Research Article |
Corresponding author: Takato Izumi ( iz.takato@gmail.com ) Academic editor: Bert W. Hoeksema
© 2021 Takato Izumi, Takuma Fujii.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Izumi T, Fujii T (2021) Gems of the southern Japanese seas – four new species of Edwardsianthus (Anthozoa, Actiniaria, Edwardsiidae) with redescriptions of two species. ZooKeys 1076: 151-182. https://doi.org/10.3897/zookeys.1076.69025
|
Edwardsianthus England, 1987 is a genus of Edwardsiidae, a family of burrowing and worm-like sea anemones characterized by lacking four mesenteries in the first cycle and containing only one type of nematocysts in nemathybomes. Until now, this genus has accommodated only two species since its establishment and has been recorded only from Indo-West Pacific regions. In this study, six species are reported from Japan: two are previously known species, E. pudicus (Klunzinger, 1877) and E. gilbertensis (Carlgren, 1931); four are new species, E. carbunculus sp. nov., E. sapphirus sp. nov., E. smaragdus sp. nov., and E. amethystus sp. nov. Based on these results, the diagnostic features of the genus are revised.
Cnidaria, cnidae, Kochi, Nansei Islands, nemathybomes, northernmost distribution limit, Pacific Ocean, phylogeny, taxonomy
The superfamily Edwardsioidea, re-established by
The genus Edwardsianthus England, 1987 was established in order to rearrange the type genus of Edwardsiidae, Edwardsia de Quatrefages, 1842.
Edwardsianthus specimens have been collected from a broad range in the Indo-West Pacific region (Fautin, 2013). However, until now there has been only one record of an Edwardsianthus species from Japanese waters; E. gilbertensis from Ishigaki Island, Okinawa (Uchida & Soyama, 2001). This reference also mentioned Edwardsianthus cf. pudica from Onagawa, Miyagi as reported in
During recent surveys of Japanese waters, we recorded two previously described species of Edwardsianthus and also collected specimens of four undescribed species. These undescribed species have tentacles in more vivid colors than the two other ones, and they share the same particular morphological genus characters. Moreover, in our phylogenetic analysis, these undescribed species were found within the clade of Edwardsianthus and monophyletic with the other two species.
We formally describe the new species as Edwardsianthus carbunculus sp. nov., E. smaragdus sp. nov., E. sapphirus sp. nov., and E. amethystus sp. nov., and redescribe the two existing species, E. pudicus and E. gilbertensis. Furthermore, we revise the definition of Edwardsianthus to accommodate the four new species. Since neither the family, the genus, nor its species had names in the Japanese language, we designate Japanese names to all these taxa.
Specimens of Edwardsianthus used in the present study were collected from southern Japan (Fig.
Localities of the specimens of the Edwardsianthus species collected in this study. Purple star marked by p indicates collection locality of Edwardsianthus pudicus; orange stars are those of E. gilbertensis; red star marked by c is E. carbunculus sp. nov.; blue star marked by a is E. sapphirus sp. nov.; green star marked by s is E. smaragdus sp. nov.
Histological sections of all specimens were made following standard protocols (Presnell and Schreibman, 1997); The materials were dissected by scissors, serially dehydrated by ethanol and xylene, embedded in paraffin, and sliced into serial sections each 8–10 μm thick. Thereafter, sections were mounted on glass slides. All sections were stained by hematoxylin and eosin, and finally they were mounted using the medium EUKITT (ORSAtec).
Cnidae were extracted from the tentacles, actinopharynx, nemathybomes, column, and filaments. Concerning the column of some Edwardsianthus species, no or few cnidocytes were observed, and the few observed capsules were broken or almost of the same type as those observed in their nemathybomes. In those cases, we did not describe the cnidom of column because it is possible that these cnidae were contaminants from broken nemathybomes. Images of the cnidae were obtained by differential interference contrast microscopy following the method of
DNA was extracted from subsamples of each tissue that were preserved in 99% ethanol by using ChargeSwitch gDNA Micro Tissue Kit (Invitrogen). In addition, some tissue samples for DNA were processed following the guanidine extraction protocol (
Primers and protocols of polymerase chain reactions of every molecular marker.
Marker | Primer | Sequences (5‘-3‘) | PCR protocol | Reference | |
---|---|---|---|---|---|
12S | 12S1a | TAAGTGCCAGCAGACGCGGT | (95 °C for 4 min) + 4 × [(94°C for 30 sec) → (50°C for 1 min) → (72°C for 2 min)]+30 × [(94°C for 30 sec) → (55°C for 1 min) → (72°C for 2 min)] + (72°C for 4 min) |
|
|
12S3r | ACGGGCAATTTGTACTAACA | ||||
16S | ANEM16SA | CACTGACCGTGATAATGTAGCGT | (95°C for 4 min) + 30 × [(95°C for 30 sec) → (46°C for 45 sec) → (72°C for 1 min)] + (72°C for 5 min) |
|
|
ANEM16SB | CCCCATGGTAGCTTTTATTCG | ||||
16Sant1a | GCCATGAGTATAGACGCACA | (95°C for 4 min) + 30 × [(95°C for 30 sec) → (46°C for 45 sec) → (72°C for 1 min)] + (72°C for 5 min) |
|
||
16SbmoH | CGAACAGCCAACCCTTGG | ||||
18S | PCR | 18SA | AACCTGGTTGATCCTGCCAGT | (94°C for 4 min) + 35 × [(94°C for 20 sec) → (57°C for 20 sec) → (72°C for 1 min 45 sec)] + (72°C for 7 min) |
|
18SB | TGATCCTTCCGCAGGTTCACCT | ||||
Only sequence | 18SL | CCAACTACGAGCTTTTTAACTG | |||
18SC | CGGTAATTCCAGCTCCAATAG | ||||
18SY | CAGACAAATCGCTCCACCAAC | ||||
18SO | AAGGGCACCACCAGGAGTGGAG |
The phylogenetic analyses were performed on the family Edwardsiidae. The base sequences used in phylogenetic analyses are shown in Table
Base sequences in the phylogenetic analyses. Sequences indicated by accession numbers were obtained from GenBank, and those indicated by bold were newly obtained in this study. Synactinernus churaumi (Actinernidae) were for the outgroups of phylogenetic analysis of Edwardsiidae.
Higher taxon | Family | Genus | Species | Localities | Catalog numbers | 12S | 16S | 18S | ||
---|---|---|---|---|---|---|---|---|---|---|
Actiniaria | Anenthemonae | Edwardsioidea | Edwards | Edwardsianthus | pudicus | Amami Island | NSMT-Co 1702 | LC649467 | LC649475 | LC649483 |
gilbertensis | Ishigaki Island | CMNH-ZG 6527 | – | LC649481 | LC649489 | |||||
gilbertensis | Kataburu_Yonaguni | NSMT-Co 1701 | LC649468 | LC649476 | LC649484 | |||||
carbunculus | Otsuki_Kochi | CMNH-ZG 05954 | LC649472 | LC649480 | LC649488 | |||||
sapphirus | Oura Bay | CMNH-ZG 09761 | LC649469 | LC649477 | LC649485 | |||||
smaragdus | Amami Island | CMNH-ZG 09762 | LC649471 | LC649479 | LC649487 | |||||
amethystus | Oura Bay | CMNH-ZG 09763 | LC649470 | LC649478 | LC649486 | |||||
Tempuractis | rinkai | Misaki | NSMT-Co 1573 | LC649473 | LC649482 | LC649490 | ||||
Edwardsia | japonica | GU473274 | GU473288 | GU473304 | ||||||
timida | GU473281 | - | GU473315 | |||||||
Edwardsianthus | gilbertensis | EU190728 | EU190772 | EU190859 | ||||||
Scolanthus | shrimp | MN200242 | MN200264 | MN200245 | ||||||
celticus | MN200251 | MN200244 | MN200240 | |||||||
Nematostella | vectensis | EU190750 | AY169370 | AF254382 | ||||||
Actinernidae | Synactinernus | churaumi | Off Ishigaki Island | NSMT-Co 1661 | LC649474 | LC484641 | LC484636 |
Mitochondrial | Nuclear | ||
---|---|---|---|
12S rDNA | 16S rDNA | 18S rDNA | |
ML analysis | GTR+Gamma | GTR+Gamma | GTR+Gamma |
Bayesian inference | HKY85+Gamma | HKY85+Gamma | K80+Gamma |
All constructed Maximum Likelihood and Bayesian trees were rooted and combined using FigTree ver. 1.4.3 (http://tree.bio.ed.ac.uk/software/figtree/).
Suborder Anenthemonae Rodriguez & Daly, 2014
Superfamily Edwardsioidea Andres, 1881
Family Edwardsiidae Andres, 1881
(revised from the diagnosis given by England, 1987). Body divisible into physa, scapus, and capitulum. physa short, without nemathybomes or cuticle. Scapus long, generally with nemathybomes but sometimes without, sunk in mesoglea; cuticle present. Tentacles usually 20, inequal number at inner and outer cycle: five-eight inner and 12–15 outer. Siphonoglyph weak or absent, ventral. Mesenteries eight macrocnemes and six pairs of microcnemes, minute and restricted to distal part of column. Microcnemes never paired with macrocnemes. Gametogenic tissue, filaments, and parietal and retractor muscles on macrocnemes only. Parietals well developed; retractors strong-diffuse to restricted-reniform. Cnidom: spirocysts, basitrichs, microbasic p-mastigophores.
Edwardsia pudica Klunzinger, 1877 (currently recognized as Edwardsianthus pudicus (Klunzinger, 1877); the genus name is masculine). Type locality is Egypt, Red Sea.
This name is constructed from nanyo (south sea), mushimodoki-ginchaku (worm-like sea anemone).
Since
In the present study, sea anemones resembling Edwardsianthus were collected from several Japanese localities (Fig.
Edwardsia pudica Klunzinger, 1877: 80–81, pl. 6, fig. 3; Carlgren, 1931: 18–20, figs 16, 17.
Edwardsiella pudica Andres, 1883: 309.
Edwardsia adenensis Faurot, 1895: 121, pl. 6, fig. 5, pl. 7, fig. 6.
Edwardsia bocki Carlgren, 1931: 7–9, figs 5, 6.
Edwardsia stephensoni Carlgren, 1950: 128–129, figs 1, 2.
Edwardsianthus pudica: England, 1987: 224–229, fig. 10.
NSMT-Co 1702: histological sections, dissected tissues, and prepared nematocysts, collected by SCUBA diving on 7 November 2015 off Kurasaki seashore, Amami-Oshima Island, Kagoshima, Japan, at ca. 20 m depth, by Takuma Fujii.
External anatomy. Size: ca. 120–200 mm in whole length, and ca. 12–15 mm in width in living specimen, and ca. 80–130 mm in length and ca. 8–10 mm in width in preserved specimen (Fig.
Cnidoms of the species of Edwardsianthus pudicus, Edwardsianthus gilbertensis and Edwardsianthus carbunculus sp. nov.
Edwardsianthus pudicus | Edwardsianthus gilbertensis | Edwardsianthus carbunculus sp. n. | ||||||||||||||
NSMT-Co 1702 | CMNH-ZG 06527 | CMNH-ZG 05954 | ||||||||||||||
Length × Width (µm) | Mean (µm) | SD (µm) | n | frequency | Length × Width (µm) | Mean (µm) | SD (µm) | n | frequency | Length × Width (µm) | Mean (µm) | SD (µm) | n | frequency | ||
Tentacle | ||||||||||||||||
basitrichs | 20.1–34.0 × 2.9–4.2 | 27.4 × 3.6 | 3.09 × 0.30 | 57 | numerous | 13.2–26.4 × 2.8–4.6 | 20.5 × 3.6 | 3.23 × 0.44 | 50 | numerous | 25.9–34.6 × 2.7–4.3 | 30.0 × 3.3 | 2.05 × 0.29 | 94 | numerous | |
spirocysts | 11.9–20.1 × 2.2–3.6 | 15.1 × 2.9 | 1.88 × 0.32 | 25 | numerous | 8.5–14.3 × 3.0–4.4 | 11.0 × 3.4 | 1.43 × 0.35 | 12 | few | 11.8–21.0 × 2.5–3.7 | 16.6 × 3.1 | 1.83 × 0.28 | 57 | numerous | |
Actinopharynx | ||||||||||||||||
basitrichs | S | 17.4–24.2 × 1.9–3.0 | 20.8 × 2.5 | 2.02 × 0.44 | 15 | numerous | 16.3–21.1 × 2.4–3.9 | 18.4 × 3.1 | 1.24 × 0.39 | 12 | few | 14.3–16.9 × 3.5–3.9 | 16.0 × 3.7 | 0.99 × 0.19 | 4 | rare |
L | 34.8–42.6 × 3.3–5.4 | 38.4 × 4.5 | 1.80 × 0.44 | 47 | numerous | 26.5–34.3 × 3.0–4.5 | 30.8 × 3.7 | 1.71 × 0.35 | 66 | numerous | 36.1–48.8 × 3.2–5.0 | 42.5 × 4.2 | 2.85 × 0.40 | 76 | numerous | |
microbasic p-mastigophores | 30.3–35.6 × 6.6–7.1 | 33.4 × 6.7 | 1.92 × 0.17 | 5 | few | 28.9–35.5 × 6.6–8.4 | 32.5 × 7.6 | 2.71 × 0.78 | 3 | rare | – | – | – | – | – | |
Nemathybome | ||||||||||||||||
basitrichs | S | – | – | – | – | – | – | – | – | – | – | 16.6–19.9 × 3.9–4.1 | 18.4 × 4.0 | 1.35 × 0.08 | 4 | rare |
L | 46.8–56.6 × 3.2–5.6 | 41.7 × 51.7 | 1.95 × 0.43 | 44 | numerou | 34.0–45.2 × 3.0–4.8 | 39.6 × 3.8 | 2.02 × 0.38 | 75 | numerous | 46.8–56.6 × 3.2–5.6 | 51.7 × 4.3 | 2.08 × 0.47 | 44 | numerous | |
Column | ||||||||||||||||
basitrichs | 15.8–17.5 × 3.4–3.8 | 16.8 × 3.7 | 0.72 × 0.18 | 3 | rare | 9.8–14.4 × 2.8–4.1 | 12.0 × 3.3 | 1.12 × 0.41 | 12 | few | 47.9–53.8 × 3.4–4.8 | 50.8 × 4.0 | 1.62 × 0.33 | 24 | numerous | |
Filament | ||||||||||||||||
basitrichs | S | 25.1–31.7 × 2.4–4.1 | 29.0 × 3.3 | 1.69 × 0.34 | 49 | numerous | 12.9–19.2 × 2.8–4.2 | 14.8 × 3.4 | 1.32 × 0.33 | 61 | numerous | 22.4–32.2 × 3.2–5.0 | 28.3 × 4.0 | 2.29 × 0.43 | 43 | numerous |
L | 29.4–42.7 × 4.2–5.9 | 37.3 × 4.9 | 3.09 × 0.31 | 29 | numerous | – | – | – | – | – | 27.6–44.3 × 4.1–5.8 | 34.8 × 4.8 | 5.87 × 0.51 | 11 | few | |
microbasic p-mastigophores | 29.7–34.1 × 5.2–7.6 | 31.6 × 6.2 | 1.26 × 0.62 | 11 | few | 33.0–38.4 × 8.2–10.9 | 36.3 × 9.3 | 1.63 × 0.72 | 12 | few | 30.1–31.8 × 5.3–5.9 | 30.9× 5.6 | 0.87 × 0.29 | 2 | rare |
External and internal morphology of Edwardsianthus pudicus (NSMT-Co 1702) A outer view of living specimen B oral view of living specimen C longitudinal section of tentacle D transverse section of tentacle E transverse section of parietal muscle F transverse section of macrocnemes G longitudinal section of physa. Abbreviations: cap, capitulum; fi, filament; me, mesoglea; pa, parietal muscle; ph, physa; rm, retractor muscle; scs, scapus; te, tentacle; tlm, tentacular longitudinal muscle. Scale bars: 5 mm (A, B); 1 mm (C); 500 µm (D, F, G); 100 µm (E).
Cnidae of Edwardsianthus species A–E E. pudicus (NSMT-Co 1702) A1 spirocyst in tentacle; A2 basitrich in tentacle B1 small basitrich in actinopharynx B2 large basitrich in actinopharynx B3 microbasic p-mastigophore in actinopharynx C basitrich in nemathybome D basitrich in column E1 small basitrich in filament E2 large basitrich in filament E3 microbasic p- mastigophore in filament F–J E. gilbertensis (CMNH-ZG 06527) F1 spirocyst in tentacle F2 basitrich in tentacle G1 small basitrich in actinopharynx G2 large basitrich in actinopharynx G3 microbasic p-mastigophore in actinopharynx H basitrich in nemathybome I basitrich in nemathybome J1 basitrich in filament J2 microbasic p- mastigophore in filament K–O E. carbunculus sp. nov. (CMNH-ZG 05954) K1 spirocyst in tentacle K2 basitrich in tentacle L1 small basitrich in actinopharynx L2 large basitrich in actinopharynx M1 small basitrich in nemathybome M2 large basitrich in nemathybome N basitrich in column O1 small basitrich in filament O2 large basitrich in filament O3 microbasic p-mastigophore in filament.
see the derivation of genus name.
This specimen from Amami Oshima Island resembled the features of Edwardsianthus pudicus as stated by
Edwardsia gilbertensis Carlgren, 1931: 10–12, figs 7–9.
Edwardsianthus gilbertensis: England, 1987: 218, 231, fig. 10; Uchida and Soyama, 2001: 49.
CMNH-ZG 06527: dissected specimen, histological sections, tissues in paraffin, and prepared nematocysts, collected by wading on 7 June 2013 from the intertidal zone of Kabira Bay, Ishigaki Island, Okinawa Pref., Japan, by Kensuke Yanagi; NSMT-Co 1701: dissected specimens (2 individuals), collected by hand during wading on 26 March 2015 from the intertidal zone of Funaura Bay, Iriomote Island, Okinawa Pref., Japan, by Takato Izumi; NSMT-Co 1781: dissected or whole specimens (3 individuals), collected by wading on 17 March 2015 from the intertidal zone of Yonaha Bay, Miyako Island, Okinawa Pref., Japan, by Takato Izumi; NSMT-Co 1782: histological sections, tissues in paraffin, and prepared nematocysts, collected by wading on 19 March 2014 from the intertidal zone of Kataburu Beach, Yonaguni Island, Okinawa Pref., Japan, by Takato Izumi; NSMT-Co 1783: histological sections, tissues in paraffin, and prepared nematocysts, collected by wading on 23 March 2015 from the intertidal zone of Kataburu Beach, Yonaguni Island, Okinawa Pref., Japan, by Takato Izumi; NSMT-Co 1784–NSMT-Co 1789: whole or dissected specimens, collected by wading on 17 March 2016 from the intertidal zone of Kataburu Beach, Yonaguni Island, Okinawa Pref., Japan, by Takato Izumi; NSMT-Co 1790: dissected specimens (3 individuals), collected by wading on 24 March 2015 from the intertidal zone of Higawa Bay, Yonaguni Island, Okinawa Pref., Japan, by Takato Izumi; NSMT-Co 1791: histological sections, tissues in paraffin, collected by wading on 23 September 2014 from the intertidal zone of Senaga Island, Okinawa Pref., Japan, by Takato Izumi; NSMT-Co 1792: histological sections, tissues in paraffin, collected by wading on 21 September 2014 from the intertidal zone of Yagaji Island, Okinawa Pref., Japan, by Takato Izumi; NSMT-Co 1793: histological sections, tissues in paraffin, collected by hand during snorkeling on 9 November 2015 from Shio-michi, Kikai Island, Kagoshima Pref., Japan, 1 m depth, by Takato Izumi.
External anatomy. Size: preserved specimens ca. 20–60 mm in whole length, and 2.5–3.5 mm in width, with worm-like form, and equal width along whole body. Column: consisting of capitulum, scapus, and physa. The distal-most part capitulum, translucent or opaque gray in color in living specimens, short, without nemathybomes. Scapus with thick periderm-like cuticle, brownish orange in color, both in living and preserved specimens, and with tiny, pale white in color, more or less in 8 rows nemathybomes. Aboral end apparent physa (Fig.
External and internal morphology of Edwardsianthus gilbertensis (CMNH-ZG 06527 except for B) A outer view of preserved specimen B oral view of living specimen with 18 tentacles in the habitat C longitudinal section of oral end D transverse section of nemathybome E transverse section of column in lower part; F. Enlarged view of transverse section of mesenteries. Abbreviations: a, actinopharynx; cap, capitulum; fi, filament; ma, macrocneme; ne, nemathybomes; pa, parietal muscle; ph, physa; rm, retractor muscle; scs, scapus; te, tentacle. Scale bars: 5 mm (A); 1 mm (B); 500 µm (C, E, F); 100 µm (D). Photograph B by Kensuke Yanagi.
Edwardsia gilbertensis was originally described from the Gilbert Islands, Kiribati (Carlgren, 1931), and there have been several reports from other localities in the tropical/subtropical zone in the Pacific (Fautin, 2013). However, there were no records of E. gilbertensis from Japan except for a fieldguide (Uchida & Soyama, 2001), which reported this species from Kabira Bay, Ishigaki Island. In this research we discovered many individuals of E. gilbertensis living not only in the intertidal zone of Kabira Bay in Ishigaki Island (Fig.
Holotype . CMNH-ZG 05954, histological sections, tissues in paraffin, and prepared nematocysts, collected by SCUBA diving on 10 July 2013, Nishidomari (in front of Kuroshio Biological Institute), Kochi Pref., Japan, 5 m depth, by Kensuke Yanagi.
External anatomy. Size: preserved specimen ca. 60 mm in whole length, and 10–15 mm in width (but distal side strongly contracted and aboral side torn off during sampling, so body length estimated > 100 mm when living), with cylinder-like form, and the proximal side a little narrower. Column: consisting of capitulum and scapus. The distal-most part of capitulum, transparent and visible scarlet color inside, short, without nemathybomes. Scapus with very thick periderm-like cuticle, dark brown in color in living specimen (Fig.
External and internal morphology of Edwardsianthus carbunculus sp. nov. (CMNH-ZG 05954) A outer view of preserved specimen (aboral end is damaged) B oral view of living specimen in the habitat (photograph Kensuke Yanagi) C transverse section of column in upper part D transverse section of lower column in lower part E transverse section of the macrocneme F transverse section of testis G transverse section of nemathybomes. Abbreviations: a, actinopharynx; cap, capitulum; fi, filament; me, mesoglea; ne, nemathybomes; pa, parietal muscle; rm, retractor muscle; scs, scapus; te, tentacle. Scale bars: 5 mm (A, B); 500 µm (C–F); 100 µm (G). Picture B taken by Kensuke Yanagi.
The species epithet refers to ruby, a kind of gemstone, and is named so after the scarlet, vivid red, color of its tentacles. Derivation of the Japanese name is the same as that of the Latin species name.
This species can be distinguished from Edwardsianthus not only by the scarlet tentacles, the most characteristic feature of this species, and their arrangement, but also by the species’ cnidom: E. carbunculus can be distinguished from E. gilbertensis and E. pudicus by having two types of basitrichs in its nemathybomes (Table
Cnidoms of the species of Edwardsianthus sapphirus sp. nov., Edwardsianthus smaragdus sp. nov., and Edwardsianthus amethystus sp. nov.
Edwardsianthus sapphirus sp. nov. | Edwardsianthus smaragdus sp. nov. | Edwardsianthus amethystus sp. nov. | ||||||||||||||
CMNH-ZG 09761 | CMNH-ZG 09762 | CMNH-ZG 09763 | ||||||||||||||
Length × Width (µm) | Mean (µm) | SD (µm) | n | frequency | Length × Width (µm) | Mean (µm) | SD (µm) | n | frequency | Length × Width (µm) | Mean (µm) | SD (µm) | n | frequency | ||
Tentacle | ||||||||||||||||
basitrichs | 27.5–37.3 × 3.0–4.8 | 33.1 × 3.9 | 2.27 × 0.40 | 55 | numerous | 25.4–40.3 × 3.0–4.7 | 30.4 × 3.8 | 2.72 × 0.41 | 67 | numerous | 17.0–32.6 × 2.7–4.3 | 27.7 × 3.6 | 3.15 × 0.38 | 55 | numerous | |
spirocysts | 14.9–23.6 × 2.8–4.9 | 19.1 × 3.9 | 1.78 × 0.46 | 64 | numerous | 12.1–21.7 × 2.5–5.1 | 18.0 × 3.8 | 2.07 × 0.49 | 61 | numerous | 14.6–24.1 × 3.0–4.9 | 20.6 × 4.0 | 1.96 × 0.37 | 53 | numerous | |
Actinopharynx | ||||||||||||||||
basitrichs | S | 20.2–25.9 × 2.3–3.6 | 22.1 × 3.1 | 1.49 × 0.40 | 13 | few | 20.5–23.6 × 2.5–3.0 | 22.2 × 2.7 | 1.03 × 0.20 | 6 | few | 12.3–18.2 × 2.7–4.7 | 14.2 × 3.7 | 1.18 × 0.48 | 48 | numerous |
L | 34.1–44.1 × 3.6–5.6 | 39.1 × 4.7 | 2.24 × 0.42 | 44 | numerous | 34.9–47.7 × 3.5–5.9 | 40.0 × 4.5 | 2.46 × 0.44 | 71 | numerous | 28.9–49.1 × 3.8–4.7 | 38.6 × 4.1 | 9.60 × 0.34 | 4 | rare | |
microbasic p-mastigophores | – | – | – | – | – | 35.1–42.0 × 7.2–8.5 | 38.3 × 7.8 | 2.73 × 0.49 | 5 | few | – | – | – | – | – | |
Nemathybome | (No nematocyst was observed) | |||||||||||||||
basitrichs | S | 16.9–20.5 × 3.2–3.9 | 18.5 × 3.4 | 1.05 × 0.22 | 8 | few | 16.5–17.1 × 3.0–3.7 | 16.8 × 3.3 | 0.31 × 0.35 | 2 | rare | |||||
L | 39.8–75.2 × 2.8–4.9 | 56.0 × 3.7 | 4.98 × 0.47 | 43 | numerous | 48.7–61.6 × 3.0–4.7 | 54.4 × 3.8 | 2.75 × 0.41 | 59 | numerous | ||||||
Filament | ||||||||||||||||
basitrichs | S | 25.2–29.8 × 2.6–3.9 | 27.1 × 3.4 | 1.71 × 0.48 | 4 | few | 18.6–32.2 × 2.5–4.1 | 28.2 × 3.1 | 2.23 × 0.33 | 61 | numerous | 12.6–17.3 × 2.9–4.8 | 15.2 × 3.6 | 1.15 × 0.45 | 42 | numerous |
L | 38.4–50.5 × 4.3–6.2 | 44.6 × 5.1 | 2.97 × 0.41 | 54 | numerous | 39.3–52.0 × 4.6–7.1 | 46.1 × 5.8 | 2.77 × 0.51 | 45 | numerous | 27.4–46.3 × 3.6–5.2 | 36.7 × 4.3 | 5.98 × 0.41 | 23 | numerous | |
spirocysts | – | – | – | – | – | 15.6–18.2 × 3.0–4.2 | 16.9 × 3.7 | 1.31 × 0.57 | 2 | rare | 13.3–23.6 × 3.2–6.1 | 19.5 × 4.8 | 2.14 × 0.57 | 27 | numerous | |
microbasic p-mastigophores | 33.1–42.3 × 5.9–8.3 | 36.9 × 7.4 | 2.69 × 0.55 | 16 | numerous | 30.9–41.2 × 6.6–8.6 | 35.0 × 7.8 | 2.91 × 0.70 | 13 | few | 35.1 × 7.8 | – | – | 1 | rare |
To complete the description of this species, it is necessary to collect and examine specimens with complete proximal ends. However, this species was collected only once from the type locality, and no additional field observations are known, even despite the presence of its characteristic red tentacles. This species is the only Edwardsianthus species inhabiting the temperate zone: the other Edwardsianthus species live in tropical or subtropical zones (Fig.
Holotype . CMNH-ZG 09761: histological sections, tissues in paraffin, and prepared nematocysts, collected by SCUBA diving on 24 June 2012, in Oura Bay, Okinawa Island, Okinawa Pref., Japan, 10 m depth, by Takuma Fujii.
External anatomy. Size: preserved specimen ca. 150 mm in whole length, and 20 mm (narrower part)–35 mm (broader part) in width, and > 300 mm in living animal. Column: cylinder-like form, and the proximal part swollen to some extent in preserved specimen. The column consisting of capitulum, scapus and quite small physa. The distal-most part of the capitulum transparently blue, short, without nemathybomes. Scapus with thin and easily stripped periderm, brown in color, and with quite numerous, tiny, pale white in color, scattered nemathybomes (Fig.
External and internal morphology of Edwardsianthus sapphirus sp. nov. (CMNH-ZG 09761). A oral view of living specimen in the habitat B outer view of preserved specimen; C. Transverse section of column in upper part D enlarged view of transverse section of parietal muscle E enlarged view of transverse section of retractor muscle F transverse section of ovary G longitudinal section of tentacle H transverse section of tentacle. Abbreviations: a, actinopharynx; fi, filament; me, mesoglea; ne, nemathybome; oo, oocytes; pa, parietal muscle; ph, physa; rm, retractor muscle; scs, scapus; te, tentacle; tlm, tentacular longitudinal muscle. Scale bars: 1 cm (A, B); 500 µm (C–E); 100 µm (F–H).
Cnidae of Edwardsianthus species A–D E. sapphirus sp. nov. (CMNH-ZG 09761) A1 spirocyst in tentacle A2 basitrich in tentacle B1 small basitrich in actinopharynx B2 large basitrich in actinopharynx C1 small basitrich in nemathybome C2 large basitrich in nemathybome D1 small basitrich in filament D2 large basitrich in filament D3 microbasic p-mastigophore in filament E–H E. smaragdus sp. nov. (CMNH-ZG 09762) E1 spirocyst in tentacle E2 basitrich in tentacle F1 small basitrich in actinopharynx F2 large basitrich in actinopharynx F3 microbasic p-mastigophore in actinopharynx G1 small basitrich in nemathybome; G2 large basitrich in nemathybome; H1 spirocyst in filament; H2 small basitrich in filament H3 large basitrich in filament H4 microbasic p-mastigophore in filament I–K E. amethystus sp. nov. (CMNH-ZG 09763) I1 spirocyst in tentacle I2 basitrich in tentacle J1 small basitrich in actinopharynx J2 large basitrich in actinopharynx K1 spirocyst in filament K2 small basitrich in filament K3 large basitrich in filament K4 microbasic p-mastigophore in filament.
The species epithet refers to a sapphire, a gemstone, and is named so after the brilliant metallic blue color of the species’ tentacles. Derivation of the Japanese name is the same as that of the Latin species name.
This species is one of the largest species of its family. It is not only characterized by its gigantic body size, and bluish metallic tentacle coloration, but also by the strange club-like shape of its parietal muscles. Congeneric species have parietal muscles with simple or slightly branched processes, and there are no confirmed cases of parietal muscles with such secondary branched muscular processes in other species. Thus, the shape of parietal muscle of this species is very conspicuous within its genus, allowing E. sapphirus to be distinguished easily from its congeners.
There have been several observations of the metallic blue tentacles resembling this species reported during SCUBA diving in Amami Oshima by Takuma Fujii and some other divers (Atetsu Bay and some other places). However, it was too difficult to dig out such large edwardsiid sea anemones that are buried deeply in the substrate, as they usually retract their whole bodies quickly into the substrate. Therefore, we think that the difficulty in collecting multiple specimens is the most serious issue that needs to be overcome in order to make additional progress in the study of edwardsiids.
Holotype . CMNH-ZG 09762: histological sections, tissues in paraffin, and prepared nematocysts, collected by SCUBA diving on 31 January 2016, off Shirahama seashore, Amami-Oshima Island, Kagoshima, Japan, 15 m depth, by Daisuke Uyeno.
External anatomy. Size: preserved specimen ca. 70 mm in whole length, and ca. 15 mm in width, and ca. 100 mm in living specimen. Column: cylinder-like in form, and the middle part swollen to some extent (Fig.
External and internal morphology of Edwardsianthus smaragdus sp. nov. (CMNH-ZG 09762). A outer view of living specimen B outer view of preserved specimen C transverse section of retractor muscle D transverse section of the tentacle E longitudinal section of the tentacle F transverse section of column G enlarged view of transverse section of ovary H transverse section of a nemathybome. Abbreviations: a, actinopharynx; cap, capitulum; fi, filament; ma, macrocneme; me, mesoglea; ne, nemathybomes; ov, ovary; pa, parietal muscle; ph, physa; rm, retractor muscle; scs, scapus; te, tentacle; tcm, tentacular circular muscle; tlm, tentacular longitudinal muscle. Scale bars: 1 cm (A, B); 500 µm in (C–H).
This species epithet refers to an emerald, a gemstone, and is named so after the bright green coloration of its tentacles. Derivation of the Japanese name is the same as that of the Latin species name.
Edwardsianthus species usually have strongly developed and diffused retractor and parietal muscles (Figs
In the phylogenetic tree (Fig.
Holotype . CMNH-ZG 09763: histological sections, tissues in paraffin, and prepared nematocysts, collected by SCUBA diving on 28 March 2013, in Oura Bay, Okinawa Island, Okinawa Pref., Japan, 15 m depth, by Takuma Fujii.
External anatomy. Size: preserved specimen ca. 200 mm in whole length, and 7 mm (narrower part)–20 mm (broader part) in width, and > 300 mm in living animal, one of the largest species in edwardsiids (Fig.
External and internal morphology of Edwardsianthus amethystus sp. nov. (CMNH-ZG 09763) A oral view of living specimen in the habitat B outer view of preserved specimen C longitudinal section of tentacle D transverse section of tentacle E transverse section of retractor muscle F transverse section of testis G transverse section of trace of nemathybome. Abbreviations: fi, filament; me, mesoglea; ne, nemathybome-like structure; pa, parietal muscle; rm, retractor muscle; scs, scapus; te, tentacle; tlm, tentacle longitudinal muscle; ts, testis. Scale bars: 1 cm (A, B); 500 µm (E, F); 100 µm (C, D, G).
This species epithet refers to amethyst, a kind of gemstone, and is named after this species’ dark purple tentacle coloration. Derivation of the Japanese name is the same as that of the Latin species name.
The most characteristic feature of this species is the nemathybome-like features without nematocysts. Nemathybomes are pocket-like features on columns of some genera of Edwardsiidae, and they always contain large nematocysts (Carlgren, 1949; Brandão et al. 2019). Thus, the structures of Edwardsianthus amethystus cannot be called nemathybomes because they lack nematocysts. This is the first case of confirmation of this nemathybome-like feature in Edwardsianthus anemones, and by these E. amethystus can be easily distinguished from its congeners. We placed this sea anemone in the genus Edwardsianthus because of the characteristic arrangement of tentacles and mesenteries, but the generic diagnosis has now been modified to “sometimes without” nemathybomes (see the Remarks for the genus).
The concatenated phylogenetic tree of 12S, 16S, and 18S rDNA (total 2886 bp) is shown in Fig.
Maximum-likelihood tree of the order Actiniaria based on the combined dataset of mitochondrial 12S and 16S and nuclear 18S rDNA (total 2866 bp). The clade of the genus Edwardsianthus is colored in a red box. Red bar at node indicates the position at which nemathybomes would be obtained. Numbers indicate ML bootstrap support values followed by BI posterior probabilities of the nodes (bootstrap values of ≥ 50% and posterior probabilities ≥ 0.5 are shown).
In addition, the most basal position of our phylogenetic tree of Edwardsiidae is taken by Tempuractis rinkai Izumi, Ise, & Yanagi, 2018. This edwardsiid is the only species of the genus Tempuractis Izumi, Ise, & Yanagi, 2018. It has a simple morphology compared to other edwardsiid species by showing a smooth body wall without particular structures, like nemathybomes, a simple aboral end without any apparent physa, and simple tentacles without any structures (
We thank the researchers below for sample collection as indicated in parentheses: Kensuke Yanagi (Coastal Branch of Natural History Museum and Institute, Chiba; E. carbunculus and some specimens of E. gilbertensis), Daisuke Uyeno (Kagoshima University; E. smaragdus). Regarding the collection of specimens, we also thank the following people: research members of Umisawa collections (E. pudicus), Takuma Mezaki (Kuroshio Biological Research Institute; E. carbunculus), Shin Nishihira and the members of the diving team Diving Team Snuck Snufkin (E. sapphirus). In addition, we are greatful to Kensuke Yanagi and Toshihiko Fujita (National Science Museume, Tsukuba) for their advice and help for research, and James Davis Reimer (University of the Ryukyus) for editing an early draft of the manuscript. Finally, we thank two reviewers and the editor of this paper for providing us with helpful comments and suggestions. We also thank the financial support from several groups for our research: The Sasakawa Scientific Research Grant from the Japan Science Society (No. 27–528), JSPS KAKENHI (JP17J03267), and Grant-in-Aid for JSPS Fellow DC2 to TI; JSPS KAKENHI (24–3048, JP17K15198, JP17H01913, and 21H03651) and the “Establishment of Research and Education Network on Biodiversity and Its Conservation in the Satsunan Islands” project of Kagoshima University adopted by the Ministry of Education, Culture, Sports, Science and Technology, Japan to TF.
The correct shape of Maximum-likelihood tree of the order Actiniaria based on the combined dataset of mitochondrial 12S and 16S and nuclear 18S rDNA (total 2866 bp)
Data type: phylogenetic tree