Research Article
Print
Research Article
Capoeta coadi, a new species of cyprinid fish from the Karun River drainage, Iran based on morphological and molecular evidences (Teleostei, Cyprinidae)
expand article infoNisreen H. Alwan‡, Halimeh Zareian§, Hamid Reza Esmaeili§
‡ American University of Beirut, Beirut, Lebanon
§ Shiraz University, Shiraz, Iran

Corresponding author: Hamid Reza Esmaeili ( hresmaeili22@gmail.com )

Academic editor: Richard Mayden
© 2016 Nisreen H. Alwan, Halimeh Zareian, Hamid Reza Esmaeili.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Alwan NH, Zareian H, Esmaeili HR (2016) Capoeta coadi, a new species of cyprinid fish from the Karun River drainage, Iran based on morphological and molecular evidences (Teleostei, Cyprinidae). ZooKeys 572: 155-180. https://doi.org/10.3897/zookeys.572.7377
ZooBank: urn:lsid:zoobank.org:pub:F09699B7-3D33-4D4C-9AF6-73C4B4FDD63C
Open Access

Abstract

As presently recognized, the genus Capoeta includes 24 species, nine of which are known to occur in Iran (C. aculeata, C. capoeta, C. buhsei, C. damascina, C. fusca, C. heratensis, C. mandica, C. saadii and C. trutta) and are distributed in almost all Iranian basins except Sistan and Mashkid. Capoeta coadi sp. n. is a new species from the Karun River, southern Iran, draining into the Arvand Rud (Shatt al-Arab) which drains into the Persian Gulf. It is distinguished from all other species of Capoeta by the combination of the following characters: elongate and usually cylindrical body; 8–9 branched dorsal-fin rays; last unbranched dorsal-fin ray weakly to moderately ossified and serrated along 1/3–2/3 of its length; scales small; 70-84 in lateral line (total); 12–17 scales between dorsal-fin origin and lateral line; 9-11 scales between anal-fin origin and lateral line; 26–32 circum-peduncular scales; 10–13 gill rakers on lower limb of first gill arch; 45–47 total vertebrae; one posterior pair of barbels; bright golden-greenish or silvery body coloration in life; length of the longest dorsal-fin ray 15–22% SL; head length 23–26% SL; mouth width 7–10% SL. Capoeta coadi is also distinguished from all other congeners in the Iranian drainages by fixed diagnostic nucleotide substitutions in the mtDNA COI barcode region and cyt b. It is nested in the Capoeta damascina species complex.

Keywords

Capoeta damascina species complex, COI, Cyt b , Persian Gulf, phylogenetic relationships

Introduction

The Middle East is a transition zone between three major biogeographic units, the Palaearctic, the Afrotropical, and the Oriental realms. It served as an important crossroad of biotic exchange resulting in an outstanding biological diversity of freshwater fishes (Durand et al. 2002, Krupp et al. 2009). Lying between major drainages of the Nile in Africa to the west, the Indus in southern Asia to the east and the Caspian and Black Sea drainages to the north, the Tigris-Euphrates River drainage is the largest river system in the Middle East and has high fish diversity, especially in cyprinid fishes.

Capoeta Valenciennes in Cuvier and Valenciennes 1842 is an example of a cyprinid genus widely spread in the Middle East (Krupp and Schneider 1989). Being found in a wide range of habitats, species of this genus display considerable morphological variability (e.g., scale counts and colour pattern) and the extent of morphological plasticity and genetic variability remain to be determined. As a consequence, there has been considerable disagreement regarding the status of several species. However, Capoeta is considered monophyletic (Krupp 1985, Küçük et al. 2009).

Members of the genus Capoeta are cyprinids characterized by having an elongate, cylindrical body and a short dorsal fin. They have three to five unbranched and 5–9 branched dorsal-fin rays, the last unbranched ray being ossified and serrated. All species have three unbranched and 5 branched anal-fin rays. Scales are usually small. Mouth is inferior and the lower lip is covered with a horny sheath. One pair of barbels (rarely two) is present and the pharyngeal teeth are arranged in three rows. The shape of the mouth as well as the pharyngeal teeth are nearly identical in all species, which indicate their adaptation to the same mode of feeding. This combination of character states distinguishes Capoeta from all other cyprinids (Krupp 1985, Krupp and Schneider 1989).

As presently recognized, the genus Capoeta includes about 24 species (Eschmeyer and Fricke 2016) in different phylogenetic groups widely distributed in many river drainages and basins in southwestern Asia except the Arabian Peninsula (Alwan 2011, Levin et al. 2012). Levin et al. (2012) studied the phylogenetic relationships of the genus Capoeta based on complete mitochondrial gene for cytochrome b sequences obtained from 20 species from the overall range of the genus. Three main groups were detected: the Mesopotamian group (Capoeta trutta group), the Anatolian-Iranian group (Capoeta damascina group) and the Aralo-Caspian group (Capoeta capoeta group).

Members of the Capoeta damascina species group, characterized by having small scales, include C. buhsei Kessler, 1877, C. caelestis Schöter, Özuluğ & Freyhof, 2009, C. damascina (Valenciennes, 1842), C. kosswigi Karaman, 1969, C. saadii (Heckel, 1847), and C. umbla (Heckel, 1843) (Alwan 2011). Based on phylogenetic analyses of cytochrome c oxidase subunit I (COI) and the large subunit (LSU or 28S) ribosomal RNA gene sequences Alwan (2011) identified two main lineages within what we will refer to in this paper, as the “C. damascina species complex”. A western lineage is represented by C. caelestis, C. damascina and C. umbla and an eastern lineage represented by C. buhsei, C. saadii, and a new undescribed species.

Traditionally, C. damascina is recorded from Tigris, Mond, Kor, Esfahan, Dasht-e Kavir, Namak Lake, Kor River, Lake Maharlu, Persian Gulf (now Persis), Kerman-Na’in, Dasht-e Lut, Sirjan, Hormuz, and Hamun-e Jaz Murian basins in Iran (Nikol’skii 1899, Berg 1949, Kähsbauer 1964, Armantrout 1980, Rainboth 1981, Bianco and Banarescu 1982, Ghorbani Chafi 2000, Jalali et al. 2005, Esmaeili et al. 2010, Bahrami Kamangar et al. 2012). Its distribution over such wide range of isolated water bodies, raises questions regarding the status of C. damascina. Currently, C. damascina s.l. represents a complex of closely related species with high intraspecific and comparatively low interspecific variation (Alwan 2011, Levin et al. 2012). Now, three species of Capoeta from Iranian water bodies are recognized as being members of C. damascina species complex group: C. buhsei, C. saadii (Iranian populations were considered as C. damascina) (see Alwan 2011, Levin et al. 2012), and a new undescribed species from the Karun (Karoun) River drainage. It is described here as a new species, Capoeta coadi.

Material and methods

After anaesthesia, fishes were either fixed in 5% formaldehyde, and stored in 70% ethanol, or directly fixed in 99% ethanol (for molecular studies). Measurements were made with a digital caliper and recorded to 0.01 mm. All measurements were made point to point, and never by projections. Methods for counts and measurements follow Hubbs and Lagler (1958) and Krupp (1983). Standard length (SL) was measured from the tip of the snout to the end of the hypural complex. The length of the caudal peduncle was measured from behind the base of the last anal-fin ray to the end of the hypural complex. The last two branched rays articulating on a single pterygiophore in the dorsal and anal fins are counted as “1½”.The holotype is included in the calculation of means and SD.

Abbreviations used: SL, standard length; HL, lateral head length.

Abbreviations used for museum collections: Zoological Museum of Shiraz University, Collection of Biology Department, Shiraz, Iran (ZM-CBSU), the Senckenberg Research Institute and Natural History Museum (SMF: Frankfurt, Germany), and the private collection of Jörg Freyhof (FSJF: Fischsammlung J. Freyhof).

DNA extraction and PCR amplification protocol

For DNA sequencing, specimens were directly fixed in 99% molecular grade ethanol. Mitochondrial DNA was extracted using Salt method (Bruford et al. 1992). The standard vertebrate DNA barcode region of the COI (cytochrome c oxidase subunit 1) and cytochrome b (cyt b) were amplified using primer pairs named FishF1-5'TCAACCAACCACAAAGACATTGGCAC3’ and FishR1-5'TAGACTTCTGGGTGGCCAAAGAATCA3’ (Ward et al. 2005) and L14724-5'GTGACTTGAAAAACCACCGTTG3’ and H15915-5'CAACGATCTCCGGTTTAGAAGAC3’ (Xiao et al. 2001) or GluF- 5'AACCACCGTTGTATTCAACTACAA3’ and H-15560 5`TAGGCRAATAGGAAR TATCA3` (Machordom and Doadrio 2001), respectively.

Purification and sequencing of the PCR products were conducted at Macrogen Korea Laboratories using the aforementioned primer sets.

Molecular data analyses

Data processing and sequence assembly was done in BioEdit 7.2.5 (Hall 1999); MEGA6 (Tamura et al. 2013) was used to create a DNA sequence alignment. No indications of unexpected stop-codons or nuclear copies of mitochondrial fragments occurred in any sequences. All generated DNA barcodes and cyt b were deposited in the NCBI GenBank. The most appropriate sequence evolution model for the given data was determined with Modeltest (Posada and Crandall 1998) as implemented in the MEGA6 software, treating gaps and missing data with the partial deletion option under 95% site coverage cut-off. The model with the lowest BIC (Bayesian Information Criterion) score is considered the best model to describe the substitution pattern for each gene. To explore species phylogenetic relationships, trees were generated using Maximum Likelihood analysis with 10,000 bootstrap replicates in RaxML 7.2.5 (Stamatakis 2006) under the GTR+G model of nucleotide substitution, with fast bootstrap and also Bayesian analysis (BA), using the Markov Chain Monte Carlo method (MCMC), with 6,000,000 generations under the most generalizing model (GTR+G+I) using Mr. Bayes 3.1.1 (Huelsenbeck and Ronquist 2001). Screening for diagnostic nucleotide substitutions was performed manually from the sequence alignment. As an appropriate outgroup to root the constructed phylogenetic hypothesis, we included the distantly related Cyprinus carpio.

Results

Morphological assessments

Capoeta coadi sp. n.

http://zoobank.org/4B5B0984-0C65-4B6D-97CC-31245E179D13
Figs 1, 2, 3

Holotype

ZM-CBSU Z190, 157 mm SL; Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar (Bashar) River at Tale Gah village, Karun River drainage, 30°47'27"N, 51°25'13"E.

Paratypes

ZM-CBSU Z191, 6, 91–157 mm SL; same data as holotype. ZM-CBSU J520, 1, 107 mm SL; ZM-CBSU Z275, 12, 105–152 mm SL; Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar (Bashar) River at Tale Gah village, Karun River drainage, 30°47'27"N, 51°25'13"E. 15 December 2014, G. Sayyadzadeh, R. Khaefi, A. Khajehpanah. ZM-CBSU J526, 1, 98 mm SL; ZM-CBSU J533, 1, 114 mm SL; ZM-CBSU J535, 1, 97 mm SL; ZM-CBSU J540, 1, 67 mm SL; All from Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Tange sorkh, Karun River drainage, 30°26'14"N, 51°45'48"E. 24 July 2011, R. Zamaneian Nejad, S. Mirgheiasi, S. Ghasemian. ZM-CBSU J444, 2, 73–90 mm SL; ZM-CBSU J447, 2, 76–111 mm SL; ZM-CBSU J450, 1, 86 mm SL; ZM-CBSU J452, 1, 107 mm SL; ZM-CBSU J459, 2, 104–120 mm SL; ZM-CBSU J464, 1, 110 mm SL; all from Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Mokhtar village, Karun River drainage, 30°40'31"N, 51°31'26"E. 25 May 2011, R. Zamaneian Nejad.

Additional material

ZM-CBSU 7880–7881, 2, 96.69–158.12 mm SL; Iran, Fars prov., Sepidan city, Gorgu River, a tributary of Beshar River, north of Sepidan city, Karun River drainage, 30°21.283'N, 51°45.754'E. 2006. H.R. Esmaeili, A. Teimori, M. Ebrahimi and A. Gholamhoseini. SMF 33337, 1, 48.86 mm SL; Iran, Lorestan prov., Hadi River between Zagheh and Polehoru, 33°31.138'N, 48°46.340'E. 04 March 2008. N. Alwan, K. Borkenhagen, M. Ghanbari Fardi and A. Kazemi. FSJF 2213, 11, 107.92–143.94 mm SL; Iran, Chaharmahal and Bakhtiari Prov., Sandgan River (Sandgan stream) at Sandgan, 31°15.692'N, 51°17.150'E. 19 April 2007, A. Abdoli and J. Freyhof. FSJF 2233, 2, 156.22–162.23 mm SL; Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River, 20 km northeast of Yasuj, 30°44.152'N, 51°29.522'E. 19 April 2007. A. Abdoli and J. Freyhof. SMF 30865, 1, 26.94 mm SL; Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Tang-e Sorkh, 30°27.680'N, 51°44.907'E. 28 November 2007, K. Borkenhagen, H. R. Esmaeili and F. Wicker (in 96% alcohol). SMF 30871, 1, 28.34 mm SL; Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Tang-e Sorkh, 30°27.680'N, 51°44.907'E. 28 November 2007. K. Borkenhagen, H. R. Esmaeili and F. Wicker (in 96% alcohol). SMF 33316, 7, 35.22–166.87 mm SL; Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Tang-e Sorkh, 30°27.680'N, 51°44.907'E. 28 November 2007, K. Borkenhagen, H. R. Esmaeili and F. Wicker. SMF 30872, 1, 29.70 mm SL; Iran, Fars prov., Sepidan, Tang-e Tizab, 30°23.470'N, 51°46.710'E, 28 November 2007, K. Borkenhagen, H. R. Esmaeili and F. Wicker (in 96% alcohol).

Capoeta coadi specimens used for molecular genetic analysis

ZM-CBSU M1275,1, Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Dehno village, Karun River drainage, 30°38'55"N, 51°37'05"E. 16 January 2014, H.R. Esmaeili, G. Sayyadzadeh, H.R. Mehraban, M. Razbani. GenBank accession number: (COI: KU564296); ZM-CBSU M1447, 2, GenBank accession number: (COI: KU564297, KU564298; cytb: KU564303, KU564304) ZM-CBSU M1458, 2); Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Tale Gah village, Karun River drainage, 30°47'27"N, 51°25'13"E. 14 December 2013. G. Sayyadzadeh, A. Khajehpanah, R. Khaefi. GenBank accession number: (COI: KU564294, KU564295; cytb: KU564305, KU564306).

Diagnosis

Capoeta coadi sp. n. is distinguished from all other species of Capoeta by the following combination of characters: last unbranched dorsal-fin ray weakly to moderately ossified and serrated in 1/3–2/3 of its length; scales small, 70–84 total lateral line scales (84 in holotype), 12–17 scales between dorsal-fin origin and lateral line (16 in holotype), 9–11 scales between anal-fin origin and lateral line (11 in holotype), 26–32 encircling least circumference of caudal peduncle (31 in holotype); total gill rakers 14–18 (17 in holotype), 10–13 gill rakers on lower limb of first gill arch (12 in holotype); 45–47 total vertebrae; one posterior pair of barbels; length of the longest dorsal-fin ray 14.92–21.58% SL (18.90 in holotype); head length 22.87–26.33% SL (23.76 in holotype); mouth width 7.48–9.77% SL (8.65 in holotype); bright golden-greenish or silvery body coloration in life.

Description

General body shape and appearance are shown in Figs 1–3, morphometric data in Table 1 and meristic data are summarized in Tables 2–9. Body elongate and cylindrical; predorsal body profile smoothly convex with no marked discontinuity between head and body except when a nuchal hump is present in few specimens; greatest body depth at level of dorsal-fin origin; snout rounded (in 20 specimens) or pointed (in 14 specimens) and not size dependent; mouth inferior; lips slightly fleshy, especially at the mouth corners; lower lip covered with a sharp-edged horny sheath, its anterior margin straight in adult specimens and rounded to almost crescent-shaped in juveniles, with a considerable degree of individual variation.

Figure 1. 

Capoeta coadi sp. n., ZM-CBSU Z190, holotype, 157 mm SL; Iran: Kohgiluyeh and Boyer Ahmad, Beshar River, Karun River drainage.

Figure 2. 

Capoeta coadi sp. n., paratypes: aZM-CBSU Z191; 157 mm SLbZM-CBSU Z192, 148 mm SL; Iran: Kohgiluyeh and Boyer Ahmad, Beshar River, Karun River drainage.

Figure 3. 

Live specimen of Capoeta coadi sp. n, Iran: Kohgiluyeh and Boyer Ahmad, Beshar River, Karun River drainage.

Table 1.
Download as
CSV
XLSX

Morphometric data of Capoeta coadi sp. n. (holotype ZM-CBSU Z190, and 33 paratypes), C. buhsei and C. saadii.

Holotype Paratypes (n=33) Capoeta buhsei (n=27) Capoeta saadii (n=20)
Range Mean SD Range Mean SD Range Mean SD
Standard length (mm) 157.64 67.23–157.64 110.67 74.30–149.30 112.56 51.31–231 109.30
In percent of standard length
Head length 23.76 22.87–26.33 24.5 0.80 21.47–25.98 23.56 0.98 24.28–29.62 26.84 1.32
Body depth at dorsal-fin origin 21.82 21.33–25.04 23.15 0.98 19.78–24.55 21.82 1.19 19.58–27.78 23.32 2.11
Predorsal length 49.07 47.75–53.43 50.23 1.31 48.85–55.05 51.59 1.34 44.33–55.12 51.93 2.51
Postdorsal length 54.13 54.13–63.19 57.53 1.88 48.20–60.13 55.24 2.78 50.79–59.64 55.06 2.60
Preanal length 72.45 70.22–76.14 72.8 1.36 71.34–76.34 74.01 1.28 69.37–78.38 75.61 2.07
Prepelvic length 53.74 50.22–55.90 52.84 1.31 50.17–56.64 53.58 1.49 51.23–61.21 56.22 2.36
Distance between pectoral and pelvic-fin origins 32.42 27.81–32.42 30.19 1.13 29.07–33.64 31.30 1.04 25.55–32.66 30.87 2.15
Distance between pelvic and anal-fin origins 21.48 19.31–23.17 21.12 0.88 19.90–23.65 21.60 0.91 18.32–23.41 20.83 1.56
Depth of caudal peduncle 10.37 10.03–11.61 10.65 0.37 8.58–10.84 10.05 0.50 8.98–11.15 10.43 0.60
Length of caudal peduncle 20.73 17.16–22. 35 19.85 1.14 18.64–22.01 19.81 0.91 15.19–20.11 17.67 1.30
Dorsal-fin base length 12.71 12.27–16.17 14.41 0.89 11.75–15.28 13.51 0.80 10.46–14.39 12.98 1.11
Anal-fin base length 6.78 6.38–8.85 7.39 0.55 6.96–8.80 7.88 0.58 6.24–8.27 7.17 0.60
Pectoral-fin length 17.32 16.68–20.46 18.43 0.89 16.39–20.96 18.38 0.99 16.15–19.16 17.86 1.01
Pelvic-fin length 15.05 14.24–16.96 15.61 0.68 13.85–18.08 15.61 1.08 13.58–16.23 15.08 0.82
Length of the longest dorsal fin ray 18.90 14.92–21.58 19.57 1.27 16.42–21.22 18.78 1.06 16.35–21.53 19.03 1.47
Mouth width 8.65 7.48–9.77 8.63 0.51 6.49–8.89 7.87 0.57 6.51–9.38 8.1 0.73
In percent of head length
Head depth at eye 56.88 49.05–61.87 54.21 2.73 48.01–56.63 67.01 2.26 49.17–57.97 65.47 3.96
Snout length 38.32 31.60–47.70 38.08 2.60 32.69–38.89 35.55 1.67 32.65–40.61 36.18 2.41
Postorbital distance 48.83 33.82–51.84 48.01 3.01 47.66–56.59 51.57 1.89 46.58–54.84 51.05 2.28
Interorbital width 40.04 34.62–42.81 38.19 1.98 33.88–41.49 37.15 1.93 30.90–40.16 35.57 2.70
Eye diameter 15.97 15.07–23.57 18.52 2.36 13.91–24.44 17.36 2.11 11.95–26.18 18.23 3.43
Maximum head width 60.53 51.75–66.89 59.60 3.99 57.83–69.68 62.76 3.04 47.38–59.00 54.62 3.39
Barbel length 15.14 13.30–20.20 16.25 1.66 15.66–24.60 19.71 2.27 13.34–24.64 18.11 2.73

Dorsal-fin origin anterior to pelvic-fin origin, its outer margin usually straight to concave with 3–5 unbranched and 8–9 branched rays (3 and 8 in holotype, respectively); last unbranched dorsal-fin ray weakly to moderately ossified, flexible and soft at the tip, serrated in 1/2–2/3 of its length (Fig. 4); pectoral fins not extending to pelvic-fin base; their outer margins usually slightly convex with 16–22 rays in total (19 in holotype) (Table 2); pelvic fins not extending to anal fin base, their outer margin straight or slightly convex and blunt with 7–11 rays in total (8 in holotype) (Table 2); pelvic axillary scale present; anal fin with 3 unbranched and 5 branched rays, outer margin straight or slightly convex; caudal fin forked with 16–19 branched rays (17 in holotype) (Table 3), its tip pointed and its upper lobe often longer than lower one.

Figure 4. 

Dorsal fins of Capoeta coadi sp. n. aZM-CBSU J 444; 73 mm SLbZM-CBSU Z195; 104 mm SLcZM-CBSU Z192; 148 mm SL; Iran: Kohgiluyeh and Boyer Ahmad, Beshar River, Karun River drainage, to show size-dependent variability of the last simple dorsal-fin ray serration.

Table 2.
Download as
CSV
XLSX

Number of pectoral and pelvic fin rays in examined Capoeta species.

Pectoral fin rays Pelvic fin rays
13 14 15 16 17 18 19 20 21 22 7 8 9 10 11
C. buhsei 2 10 4 6 2 14 10
C. coadi 6 10 8 11 7 1 3 1 14 16 12 8
C. mandica 1 7 2 1 9 2
C. saadii 3 12 4 1 9 10 1
C. trutta 2 8 17 8 5 22 17 1
Table 3.
Download as
CSV
XLSX

Number of branched caudal fin rays in examined Capoeta species.

Branched caudal fin rays 15 16 17 18 19 20
C. buhsei 3 21 3
C. saadii 1 29 2 1
C. mandica 2 8 1
C. trutta 1 9 16 11 3

Scales small, total lateral-line scales 70–84; 12–17 scales between dorsal-fin origin and lateral line (Table 4); 9–11 scales between anal-fin origin and lateral line (Table 4); 26–32 circum-peduncle scales (Table 5); ventral midline and pectoral region covered with deeply embedded scales of reduced size; gill rakers slightly hooked, total gill rakers 14–18 (10–13 gill rakers on lower limb) of first gill arch (Table 8–9); 45–47 total vertebrae; usually one posterior pair of barbels present (very rarely two, 1 out of 51 individual); pharyngeal teeth arranged in 3 rows in the following manner: 2.3.5–5.3.2 and very similar in shape to those of C. damascina; teeth in the main row spatulate or spoon-shaped and crowns flat, narrow and curved.

Table 4.
Download as
CSV
XLSX

Number of scales above (between dorsal-fin origin and lateral line) and below (between dorsal-fin origin and lateral line) lateral line in examined Capoeta species.

Above lateral line Below lateral line
6 7 8 9 10 11 12 13 14 15 16 17 5 6 7 8 9 10 11 12 13
C. buhsei 3 6 4 12 3 13 7 3 1
C. coadi 1 9 9 15 15 1 11 20 18
C. mandica 1 10 4 5 2
C. saadii 1 2 1 8 7 1 2 4 3 9 2
C. trutta 2 1 1 7 16 7 3 3 7 19 8 6
Table 5.
Download as
CSV
XLSX

Number of circum-pendicular scales in examined Capoeta species.

19 21 22 23 24 25 26 27 28 29 30 31 32 33
C. buhsei 1 3 2 5 5 3 4 3
C. coadi 3 11 7 14 4 7 5
C. fusca 1 6 2 4 1 1
C. mandica 5 1 3 1 1

Coloration. Live specimens. Dorsum and sides bright golden-green or silvery, darker dorsally and lighter below the lateral line; dorsal head bright golden-green or light pink-brown; dorsal, anal and caudal fins beige to light brown with light pink to red tinge; pectoral and pelvic-fins beige to light brown or golden with brown tinge on the first few rays (Fig. 3); few large black blotches present on the body of some specimens whereas small diffuse black spots are present only on the body of some juveniles (above the lateral line).

Preserved specimens

Dorsum, head and sides grey or brownish-grey dorsally and beige or yellow ventrally; dorsal and caudal fins dusky grey; pectoral, pelvic and anal fins white or beige with or without grey tinge; blotches and spots well discernible (Figs 1–2).

Sexual dimorphism

Breeding tubercles present in both sexes, being bigger and more pronounced in males. Tubercles present on the sides of the snout but may also cover the entire body surface, on and above the lateral line with one or two tubercles per scale but not on each scale, below the lateral line especially in the area above the anal fin and on the branched anal-fin rays; tip of anal fin reaching to or beyond the vertical of the caudal-fin base in females and to about 2/3 of the caudal peduncle in males.

Habitat and distribution

Capoeta coadi sp. n. occurs in medium-fast flowing rivers with usually gravel substrates and clear waters (Fig. 5). At the Beshar River sampling site, the river is about 25 m wide, with substrate consisting of coarse gravel and boulders, and fast-flowing and semi-transparent waters. The physicochemical parameters at the spot were: dissolved oxygen, 9.89 mg/L; total dissolved solids, 190.2 mg/L; salinity, 0.19‰; conductivity, 395 µs/cm; pH: 8.5 and water temperature 23.4 °C. It is known only from the Karun River drainage, a system that constitutes the southeastern part of the Tigris-Euphrates River system.

Figure 5. 

Beshar River at Taleh Gah village, Karun River drainage, type locality of C. coadi.

Etymology

The new species is named after Brian W. Coad, a well-known ichthyologist for his valuable contribution to the knowledge of freshwater fishes of Iran.

Comparative remarks

The presence of one pair of barbels in Capoeta coadi sets the species apart from C. antalyensis, C. baliki, C. banarescui, C. tinca, and C. heratensis, all of which have two pairs of barbels based on data from Turan et al. (2006a) and this study. The new species is further distinguished from C. antalyensis by the presence of serrae on the last unbranched dorsal-fin ray (vs. absence) (Fig. 4), and by number of scales between dorsal-fin origin and lateral line (12–17 vs. 10–12 in C. antalyensis) (Table 4), between anal-fin origin and lateral line (9–11 vs. 7), and by total number of the lateral-line scales (70–84 vs. 51–57) (Table 7). Capoeta coadi is distinguished from C. banarescui by number of scales between anal-fin origin and lateral line (9–11 vs. 8–9) (Table 4). Data for C. antalyensis and C. banarescui are from Turan et al. (2006a).

Capoeta coadi is distinguished from C. mandica, C. erhani, and C. trutta by having 10–13 gill rakers on the lower limb of the first gill arch (vs. 17–24 in C. mandica, 20–22 in C. erhani and 18–25 in C. trutta [data from Krupp 1985, Turan et al. 2008, Table 8]). The total number of gill rakers in Capoeta coadi specimens is 14–18 that is lower than in C. mandica (23–27), C. barroisi (28–30), C. turani (25–30) and C. trutta (21–31) [data from Turan et al. (2006b), Özuluğ and Freyhof (2008), and this study] Table 9. Capoeta coadi is further distinguished from C. mandica by having fewer pectoral fin rays (16–22 vs. 13–16) (Table 2). Capoeta coadi is distinguished from C. bergamae, C. capoeta and C. sieboldii by number of scales between dorsal-fin origin and lateral line (12–17 in C. coadi vs. 8–10 in C. capoeta and 9–11 in C. sieboldii); number of scales between anal-fin origin and lateral line (9–11 in C. coadi vs. 7–9 in C. bergamae, 6–10 in C. capoeta and 8–10 in C. sieboldii); total lateral line scales (70–84 in C. coadi vs. 48–66 in C. capoeta and 52–60 in C. sieboldii) [data from Banarescu 1999, Turan et al. 2006b, Tables 4, 7]. In addition to the presence of serrae on the unbranched dorsal-fin ray, Capoeta coadi is set apart from C. caelestis by the number of scales between the dorsal-fin origin and lateral line (12–17 in C. coadi vs. 10–13.5 in C. caelestis); scales between anal-fin origin and lateral line (9–11 in C. coadi vs. 7–8 in C. caelestis); circum-peduncular scales (26–32 in C. coadi vs. 23–24 in C. caelestis) (Tables 4–5) and probably vertebral counts (45–47 in C. coadi vs. 44 in C. caelestis) [data from Schöter et al. 2009].

Table 6.
Download as
CSV
XLSX

Number of caudal-peduncle scales in examined Capoeta species.

10 11 12 13 14 15 16 17 18 19 20 21 22
C. buhsei 6 3 7 9 1 1
C. coadi 1 1 2 8 15 2 3 1
C. mandica 4 2 4 1
C. saadii 2 1 10 6 1
C. trutta 1 1 2 3 5 14 8 1 4 1
Table 7.
Download as
CSV
XLSX

Number of lateral-line scales in examined Capoeta species.

58 59 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 87 89
C. buhsei 1 3 1 2 1 2 4 3 1 2 4 1 1
C. coadi 2 1 2 6 1 4 4 1 5 3 5 6 5 1 1
C. mandica 1 1 2 1 2 1 2 1
C. saadii 1 2 1 2 2 1 2 3 1 1 2 2
C. trutta 1 2 1 3 1 5 4 2 2 2 5 3 2 4 2 1
Table 8.
Download as
CSV
XLSX

Gill rakers on the lower limb of the first gill arch in studied Capoeta species.

GR 8 9 10 11 12 13 17 18 19 20 22 24
C. buhsei 2 19 6
C. coadi 1 9 19 20
C. mandica 1 2 3 1 3 1
Table 9.
Download as
CSV
XLSX

Number of total gill rakers on the first gill arch in examined Capoeta species.

12 13 14 15 16 17 18 21 22 23 24 25 26 27 28 31
C. buhsei 10 13 6
C. coadi 1 7 14 6 5
C. mandica 2 2 2 1 4
C. saadii 1 9 6 1 2 1
C. trutta 1 1 9 11 7 5 4 1 1

It is distinguished from C. damascina by having 11–13, modally 13, gill rakers on the lower limb of the first gill arch (vs. 12–18, modally 14–15) (Alwan 2011, Table 8). Capoeta coadi is clearly distinguished from C. ekmekciae by number of scales between dorsal-fin origin and lateral line (12–17 in C. coadi vs. 9–10 in C. ekmekciae); number of scales between anal-fin origin and lateral line (9–11 in C. coadi vs. 6–7 in C. ekmekciae) (Table 4); number of lateral line scales (70–84 in C. coadi vs. 55–61 in C. ekmekciae [data from Turan et al. 2006b; Alwan 2011].

Capoeta coadi is distinguished from C. kosswigi by total number of gill rakers (Table 9): 14–18 in C. coadi vs. 19–28 in C. kosswigi (see Karaman 1969; Turan et al. 2006b; Turan 2008).

Capoeta coadi is distinguished from C. mauricii and C. pestai by having a weaker, thinner and less ossified last unbranched dorsal-fin ray in juveniles and adults and fewer scales between dorsal-fin origin and lateral line (12–17 in C. coadi vs. 18–22 in C. mauricii and 16–19 in C. pestai [data from Özuluğ and Freyhof 2008, Küçük et al. 2009]). It is further distinguished from C. pestai by the absence of spots on the body except in juveniles (vs. presence of many on the body [see Özuluğ and Freyhof 2008, Küçük et al. 2009]). Capoeta coadi is distinguished from C. umbla by total number of lateral line scales (70–84 vs. 86–104), number of scales between dorsal-fin origin and lateral line (12–17 vs. 18–24), number of scales between anal-fin origin and lateral line (9–11 vs. 11.5–15.5), and circum-pendicular scales (26–32 vs. 32–39) (see Alwan 2011, Tables 4–7).

Compared to other Iranian species of Capoeta, C. coadi has more scales and fewer gill rakers than C. aculeata (number of scales between dorsal-fin origin and lateral line: 12–17 vs. 6–10; number of scales between anal-fin origin and lateral line: 9–11 vs. 5–8; circum-peduncular scales: 26–32 vs. 13–23; total number of lateral line scales: 70–84 vs. 36–52; caudal peduncle scales: 14–18 vs. 10–12; gill rakers on the lower limb of the first gill arch: 10–13 vs. 15–18 [data from Coad and Krupp 1994] and this study (Tables 4–9)). Capoeta coadi is distinguished from C. fusca by more total vertebrae (45–47 vs. 44), and more total lateral-line scales (70–84 vs. 40–62) (see Coad 2008, Johari et al. 2009).

Capoeta coadi differs from its sister species (see Figs 6–7), C. buhsei in having more gill rakers on lower limb of first gill arch (10–13 vs. 8–10), more gill rakers on the whole first gill arch (14–18 vs. 12–14, see Tables 8–9) and by depth of caudal peduncle in percent of standard length (10.03–11.61 vs. 8.58–10.84). Capoeta coadi is distinguished from another closely related species, C. saadii by having more scales below the lateral line (9–11 vs. 6–10, modally 9) (Table 4) and more circum-pendicular scales (26–32 vs. 23–28, modally 25–26) [data from Alwan (2011)].

Figure 6. 

Bayesian tree inferred from cyt b. Numbers left of the slash, indicate the posterior probabilities of the Bayesian analysis, using MrBayes, while numbers right of the slash are the bootstrap support for 10,000 replicates in the Maximum Likelihood tree, using RaxML. Asterisks (*) indicate less than 50% Maximum Likelihood support for the node.

Figure 7. 

Bayesian tree inferred from COI. Numbers left of the slash, indicate the posterior probabilities of the Bayesian analysis, using MrBayes, while numbers right of the slash are the bootstrap support for 10,000 replicates in the Maximum Likelihood tree, using RaxML. Asterisks (*) indicate less than 50% Maximum Likelihood support and (-) indicates less than 0.50 Bayesian posterior probabilities for the node.

Molecular phylogenetic assessments

We generated COI barcode and cyt b sequences for a total of 76 and 61 Capoeta specimens, respectively (Tables 10–11). Two phylogenetic approaches including Maximum Likelihood and Bayesian analyses for species of Capoeta are given in Figs 6–7. Tables 12–13 provide the diagnostic nucleotide substitutions found in the mtDNA COI barcode region and cyt b, respectively.

Table 10.
Download as
CSV
XLSX

List of species used for molecular analysis for cyt b (*present study, the ones without * are obtained from GenBank). Cyprinus carpio was considered as outgroup.

Species Accession Number Locality
C. aculeata JF798267 Stream Sangan, Karun River basin, Tigris basin, Iran
C. aculeata JF798264 Sevah River, Kor basin, Iran
C. aculeata JF798266 Beshar River, Karun basin, Tigris basin, Iran
C. aculeata JF798265 Sevah River, Kor basin, Iran
C. angorae JF798268 Pozanti River, Mediterranean Sea basin, Turkey
C. antalyensis JF798269 Boga Cayi River, Mediterranean Sea basin, Turkey
C. baliki JF798272 Kizilirmak River, Black Sea basin, Turkey
C. baliki JF798273 Biggest tributary of Kurtbog˘azi dam lake, Sakarya River basin, Turkey
C. baliki JF798275 Stream Cakirca, Lake Iznik basin, Turkey
C. baliki GQ424019 Unknown
C. baliki GQ424020 Unknown
C. baliki JF798271 Kizilirmak River, Black Sea basin, Turkey
C. banarescui GQ423987 Unknown
C. banarescui GQ423988 Unknown
C. bergamae JF798282 Bakacak stream, Marmara Sea basin, Turkey
C. bergamae JF798280 Bakircay River, Turkey
C. bergamae JF798281 Stream Guzelhisar, Aegean Sea basin, Turkey
C. buhsei JF798283 Taghra Rud stream, Namak Lake basin, Iran
C. buhsei* KU312369 Kordan River, Namak Lake basin, Karaj, Iran
C. buhsei* KU312370 Kordan River, Namak Lake basin, Karaj, Iran
C. caelestis JF798336 Ilica stream, Gulf of Antalya, Mediterranean Sea basin,Turkey
C. caelestis JF798286 Goksu River, Mediterranean Sea basin, Turkey
C. caelestis JF798287 Kargi Cayi River, Mediterranean Sea basin, Turkey
C. coadi* KU564303 Beshar River, Tigris River basin, Iran
C. coadi* KU564304 Beshar River, Tigris River basin, Iran
C. coadi* KU564305 Beshar River, Tigris River basin, Iran
C. coadi* KU564306 Beshar River, Tigris River basin, Iran
C. damascina JF798309 Karadut River, Euphrates basin, Turkey
C. damascina JF798303 Stream Arsuz, Iskenderun Gulf basin, Mediterranean Sea, Turkey
C. damascina JF798308 Yocalti River, Turkey
C. damascina JF798306 Spring Incesu, Orontes basin, Mediterranean Sea, Turkey
C. damascina JF798307 Yocalti River, Mediterranean Sea basin, Turkey
C. ekmekciae GQ424027 Unknown
C. heratensis JF798319 Keltechinar River, Turkmenistan
C. heratensis JF798318 Yanbash River, Turkmenistan
C. heratensis JF798317 Yanbash River, Turkmenistan
C. heratensis JF798316 Murgab River, Turkmenistan
C. kosswigi JF798322 Deli Cayi River, Van Lake basin, Turkey
C. kosswigi JF798323 Deli Cayi River, Van Lake basin, Turkey
C. mandica * KU564307 Ghare Aghaj River, Mond River basin, Khaneh Zanian , Iran
C. mandica * KU564308 Ghare Aghaj River, Mond River basin, Khaneh Zanian , Iran
C. mandica * KU312375 Ghare Aghaj River, Mond River basin, Khaneh Zanian , Iran
C. mauricii JF798325 Eflatum spring, Beysehir Lake basin, Turkey
C. mauricii JF798324 Sarioz stream, Beysehir Lake basin, Turkey
C. saadii* KU564309 Ghare Aghaj River, Mond River basin, Firuzabad, Iran
C. saadii* KU564310 Ghare Aghaj River, Mond River basin, Firuzabad , Iran
C. saadii* KU564311 Saadii Tomb Spring, Maharlu basin, Iran
C. saadii* KU312373 Helleh River, Helleh basin, KohmarSorkhi, Iran
C. saadii* KU564312 Kor River, Kor basin, Kamfirouz, Iran
C. saadii* KU564313 Kor River, Kor basin, Kamfirouz, Iran
C. saadii JF798326 Rodan River, Makran basin, Iran
C. saadii JF798327 Spring Golabii, 35 km north from Darab, Hormuz basin, Iran
C. sieboldii JF798329 Kizilirmak River, Black Sea basin, Turkey
C. sieboldii JF798330 Kelkit Cayi River, Black Sea basin, Turkey
C. tinca GQ424008 Unknown
C. tinca GQ424007 Unknown
C. trutta JF798334 Dez River, Karun River basin, Iran
C. trutta JF798333 Sultansuyu River, Euphrates basin, Turkey
C. trutta JF798332 Gelal River, Ab e Seymareh, Tigris River basin, Iran
C. turani JF798335 Çatkit River, Mediterranean Sea basin, Turkey
Cyprinus carpio DQ868875 Unknown
Table 11.
Download as
CSV
XLSX

List of species used for molecular analysis for COI (*present study, the ones without * are obtained from GenBank). Cyprinus carpio was considered as outgroup.

Species Accession num. Locality
C. heratensis* KU564288 Gilas spring, Tedzen basin, Iran
C. heratensis* KU564289 Gilas spring, Tedzen basin, Iran
C. heratensis* KU564290 Gilas spring, Tedzen basin, Iran
C. heratensis* KU564291 Bezangan Lake, Tedzen basin, Iran
C. angorae KJ553074 Seyhan, Turkey
C. angorae KJ552868 Seyhan, Turkey
C. antalyensis KJ552850 Aksu, Turkey
C. antalyensis KJ553025 Aksu, Turkey
C. barroisi KJ553267 Orontes, Turkey
C. barroisi KJ553245 Orontes, Turkey
C. barroisi KJ552785 Orontes, Turkey
C. barroisi KJ552810 Orontes, Turkey
C. bergamae KJ553157 Bakir, Turkey
C. bergamae KJ552877 Bakir, Turkey
C. bergamae KJ553253 Biga, Turkey
C. bergamae KJ553081 Biga, Turkey
C. buhsei* KU312349 Kordan River, Namak Lake basin, Karaj, Iran
C. buhsei* KU312350 Kordan River, Namak Lake basin, Karaj, Iran
C. buhsei* KU564292 Roudbar River, Kavir basin,Iran
C. buhsei* KU564293 Roudbar River, Kavir basin,Iran
C. caelestis KJ552856 Göksu, Turkey
C. caelestis KJ553237 Ilica, Turkey
C. caelestis KJ553301 Göksu, Turkey
C. caelestis KJ553030 Göksu, Turkey
C. damascina KJ553080 Arsuz, Turkey
C. damascina KJ553043 Orontes, Turkey
C. damascina KJ552896 Orontes, Turkey
C. damascina KJ553272 Orontes, Turkey
C. damascina KJ552846 Orontes, Turkey
C. damascina KJ552874 Ceyhan, Turkey
C. damascina KJ552797 Orontes, Syria
C. damascina KJ553202 Orontes, Syria
C. damascina KJ553027 Ceyhan, Turkey
C. damascina KJ553194 Ceyhan, Turkey
C. damascina KJ552763 Ceyhan, Turkey
C. damascina KJ552939 Jordan River Drainage, Syria
C. damascina KJ553216 Orontes, Turkey
C. damascina KJ553089 Orontes, Turkey
C. erhani KJ552767 Ceyhan, Turkey
C. erhani KJ552087 Ceyhan, Turkey
C. erhani KJ552806 Ceyhan,Turkey
C. erhani KJ553067 Ceyhan,Turkey
C. mandica* KU564301 Ghare Aghaj River, Mond River basin, Khaneh Zanian, Iran
C. mandica* KU564302 Ghare Aghaj River, Mond River basin, Khaneh Zanian, Iran
C. mandica* KU312368 Ghare Aghaj River, Mond River basin, Khaneh Zanian, Iran
C. pestai KJ553304 Egirdir, Turkey
C. pestai KJ553138 Egirdir, Turkey
C. pestai KJ552113 Egirdir, Turkey
C. pestai KJ552841 Egirdir, Turkey
C. pestai KJ552818 Egirdir, Turkey
C. tinca KJ553229 Simav, Turkey
C. tinca KJ553168 Simav, Turkey
C. trutta* KU312352 Karkheh River, Tigris River basin, Seymareh, Iran
C. trutta* KU312351 Gavi River, Tigris River basin, Illam, Iran
C. turani KJ553224 Ceyhan Nehri, Turkey
C. saadii* KU312358 Saadii Tomb Spring, Maharlou basin, Iran
C. saadii* KU312395 Spring Pirbanoo, Maharlou basin, Iran
C. saadii* KU312360 Helleh River, Helleh basin, KohmarSorkhi, Iran
C. saadii* KU312361 Helleh River, Helleh basin, KohmarSorkhi, Iran
C. saadii* KU564299 Kor River, Kor basin, Kamfiruz, Iran
C. saadii* KU564300 Kor River, Kor basin, Kamfiruz, Iran
C. saadii* KU312359 Kor River, Kor basin, Kamfiruz, Iran
C. coadi* KU564294 Beshar River, Tigris River basin, Iran
C. coadi* KU564295 Beshar River, Tigris River basin, Iran
C. coadi* KU564296 Beshar River, Tigris River basin, Iran
C. coadi* KU564297 Beshar River, Tigris River basin, Iran
C. coadi* KU564298 Beshar River, Tigris River basin, Iran
Capoeta sp. KJ552935 Dalaman, Turkey
Capoeta sp. KJ553011 Büyük Menderes, Turkey
Capoeta sp. KJ552882 Dalaman, Turkey
Cyprinus carpio DQ868875 Unknown
Table 12.
Download as
CSV
XLSX

Diagnostic nucleotide substitutions found in mtDNA COI barcode region of Capoeta species. Nucleotide position relative to Cyprinus carpio complete mitochondrial genome.

Species 6545 6620 6626 6665 6683 6713 6749 6758 6761 6770 6818 6845 6875 6887 6905 6986 6995 7076 7088
C. buhsei C A A T G G T C G G G A A C C G A G T
C. caelestis T G C T G A G T G A A C G T T G G G C
C. coadi C A A T A G T C G G G A A C C A A G T
C. damscina T A G T G A G T A A G C A T T G G A C
C. saadii T A A C G G T C A A G A A C C T A G T
Table 13.
Download as
CSV
XLSX

Diagnostic nucleotide substitutions found in cyt b of Capoeta species. Nucleotide position relative to Cyprinus carpio complete mitochondrial genome.

Species 15430 15451 15457 15463 15472 15526 15550 15610 15670 15682 15760 15814 15925 16011 16027 16039 16045 16063
C. buhsei C G T A A G G T G T G G G C C A G C
C. caelestis T A C A A G G A A C A A G T T G A T
C. coadi T G C A G G A C G T G G G C C A G C
C. damascina T A C G A A A T A T G A A C T G A T
C. saadii T G C G A A A T A T G A A C T G A T

For inter-specific differences, the greatest pairwise genetic divergence between C. coadi and its congeners was found to be 6.5 by C. erhani and lowest by C. buhsei (0.4) for COI and greatest 9.7 by C. mandica and lowest (1.5) by C. buhsei for cyt b (Tables 14–15).

Table 14.
Download as
CSV
XLSX

Mean genetic distance for cyt b between Capoeta species.

C. sieboldii C. caelestis C. mauricii C. bergamae C. baliki C. antalyensis C. tinca C. banarescui C. turani C. trutta C. buhsei C. coadi C. mandica C. saadii
C. sieboldii
C. caelestis 3.8
C. mauricii 5.1 4.6
C. bergamae 5.3 5.4 4.8
C. baliki 4.4 4.7 4.5 5.7
C. antalyensis 4.3 4.1 4.1 4.9 4.6
C. tinca 5.3 5.6 5.3 6.6 1.0 5.6
C. banarescui 5.7 4.9 4.9 6.0 4.9 4.4 4.9
C. turani 8.1 8.4 9.3 9.5 8.5 8.6 8.8 11.0
C. trutta 8.7 8.7 9.1 9.9 9.1 9.2 9.4 10.9 1.2
C. buhsei 4.3 2.6 4.1 5.6 4.3 4.0 5.1 4.7 9.3 9.5
C. coadi 4.2 2.6 4.5 6.0 5.0 4.3 5.8 5.4 9.4 9.6 1.5
C. mandica 8.5 8.8 9.0 9.9 8.7 9.5 9.2 11.4 1.5 1.1 9.6 9.7
C. saadii 4.8 3.3 4.8 4.6 4.7 4.8 5.4 5.8 8.5 8.9 2.8 2.7 9.1
C. aculeata 6.5 6.6 7.2 7.7 7.4 6.5 8.0 7.5 9.2 9.2 6.8 7.0 9.7 6.8
Table 15.
Download as
CSV
XLSX

Mean genetic distance for COI gene between Capoeta species.

C. trutta C. heratensis C. buhsei C. coadi C. saadii C. pestai C. caelestis C. damascina C. barroisi C. bergamae C. tinca C. erhani C. angorae C. antalyensis C. mauricii C. mandica
C. trutta
C. heratensis 7.15
C. buhsei 6.02 5.10
C. coadi 6.01 5.23 0.44
C. saadii 6.22 5.16 1.12 1.42
C. pestai 5.82 5.07 3.83 3.60 3.82
C. caelestis 6.03 4.54 2.61 3.10 2.88 4.01
C. damascina 5.65 4.31 2.56 3.05 2.49 3.65 1.24
C. barroisi 0.57 6.72 5.99 6.52 6.17 6.29 5.93 5.52
C. bergamae 6.56 4.87 3.95 3.81 3.98 4.33 3.64 3.45 6.75
C. tinca 4.39 5.32 4.50 4.77 4.49 5.02 4.44 4.01 4.21 4.47
C. erhani 0.94 6.74 6.03 6.55 6.20 6.18 5.83 5.27 0.99 6.35 4.18
C. angorae 6.37 4.68 3.28 3.41 3.02 3.97 1.91 0.74 6.27 3.78 4.46 5.97
C. antalyensis 5.25 4.15 2.58 2.71 2.92 2.91 2.42 2.76 5.34 2.73 3.64 5.25 3.08
C. mauricii 5.82 5.07 3.83 3.60 3.82 0.00 4.01 3.65 6.29 4.33 5.02 6.18 3.97 2.91
C. mandica 0.42 7.31 6.22 6.34 6.39 5.99 6.20 5.83 0.73 6.54 4.58 1.18 6.54 5.43 5.99
Cyprinus carpio 15.32 14.89 15.13 14.97 14.23 15.85 16.32 15.39 15.53 15.57 15.45 16.06 15.34 15.61 15.85 15.87

The two different phylogenetic analyses produced similar topologies. Both analyses produced a tree with 3 major clades (Figs 6–7). These included Clade I) C. antalyensis, C. baliki, C. banarescui, C. bergamae, C. buhsei, C. caelestis, C. coadi, C. damascina (C. angorae is a synonym [Alwan 2011]), C. kosswigi, C. mauricii, C. pestai, C. saadii, C. sieboldii, and C. tinca, Clade II) C. aculeata, C. ekmeckciae, and C. heratensis, and Clade III) C. barroisi, mandica, C. trutta, and C. turani.

The Iranian members of the C. damascina species complex, clustered together and formed the sister group to the other members in the complex. In these trees, samples of the Capoeta coadi, from Beshar River in Tigris River basin, form a well-supported monophyletic group, sister to C. buhsei in clade I.

Discussion

Based on morphological and molecular results, C. saadii and C. coadi are distinct species in the Capoeta damascina species complex group formerly known as C. damascina in Iranian water bodies. Phylogenetic analyses recovered three main groups inside the genus Capoeta: the Mesopotamian group (C. trutta group), the Anatolian-Iranian group (C. damascina group) and the Aralo-Caspian group (C. capoeta group) which is in agreement with Levin et al. (2012). The genus Capoeta is monophyletic (Levin et al. 2012). Based on the previous published data, the Capoeta damascina species complex group diverged from the C. capoeta group about 9.1 MYA (95% CI: 6.4–10.9) in the Tortonian period (Levin et al. 2012). Iranian members of the C. damascina group (buhsei, saadii and coadi) formed a clade sister to other C. damascina species complex group members.

The populations of Capoeta from the Karun River drainage have long been considered as C. damascina (Esmaeili et al. 2010). However, it has been proposed that C. damascina might be restricted to the Damascus area in Syria. Most Iranian populations, referred to C. damascina, including Karun River population have been considered as C. saadii (Heckel, 1847) (Teimori et al. 2016). Capoeta saadii was originally described from Persepolis, Pulwar (Sivand) River, Kor River basin, Ruins, northeast of Shiraz, Iran. It was considered as a synonym of C. damascina (Esmaeili et al. 2010) and as a valid species by Bianco and Bănărescu (1982), by Levin et al. (2012) and by Teimori et al. (2016). Based on morphological and molecular results presented here, C. saadii is a valid species closely related to C. buhsei (as proposed by Bianco and Bănărescu (1982) and to C. coadi yet is diagnosed from these species and from C. damascina (see Alwan 2011). Capoeta saadii is the least known species of the genus. It is not mentioned in the revision of the genus by Karaman (1969) who had no specimens available, but its position within the genus Capoeta and its close phylogenetic relationship to C. coadi and C. buhsei were demonstrated using many fresh specimens at our disposal, mostly from type localities.

Comparative materials used in morphological and molecular phylogenetic analyses

Morphological analyses

Capoeta buhsei: ZM-CBSU Z218-229, 12, 104-149 mm SL; Iran, Semnan prov., Kavir basin, Hableh Rud at Garmsar, 35°18'06"N, 52°24'57"E. 21 August 2011. H.R. Esmaeili, G. Sayyadzadeh, A. Gholamifard, R. Zamaniannejad. ZM-CBSU Z260-274, 15, 88–130 mm SL; Iran, Albourz prov., Kordan River at Karaj, 35°57'12"N, 56°50'18"E. 5 July 2014. M. Masoudi, R. Khaefi. H.R. Mehraban.

Capoeta fusca: ZM-CBSU Z197-211, 15, 50–78 mm SL; Iran, south Khorasan prov., Sharifabad Qanat at Birjand, 33°58'08"N, 59°17'03"E. 29 August 2011. H.R. Esmaeili, G. Sayyadzadeh, A. Gholamifard, R. Zamaniannejad.

Capoeta mandica: ZM-CBSU Z230-234, 5, 82-130 mm SL; Iran, Fars prov., Qareh Aghaj River at Khaneh Zanian, 29°41'13"N, 52°05'58"E. 30 May 2015. H. Zareian, A. Gholamhosseini, G. Sayyadzadeh. ZM-CBSU Z212-217, 6, 83-118 mm SL; Iran, Fars prov., Qareh Aghaj River at Kavar, 29°10'55"N, 52°41'32"E. 27 February 2015. G. Sayyadzadeh, M. Masoudi.

Capoeta saadii: ZM-CBSU Z136-146, 11, 78-121 mm SL; ZM-CBSU 2504, 1, 82 mm SL; ZM-CBSU 2508, 1, 69 mm SL; ZM-CBSU 2520-2521, 2, 51-62 mm SL; ZM-CBSU 2524-2528, 5, 113-231 mm SL; Iran, Fars prov., Ghadamgah spring, Doroodzan, 30°15'11"N, 54°25'32"E. 21 December 2003. H.R. Esmaeili, Biglari.

Capoeta trutta: ZM-CBSU E100-123, 24, 50-149 mm SL; Iran, Kermanshah prov., Gamasiab River, 34°23'31"N, 47°42'57"E. 27 September 2007. A. Teimori, A. Gholamhosseini, M. Ebrahimi, A. Gholamifard; ZM-CBSU C453-463, 11, 67-177 mm SL; ZM-CBSU C474-477, 4, 67–75 mm SL; ZM-CBSU C481, 76 mm SL; all from Iran, Khuzestan prov., Maroon River at Aghajari, 30°44'52"N, 49°54'59"E. 21 March 2008. H. Zareian.

Molecular phylogenetic analyses

Capoeta buhsei; ZM-CBSU M1299-1300, 2, Iran, Albourz prov., Kordan River at Karaj, 35°57'12"N, 56°50'18"E. 5 July 2014. M. Masoudi, R. Khaefi. H.R. Mehraban. GenBank accession number: (COI: KU312349, KU312350; cytb: KU312369, KU312370); ZM-CBSU M1289-1290, 2, Iran: Semnan Prov., Kavir basin, Roudbar River at Mehdishahr, 35°37'56"N, 53°20'41"E. 30 August 2011. H.R. Esmaeili et al., GenBank accession number: (COI: KU564292, KU564293).

Capoeta heratensis; ZM-CBSU M813-815, 3, Iran, Razavi Khorasan prov., Gilas spring, 36°36'55"N, 59°20'17"E. 25 August 2011. H.R. Esmaeili et al. GenBank accession number: (COI: KU564288, KU564289, KU564290). ZM-CBSU M816, 1, Iran, Razavi Khorasan prov., Bezangan Lake, Tedzen basin. 36°17'03"N, 60°24'18"E. 25 August 2011. H.R. Esmaeili et al. GenBank accession number: (COI: KU564291).

Capoeta mandica: ZM-CBSU M1433-1435, 3, Iran, Fars prov., Qareh Aghaj River at Khaneh Zanian, 29°41'13"N, 52°05'58"E. 30 May 2015. H. Zareian, A. Gholamhosseini, G. Sayyadzadeh. GenBank accession number: (COI: KU564301, KU564302, KU312368; cytb: KU564307, KU564308, KU312375).

Capoeta saadii: ZM-CBSU M1426-1427, 2, Iran: Fars prov. Kor River, at Kamfirouz, 30°25'2"N, 52°8'59"E. H. Zareian. 24 October 2015. GenBank accession number: (COI: KU564299, KU564300; cytb: KU564312, KU564313). ZM-CBSU M1421, ZM-CBSU1422-1425, 3, Iran, Fars prov., Qareh Aghaj River at Firuzabad, 28°41'31"N, 52°27'43"E. 25 April 2015. H. Zareian. GenBank accession number: (cytb: KU564309, KU564310, KU564311). ZM-CBSU M157, 1, Iran, Fars prov., Shiraz, Saadii Tomb, Maharlou basin, 29°37.348'N, 52° 34.934'E. R. Khaefi, 2009. GenBank accession number: (COI: KU312358). ZM-CBSU M825, M831, 2, Iran, Fars prov., Helleh River, Helleh basin, KohmarhSorkhi, S. Mirgheiasi, S. Ghasemian. 29°23'39"N, 52°09'49"E. GenBank accession number: (COI: KU312361, KU312360; cytb: KU312373). ZM-CBSU M822, 1, Iran, Fars prov., Qareh Aghaj River at Firuzabad, 29°07'34"N, 52°51'24"E. GenBank accession number: (cytb: KU564310). FSJF DNA-18 Iran: Fars prov.: spring Pirbanoo about 10 km south of Shiraz, 29°31'08"N, 52°27'55"E GenBank accession number: (COI: KU312395). FSJF DNA-22; Iran: Fars prov.: River Kor about 73 km north of Shiraz, 30°11'37"N, 52°27'56"E. GenBank accession number: (COI: KU312359).

Capoeta trutta: ZM-CBSU M583, 1, Iran: Ilam prov.; Gavi River at Mehran, H.R. Esmaeili, 13 November 2012, 33°39'18"N, 47°02'14"E. GenBank accession number: COI: KU312351; ZM-CBSU M593, 1, Iran, Ilam prov.; Seymareh River, H.R. Esmaeili, 13 November 2012, 33°38'17"N, 47°01'30"E. GenBank accession number: COI: KU312352.

Acknowledgments

We are pleased to thank A. Gholamhosseini, A. Teimori, M. Masoudi, H. Mehraban, G. Sayyadzadeh, R. Sadeghi, A. Khajepanah & M. Razbani for their help during field work. The research work was funded by the Shiraz University and was approved by the Ethics Committee of Biology Department (ECBD-SU-909789).

References

  • Alwan N (2011) Systematics, taxonomy, phylogeny and zoogeography of the Capoeta damascina species complex (Pisces: Teleostei: Cyprinidae) inferred from comparative morphology and molecular markers. PhD thesis, Goethe Universität, Frankfurt a.M., Germany.
  • Armantrout NB (1980) The freshwater fishes of Iran. Ph.D. Thesis, Oregon State University, Corvallis, Oregon.
  • Banarescu PM (1999) The Freshwater Fishes of Europe. Cyprinidae 2. Part I: Rhodeus to Capoeta. Volume 5. AULA-Verlag, Wiebelsheim.
  • Bahrami Kamangar B, Ghaderi E, Hossinpour H (2012) The fish biodiversity of Gheshlagh River (Sanandj, Iran), a tributary of Tigris basin with occurrence of Rutilus kutum and Hemiculter leucisculus. In: The GIAN International Symposium on” Biodiversity in Zagros Region (Tehran, Iran) May 2012.
  • Berg LS (1949) Freshwater Fishes of the USSR and Adjacent Countries. Academy of Sciences of the USSR. [Translation by O. Ronen, 1964, Israel Programme for Scientific Translations, IPST Press, Jerusalem]
  • Bianco PG, Banarescu PM (1982) A contribution to the knowledge of the Cyprinidae of Iran (Pisces, Cypriniformes). Cybium 3: 75–96.
  • Bruford MW, Hanotte O, Brokfield JFY, Burke T (1992) Single-locus and multilocus DNA fingerprinting. In: Hoelzel AR (Ed.) Molecular genetic analysis of populations: a practical approach. Oxford University Press, New York, 225–269.
  • Coad BW (2008) Fishes of Tehran Province and adjacent areas. Shabpareh Publications, Tehran, 244 pp.
  • Coad BW, Krupp F (1994) Capoeta aculeata (Valenciennes in Cuv. & Val. 1844), a valid species of cyprinid fish from Iran (Teleostei: Cyprinidae). Zoology in the Middle East 10: 63–72. doi: 10.1080/09397140.1994.10637662
  • Cuvier G, Valenciennes A (1842) Histoire naturelle des poissons. Tome 16. Paris.
  • Durand JD, Tsigenopoulos CS, Unlü E, Berrebi P (2002) Phylogeny and biogeography of the family Cyprinidae in the Middle East inferred from cytochrome b DNA- evolutionary significance of this region. Molecular Phylogenetics and Evolution 22(1): 91–100. doi: 10.1006/mpev.2001.1040
  • Esmaeili HR, Coad BW, Gholamifard A, Nazari N, Teimory A (2010) Annotated checklist of the freshwater fishes of Iran. Zoosystematica Rossica 19: 361–386.
  • Ghorbani Chafi H (2000) Identification of different fish species in Koohrang, Bazoft and Zayandeh Rood River in Chahar Mahal-e-Bakhtiary Province. Iranian Journal of Fisheries Sciences 8(4): 43–56. [In Farsi]
  • Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  • Heckel JJ (1849) Die Fische Persiens gesammelt von Theodor Kotschy. In: Russegger J (Ed.) Reisen in Europa, Asien und Afrika. Volume 2. Schweitzerbart’sche Verlagsbuchhandlung, Stuttgart, 255–335.
  • Hubbs CL, Lagler KF (1958) Fishes of the Great Lakes Region. University of Michigan Press, Ann Arbor.
  • Jalali B, Shamsi Sh, Barzegar M (2005) Occurrence of Gyrodactylus spp. (Monogenea: Gyrodactylidae) from Iranian freshwater fishes. Iranian Journal Fish Sciences 4: 19–30.
  • Johari SA, Coad BW, Mazloomi S, Kheyri M, Asghari S (2009) Biological and morphometric characteristics of Capoeta fusca, a cyprinid fish living in the qanats of south Khorasan, Iran (Osteichthyes: Cyprinidae). Zoology in the Middle East 47: 63–70. doi: 10.1080/09397140.2009.10638348
  • Kähsbauer P (1964) Zur Kenntnis der Ichthyofauna von Iran (II. Teil). Annalen des naturhistorischen Museums in Wien 67: 453–475, 1 Taf.
  • Karaman MS (1969) Süßwasserfische der Türkei. 7. Teil. Revision der kleinasiatischen und vorderasiatischen Arten des Genus Capoeta (Varicorhinus, Partim). Mitteilungen aus dem hamburgischen Zoologischen Museum und Institut 66: 17–54.
  • Kessler KF (1877) Ryby, vodyashchiesya i vstrechayushchiesya v Aralo-kaspiisko-pontiiskoi ikhtiologicheskoi oblasti. Volume 4. Trudy Aralo-Kaspiiskoi Ekspeditsi, Sankt-Peterburg.
  • Krupp F (1983) Freshwater fishes of Saudi Arabia and adjacent regions of the Arabian Peninsula. Fauna of Saudi Arabia 5: 568–636.
  • Krupp F (1985) Systematik und Zoogeographie der Süßwasserfische des levantinischen Grabenbruchsystems und der Ostküste des Mittelmeeres Dissertation zur Erlangung des Grades “Doktor der Naturwissenschaften” am Fachbereich Biologie der Johannes Gutenberg - Universität in Mainz, Mainz.
  • Krupp F, Schneider W (1989) The fishes of the Jordan River drainage basin and Azraq Oasis. Fauna of Saudi Arabia 10: 347–416.
  • Krupp F, Al-Jumaily M, Bariche M, Khalaf M, Malek M, Streit B (2009) The Middle Eastern Biodiversity Network: Generating and sharing knowledge for ecosystem management and conservation. ZooKeys 31: 3–15. doi: 10.3897/zookeys.31.371
  • Küçük F, Turan D, Şahin C, Gülle İ (2009) Capoeta mauricii n. sp., a new species of cyprinid fish from Lake Beyşehir, Turkey (Osteichthyes: Cyprinidae). Zoology in the Middle East 47: 71–82. doi: 10.1080/09397140.2009.10638349
  • Levin BA, Freyhof J, Lajbner Z, Perea S, Abdoli A, Gaffaro lug M, Özuluh M, Rubenyan HR, Salnikov VB, Doadrio I (2012) Phylogenetic relationships of the algae scraping cyprinid genus Capoeta (Teleostei: Cyprinidae). Molecular Phylogenetics and Evolution 62: 542–549. doi: 10.1016/j.ympev.2011.09.004
  • Machordom A, Doadrio I (2001) Evidence of a Cenozoic Betic–Kabilian Connection Based on Freshwater Fish Phylogeography (Luciobarbus, Cyprinidae). Molecular Phylogenetics and Evolution 18(2): 252–263. doi: 10.1006/mpev.2000.0876
  • Nikol’skii AM (1899) Presmykayushchiyasya, amfibii i ryby vtorogo puteshestviya NA Zarudnego v Persiyu v 1898 g [Reptiles, amphibians and fishes collected on the second expedition of NA Zarudnyi to Persia in 1898]. Ezhegodnik Zoologicheskago Muzeya Imperatorskoi Akademii Nauk, St. Petersburg4: 375–417.
  • Özuluğ M, Freyhof J (2008) Capoeta turani, a new species of barbel from River Seyhan, Turkey (Teleostei: Cyprinidae). Ichthyological Exploration of Freshwaters 19(4): 289–296.
  • Rainboth WJ (1981) Systematics of the Asiatic Barbins (Pisces, Cyprinidae). Unpubl. Ph.D. Dissertation. The University of Michigan, Ann Arbor.
  • Schöter C, Özuluğ M, Freyhof J (2009) Capoeta caelestis, a new species from Göksu River, Turkey (Teleostei: Cyprinidae). Ichthyological Exploration of Freshwaters 20(3): 229–236.
  • Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688. doi: 10.1093/bioinformatics/btl446
  • Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2013) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28: 2731–2739. doi: 10.1093/molbev/msr121
  • Teimori A, Mostafavi H, Esmaeili HR (2016) An update note on diversity and conservation of the endemic fishes in Iranian inland waters. Turkish Journal of Zoology 40: 87–102. doi: 10.3906/zoo-1407-2
  • Turan C (2008) Molecular systematics of Capoeta (Cyprinidae) species complex inferred from mitochondrial 16s rDNA sequence data. Acta Zoologica Cracoviensia 51A(1-2): 1–14. doi: 10.3409/azc.51a_1-2.1-14
  • Turan D, Kottelat M, Ekmekçi FG (2008) Capoeta erhani, a new species of cyprinid fish from Ceyhan River, Turkey (Teleostei: Cyprinidae). Ichthyological Exploration of Freshwaters 19(3): 263–270.
  • Turan D, Kottelat M, Ekmekçi FG, Imamoglu HO (2006a) A review of Capoeta tinca, with descriptions of two new species from Turkey (Teleostei: Cyprinidae). Revue Suisse de Zoologie 113(2): 421–436. doi: 10.5962/bhl.part.80358
  • Turan D, Kottelat M, Kirankaya SG, Engin S (2006b) Capoeta ekmekciae, a new species of cyprinid fish from northeastern Anatolia (Teleostei: Cyprinidae). Ichthyological Exploration of Freshwaters 17(2): 147–156.
  • Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN (2005) DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 360(1462): 1847–1857. doi: 10.1098/rstb.2005.1716
  • Xiao W, Zhang Y, Liu H (2001) Molecular systematics of Xenocyprinae (Teleostei: Cyprinidae): taxonomy, biogeography, and coevolution of a special group restricted in East Asia. Molecular Phylogenetics and Evolution 18: 163–173. doi: 10.1006/mpev.2000.0879
login to comment