Research Article |
Corresponding author: Chunsheng Wang ( wangsio@sio.org.cn ) Academic editor: Pavel Stoev
© 2022 Chuan Yu, Dongsheng Zhang, Ruiyan Zhang, Chunsheng Wang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Yu C, Zhang D, Zhang R, Wang C (2022) New psychropotid species (Echinodermata, Holothuroidea, Elasipodida) of the Western Pacific with phylogenetic analyses. ZooKeys 1088: 99-114. https://doi.org/10.3897/zookeys.1088.69141
|
Holothurians of the family Psychropotidae are widely distributed but remain the least studied deep-sea holothurians. On an expedition to the Western Pacific, six psychropotid specimens were collected by the Jiaolong Human Operated Vehicle (HOV). Through morphological examination, four of them were identified as a new species, Benthodytes jiaolongi sp. nov., which was characterized as having minute papillae, a narrow brim, and a terminal anus; and the ossicles were rods and primary crosses. The remaining two specimens were identified as Psychropotes verrucicaudatus Xiao, Gong, Kou & Li, 2019, first recorded at the Kyushu-Palau Ridge. The phylogenetic analysis showed that B. jiaolongi sp. nov. and P. verrucicaudatus were embedded in the clades Benthodytes and Psycheotrephes, respectively, and that Benthodytes was paraphyletic. The new species clustered with Benthodytes sanguinolenta and was separated from the clade containing the other Benthodytes species.
Benthodytes, deep-sea, holothurians, Psychropotes, taxonomy
Holothurians of the family Psychropotidae (Elasipodida) were first identified by
An expedition of the Jiaolong Human Operated Vehicle (HOV) concentrated on further increasing our understanding of the biodiversity, connectivity, and conservation value of the Western Pacific. During sampling, six specimens of Psychropotidae were collected from seamounts on the Kyushu-Palau Ridge and Weijia Guyot (Fig.
The samples described in the present study were collected by the Jiaolong HOV at a depth of 2408–2602 m, from the Kyushu-Palau Ridge and Weijia Guyot. Before preservation, a Canon EOS 5DII camera (Canon Inc., Tokyo, Japan) was used to take photographs of the specimens on board the ship. Then, a piece of dorsal tissue was cut from all specimens and frozen at -20 °C for DNA extraction. Finally, the specimens were fixed in 10% seawater formalin or 99% alcohol and deposited at the Repository of Second Institute of Oceanography (RSIO). Sodium hypochlorite was used to dissolve body tissues (tentacles, dorsum, ventrum, brim, dorsal warts and gonads), and ossicles present in these tissues were rinsed five times with purified water. The ossicles were observed using a scanning electron microscope (TM 1000; Hitachi, Ltd., Tokyo, Japan).
Total genomic DNA was extracted from 100 mg of muscle tissue using a DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. Two partial mitochondrial genes, 16S rRNA and cytochrome oxidase subunit 1 (COI), were amplified using primers 16S-arL/brH and COI-ef/er (
Primer | Sequence 5′→ 3' | PCR procedure |
---|---|---|
COI-ef | ATAATGATAGGAGGRTTTGG | Pre denaturation: 95 °C for 3 min |
COI-er | GCTCGTGTRTCTACRTCCAT | 40 cycles: |
Denaturation: 95 °C for 40 s | ||
Annealing: 45 °C for 40 s | ||
Extension: 72 °C for 50 s | ||
16S-arL | CGCCGTTTATCAAAAACAT | Pre denaturation:95 °C for 3 min |
16S-brH | CCGGTCTGAACTCAGATCACG | 35 cycles: |
Denaturation: 95 °C for 40 s | ||
Annealing: 50 °C for 40 s | ||
Extension: 68 °C for 50 s |
For a more comprehensive phylogenetic analysis, we not only used the sequences of Psychropotidae obtained here, but also used mitochondrial sequences of Elpidiidae Théel, 1882 and two species of Stichopodidae Haeckel, 1886, an outgroup (Table
Family | Species | GenBank accession number | |
---|---|---|---|
16S | COI | ||
Psychropotidae Théel, 1882 | Benthodytes manusensis Xiao, Li & Sha, 2018 | MH627223.1 | MH627222.1 |
Benthodytes sanguinolenta Théel, 1882 | HM196507.1 | ||
Benthodytes marianensis Li, Xiao, Zhang & Zhang, 2018 | MH049433.1 | MH049435.1 | |
Benthodytes jiaolongi sp. nov. | MW992746 | MW990356 | |
Benthodytes jiaolongi sp. nov. | MW992747 | MW990357 | |
Psycheotrephes exigua Théel, 1882 | KX874392.1 | ||
Psychropotes longicauda Théel, 1882 | DQ777099.1 | KU987469.1 | |
Psychropotes moskalevi Gebruk & Kremenetskaia in Gebruk et al., 2020 | MN310400.1 | MN313655.1 | |
Psychropotes raripes Ludwig, 1893 | MN310403.1 | MN313656.1 | |
Psychropotes verrucicaudatus Xiao, Gong, Kou & Li, 2019 | MW992749 | MW980089 | |
Psychropotes verrucicaudatus Xiao, Gong, Kou & Li, 2019 | MW992748 | MW980088 | |
Elpidiidae Théel, 1882 | Peniagone diaphana Théel, 1882 | KX856725.1 | KX874384.1 |
Peniagone incerta Théel, 1882 | HM196402.1 | ||
Peniagone sp. AKM-2016 | KX856726.1 | KX874385.1 | |
Peniagone vignoni Hérouard, 1901 | HM196381.1 | ||
Elpidia glacialis Théel, 1876 | HM196413.1 | ||
Amperima robusta Théel, 1882 | KX856728.1 | KX874381.1 | |
Protelpidia murrayi Théel, 1879 | KX856727.1 | KX874382.1 | |
Scotoplanes sp.TT-2017 | LC230158.1 | ||
Laetmogoidae Ekman, 1926 | Laetmogone wyvillethomsoni Théel, 1879 | HM196504.1 | |
Pannychia moseleyi Théel, 1882 | KX856731.1 | KX874380.1 | |
Benthogone abstrusa Sluiter, 1901 | KX856733.1 | KX874374.1 | |
Enypniastes eximia Théel, 1882 | |||
Pelagothuriide Ludwig, 1893 | KX856730.1 | KX874383.1 | |
Stichopodidae Haeckel, 1896 | Apostichopus californicus Stimpson, 1857 | KP398509.1 | KP398509.1 |
Apostichopus parvimensis H.L. Clark, 1913 | KX856750.1 | KX874373.1 |
Suborder Psychropotina Hansen, 1975
Family Psychropotidae Théel, 1882
(according to
Holotype : RSIO6017101, adult specimen, collection number: DY60-JL171-B01, 16.935°N, 134.911°E,12 January 2021, 2602 m; Paratype: RSIO3710601, adult specimen, collection number: DY37-JL106-B01, 13.017°N, 156.947°E, 1 May 2016, 2408 m.
RSIO590504, adult specimen, collection number: DY59-ROV05-B04, 16.916°N, 134.916°E, 20 July 2020, 2692 m; RSIO590506, adult specimen, collection number: DY59-ROV05-B06, 16.933°N, 134.916°E, 20 July 2020, 2453 m.
Body elongated and subcylindrical when fixed. Skin red with violet, thin, soft. No obvious large papillae arranged on dorsal surface. Some minute papillae, conical with tips, on the anterior dorsum. Brim narrow, thin, flattened. Mouth ventral, anus terminal. Eighteen tentacles; circum-oral papillae present. Dorsal ossicles include rods and primary crosses with four arms. Rods present in tentacles. Ossicles of ventrum not observed.
(RSIO6017101). Length was approximately 25 cm before preservation in 10% seawater formalin. Color violet in life (Fig.
RSIO3710601. Specimen approximately 22 cm in length, 5 cm wide at maximum point. Color red-violet in situ at the seabed (Fig.
RSIO590504.Specimen approximately 22 cm in length before preservation in 10% seawater formalin. Color red-violet on deck, skin transparent; white color after preservation. During sampling, a piece of sponge was stuck in the ROV pump sampler, and the specimen was damaged by the sponge, meaning that the tentacles could not be determined and the dorsal tips could not be distinguished. Quantity of midventral tube feet could not be determined. Mouth ventral, anus terminal. Ossicles not observed.
RSIO590506. Specimen approximately 13 cm in length before preservation in 99% alcohol and heavily damaged. Color red-violet at sea surface, skin transparent. The specimen was stained with sponge as was RSIO590504 and many external characters could not be distinguished. Mouth ventral, anus terminal. Few rods observed on dorsal region (Fig.
The name is derived from the first Chinese HOV ‘Jiaolong’.
Benthodytes typica Théel, 1882 (by original designation).
Kyushu-Palau Ridge, tropical Western Pacific. Depth: 2453–2692 m.
Known from Weijia Guyot and Kyushu-Palau Ridge.
The first group was characterized by the regular crosses, ossicles with bipartite central apophysis and well-developed dorsal papillae. This group included five species: B. incerta Ludwig, 1894; B. lingua Perrier, 1896; B. valdiviae Hansen, 1975; B. sibogae Sluiter, 1901a and B. plana Hansen, 1975. Benthodytes sanguinolenta Théel, 1882 and B. typica Théel, 1882 formed the second group characterized by strongly reduced rod ossicles, and minute dorsal papillae.
Recently, five more species were identified: B. gosarsi Gebruk, 2008; B. wolffi Rogacheva & Cross in
Benthodytes jiaolongi sp. nov. clearly belongs in the genus Benthodytes and is close to Benthodytes sanguinolenta Théel, 1882 and Benthodytes typica Théel, 1882, for the minute papillae and reduced rod ossicles.
Benthodytes typica was described by Théel in 1882 based on specimens collected by the Challenger Expedition. The original description indicated approximately eight, minute, retractile processes located on each of the dorsal ambulacra and unbranched spinose calcareous spicula scattered on the integument.
In general, the morphological features of B. typica can be summarized as follows: 3–7 pairs of minute papillae arranged on the dorsal surface and rods scattered on the body integument and tentacles. Benthodytes jiaolongi sp. nov. differs from B. typica in its arrangement and number of dorsal papillae and composition of ossicles. The dorsal minute papillae of Benthodytes jiaolongi sp. nov. are arranged in two bands along the anterior dorsal ambulacra, and those of B. typica are arranged in a row with 3–7 pairs of papillae. The rods of B. jiaolongi sp. nov. are present in the tentacles and dorsum, and the primary crosses are only present in the dorsum. However, B. typica only present rods scattered on the ventrum, dorsum and tentacles.
The characteristics of B. sanguinolenta as described by
Psychropotes verrucicaudatus Xiao, Gong, Kou & Li, 2019: 421–430.
Catalog number: RSIO6018004, adult specimen, collection number: DY60-JL180-B04, 13.569°N, 134.352°E, 25 January 2021, 2469 m; Catalog number: RSIO6017005, adult specimen, collection number: DY60-JL170-B05, 12.079°N, 134.860°E, 8 January 2021, 2361 m.
RSIO6018004. Specimen resembles a barbell after collection, approximately 20 cm in length before preservation 10% seawater formalin (Fig.
A giant cross with four arms visible in each wart. Arms 800–1000 μm in length, and maximum width between large arms approximately 500 μm. Arm flexion approximately 250 / 400 μm (Fig.
RSIO6017005. Specimen approximately 18 cm in length, height of appendage approximately 40 mm, and width at base approximately 20 mm. Mouth and anus ventral. Skin transparent, light brown color. Dorsal skin and appendage covered with warts; warts also present in dorsum of brim. Giant ossicles visible in warts. Tentacles damaged, more than 12. Ossicles as in RSIO6018004.
Jiaolong Seamount, South China Sea, Western Pacific Ocean, sandy bottom, depth 3615 m.
Psychropotes longicauda Théel, 1882.
Known from Jiaolong Seamount of South China Sea and Kyushu-Palau Ridge.
The specimens were clearly a new record for the South China Sea, as the species was previously known only from the Jiaolong seamount. The present specimens differed from those of
The intraspecific differences can be listed as follows: (1) In the present specimens, the skin was transparent and the color was darker than that of the type specimen; (2) The width of the appendage at the base was also larger than that of the type specimen; (3) The length of the primary crossing arms distributed in the dorsum, ventrum, and brim was longer than that of the type specimen. Furthermore, the spinous rod of the dorsal ossicles was not present in the type specimen, and the ventral body wall of the specimens did not possess the tripartite ossicles of the type specimens; and (4) Most of the ossicles of the tentacles in our specimens were the same as those of type specimen, but longer.
Owing to limited genetic sequences, the phylogenetic relationships of Elasipodida remains little studied. The new classification system of Elasipodida was constructed by
To obtain clearer phylogenetic relationships, we concatenated 25 COI and 18 16S sequences into a dataset to build ML and BI trees. Although the genetic sequences were limited, the topological structures of the ML and BI trees were mostly consistent with morphological classification. In addition, B. jiaolongi sp. nov. and P. verrucicaudatus were embedded in the clades of Benthodytes and Psycheotrephes, respectively (Fig.
Laetmogonidae was an obvious polyphyletic group, and Pannychia moseleyi Théel, 1882 was placed in the outmost clade of the other three families. Laetmogone wyvillethomsoni Théel, 1879 clustered with Elpidiidae and was sister to this clade; Benthogone abstrusa Sluiter, 1901 was clustered with Enypniastes eximia Sluiter, 1901, but the Bayesian posterior probabilities and bootstrap values of this clade were low.
Based on the morphological and phylogenetic analyses, B. jiaolongi sp. nov. can be identified as a new species closely related to B. sanguinolenta. In addition, our specimens provided a new record of P. verrucicaudatus in the Western Pacific, broadening its distribution. Our results support the hypothesis that Benthodytes is paraphyletic and that the clade of B. sanguinolenta and B. jiaolongi sp. nov. is separated from the other species of Benthodytes.
We are grateful to all the scientists and crew on the R/V “Shen Hai Yi Hao” and “Xiang yang hong 9”, and the Jiaolong HOV team for help in the collection of the deep-sea specimens. We also thank Dr Lu Bo for helping process the specimens on board. We would like to thank Dr Gebruk and Rogacheva for their help and valuable suggestions and comments on this article. We sincerely thank Dr Xiao Ning for fruitful discussion and critical comments. This study was supported by the foundation of China Ocean Mineral Resources R & D Association (No. DY135-E2-2-03, No. DY135-E2-2-06), the Project of State Key Laboratory of Satellite Ocean Environment Dynamics, Second Institute of Oceanography (SOEDZZ2002).