mitochondrial. Nature 290(5806): 470–474. doi: 10.1038/290470a0
  • Palumbi S, Martin A, Romano S, Mcmillan WO, Stice L, Grabowwski G (1991) The Simple Fool’s Guide to PCR. Department of Zoology, University of Hawaii, Honolulu.
  • Perna NT, Kocher TD (1995) Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. Journal of Molecular Evolution 41: 353–358. doi: 10.1007/BF01215182
  • Raay TJ, Crease TJ (1994) Partial mitochondrial DNA sequence of the crustacean Daphnia pulex. Current Genetics 25: 66–72. doi: 10.1007/BF00712970
  • Saccone C, De GC, Gissi C, Pesole G, Reyes A (1999) Evolutionary genomics in Metazoa: the mitochondrial DNA as a model system. Gene 238(1): 195–209. doi: 10.1016/S0378-1119(99)00270-X
  • Scott B (1996) Phylogenetic relationships of the Camaenidae. Journal of Molluscan Studies 62: 65–73. doi: 10.1093/mollus/62.1.65
  • Steinke D, Albrecht C, Pfenninger M (2004) Molecular phylogeny and character evolution in the Western Palearctic Helicidae s.l. (Gastropoda: Stylommatyophora). Molecular Phylogenetics and Evolution 32: 724–734. doi: 10.1016/j.ympev.2004.03.004
  • Tamura K, Peterson D, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731–2739. doi: 10.1093/molbev/msr121
  • Terrett JA, Miles S, Thomas RH (1995) Complete DNA sequence of the mitochondrial genome of Cepaea nemoralis (Gastropoda: Pulmonata). Journal of Molecular Evolution 42: 160–168. doi: 10.1007/BF02198842
  • USDA (2008) Port of Tacoma Cernuella virgata (C. virgata) Eradication Program in Pierce County, Washington, 12 pp.
  • Wade CM, Hudelot C, Davison A, Naggs F, Mordan PB (2007) Molecular phylogeny of the helicoid land snails (Pulmonata: Stylommatophora: Helicoidea), with special emphasis on the Camaenidae. Journal of Molluscan Studies 73: 411–415. doi: 10.1093/mollus/eym030
  • Wang JP, Nie XP, Cao TW, Zhang M, Guo YP, Ma EB, Zhang XN (2012) Analysis of complete mitochondrial genome of Sasakia charonda coreana (Lepidoptera, Nymphalida). Acta Zootaxonomica Sinica 37(1): 1–9.
  • Wang P, Yang HF, Zhou WC, Hwang CC, Zhang WH, Qian ZX (2014) The mitochondrial genome of the land snail Camaena cicatricosa (Müller, 1774) (Stylommatophora: Camaenidae): Presently known as the first in Camaenidae. ZooKeys 451: 33–48. doi: 10.3897/zookeys.451.8537
  • White TR, Conrad MM, Tseng R, Balayan S, Golding R, Martins AM, Dayrat BA (2011) Ten new complete mitochondrial genomes of pulmonates (Mollusca: Gastropoda) and their impact on phylogenetic relationships. BMC Evolutionary Biology 11(1): 295. doi: 10.1186/1471-2148-11-295
  • Wyman SK, Jansen RK, Boore JL (2004) Automatic annotation of organellar genomes with DOGMA. Bioinformatics 20(17): 3252–3255. doi: 10.1093/bioinformatics/bth352
  • Yamazaki N, Ueshima R, Terrett JA, Yokobori S, Kaifu M, Segawa R, Kobayashi T, Numachi K, Ueda T, Nishikawa K, Watanabe K, Thomas RH (1997) Evolution of Pulmonate Gastropod mitochondrial genomes: comparisons of gene organizations of Euhadra, Cepaea and Albinaria and implications of unusual tRNA secondary structures. Genetics 145: 749–758.
  • Yang HR, Zhang JE, Luo H, Luo MZ, Guo J, Deng ZX, Zhao BL (2014) The complete mitochondrial genome of the mudsnail Cipangopaludina cathayensis (Gastropoda: Viviparidae). Mitochondrial DNA 16: 1–3.
  • Yu DJ, Xu L, Nardi F, Li JG, Zhang RJ (2007) The complete nucleotide sequence of the mitochondrial genome of the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae). Gene 396: 66–74. doi: 10.1016/j.gene.2007.02.023
  • Zhang DX, Hewitt GM (1997) Insect mitochondrial control region: A review of its structure, evolution and usefulness in evolutionary studies. Biochemical Systematics and Ecology 25: 99–120. doi: 10.1016/S0305-1978(96)00042-7