Research Article |
Corresponding author: Jun Wu ( wujun@nies.org ) Corresponding author: Bin Wang ( wangbin@cib.ac.cn ) Academic editor: Annemarie Ohler
© 2021 Yanqing Wu, Shengchao Shi, Huiguang Zhang, Weicai Chen, Bin Cai, Van Chung Hoang, Jun Wu, Bin Wang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Wu Y, Shi S, Zhang H, Chen W, Cai B, Hoang VC, Wu J, Wang B (2021) A new species of the genus Rana sensu lato Linnaeus, 1758 (Anura, Ranidae) from Wuyi Mountain, Fujian Province, China. ZooKeys 1065: 101-124. https://doi.org/10.3897/zookeys.1065.67005
|
A new species of the frog genus Rana sensu lato from Wuyi Mountain, Fujian Province, China is described. Molecular phylogenetic analyses clustered the new species into the R. johnsi group and indicated that it was genetically divergent from its closely related species. The new species could be distinguished from its congeners by a combination of the following characters: body size medium, SVL 41.4–45.6 mm (42.9 ± 1.9 mm, n = 4) in adult males and 47.6–50.3 mm (n = 2) in adult females; adult male with a pair of internal subgular vocal sacs; lateroventral grooves present on tip of toes; webbing on fourth toes reaching the tip of toe; transverse skin ridges distinctly present on the dorsal surface of thigh and tibia, the number large (mean 26.5 ± 2.7, range 22–29, n = 6); breeding males possess creamy white nuptial pad with tiny velvety spines on the dorsal surface of the first finger, divided into three parts.
Molecular phylogenetic analyses, morphology, Rana, taxonomy
The brown frog genus Rana sensu lato Linnaeus, 1758 (Anura, Ranidae Batsch, 1796) is broadly distributed across Eurasia, Indochina, and North America (
Recently, in Wuyishan National Park, Wuyishan City, Fujian Province, China, we collected several specimens which can be assigned to Rana sensu lato based on morphology. Molecular phylogenetic analyses and detailed morphological comparisons indicated the specimens represented an undescribed species of the R. johnsi group. Herein we described it as a new species.
Twelve unnamed specimens including four adult males, two adult females, and six tadpoles were collected from Wuyishan National Park, Fujian Province, China (Table
Information for samples used in molecular phylogenetic analyses in this study.
ID | Species | Voucher | Locality | 16S | Cyt b | ND2 | BDNF | RAG1 | Tyr1 |
---|---|---|---|---|---|---|---|---|---|
1 | Rana wuyiensis sp. nov. |
|
China: Fujiang: Wuyi Mountain | MZ337980 | MZ355497 | MZ355540 | MZ355396 | MZ355426 | MZ355465 |
2 | Rana wuyiensis sp. nov. |
|
China: Fujiang: Wuyi Mountain | MZ337981 | MZ355498 | MZ355541 | MZ355397 | MZ355427 | MZ355466 |
3 | Rana wuyiensis sp. nov. |
|
China: Fujiang: Wuyi Mountain | MZ337982 | MZ355499 | MZ355542 | MZ355398 | MZ355428 | MZ355467 |
4 | Rana wuyiensis sp. nov. |
|
China: Fujiang: Wuyi Mountain | MZ337983 | MZ355500 | MZ355543 | MZ355399 | MZ355429 | / |
5 | Rana wuyiensis sp. nov. |
|
China: Fujiang: Wuyi Mountain | MZ337984 | MZ355501 | MZ355544 | / | MZ355430 | MZ355468 |
6 | Rana wuyiensis sp. nov. |
|
China: Fujiang: Wuyi Mountain | MZ337985 | MZ355502 | MZ355545 | MZ355400 | MZ355431 | MZ355469 |
7 | Rana wuyiensis sp. nov. |
|
China: Fujiang: Wuyi Mountain | MZ337986 | MZ355503 | MZ355546 | MZ355401 | MZ355432 | MZ355470 |
8 | Rana wuyiensis sp. nov. |
|
China: Fujiang: Wuyi Mountain | MZ337987 | MZ355504 | MZ355547 | MZ355402 | MZ355433 | MZ355471 |
9 | Rana wuyiensis sp. nov. |
|
China: Fujiang: Wuyi Mountain | MZ337988 | MZ355505 | MZ355548 | MZ355403 | MZ355434 | MZ355472 |
10 | Rana wuyiensis sp. nov. |
|
China: Fujiang: Wuyi Mountain | MZ337989 | MZ355506 | MZ355549 | MZ355404 | MZ355435 | MZ355473 |
11 | Rana wuyiensis sp. nov. |
|
China: Fujiang: Wuyi Mountain | MZ337990 | MZ355507 | MZ355550 | MZ355405 | MZ355436 | MZ355474 |
12 | Rana wuyiensis sp. nov. |
|
China: Fujiang: Wuyi Mountain | MZ337991 | MZ355508 | MZ355551 | MZ355406 | MZ355437 | MZ355475 |
13 | Rana zhengi |
|
China: Sichuan: Gulin County | MZ337992 | MZ355509 | MZ355552 | MZ355407 | MZ355438 | MZ355476 |
14 | Rana zhengi |
|
China: Sichuan: Gulin County | MZ337993 | MZ355510 | MZ355553 | MZ355408 | MZ355439 | MZ355477 |
15 | Rana zhengi |
|
China: Sichuan: Gulin County | MZ337994 | MZ355511 | MZ355554 | MZ355409 | MZ355440 | MZ355478 |
16 | Rana zhengi |
|
China: Sichuan: Gulin County | MZ337995 | MZ355512 | MZ355555 | MZ355410 | MZ355441 | MZ355479 |
17 | Rana zhengi |
|
China: Sichuan: Gulin County | MZ337996 | MZ355513 | MZ355556 | MZ355411 | MZ355442 | MZ355480 |
18 | Rana zhengi |
|
China: Sichuan: Gulin County | MZ337997 | MZ355514 | MZ355557 | MZ355412 | MZ355443 | MZ355481 |
19 | Rana sangzhiensis |
|
China: Hunan: Sangzhi County: Tianping Mountain | MZ337998 | / | / | / | / | / |
20 | Rana sangzhiensis |
|
China: Hunan: Sangzhi County: Tianping Mountain | MZ337999 | / | / | / | / | / |
21 | Rana sangzhiensis |
|
China: Hunan: Sangzhi County: Tianping Mountain | MZ338000 | MZ355515 | / | MZ355413 | MZ355444 | MZ355482 |
22 | Rana sangzhiensis |
|
China: Hunan: Sangzhi County: Tianping Mountain | MZ338001 | MZ355516 | MZ355558 | MZ355414 | MZ355445 | MZ355483 |
23 | Rana sangzhiensis |
|
China: Hunan: Sangzhi County: Tianping Mountain | MZ338002 | MZ355517 | MZ355559 | MZ355415 | MZ355446 | MZ355484 |
24 | Rana sangzhiensis |
|
China: Hunan: Sangzhi County: Tianping Mountain | MZ338003 | MZ355518 | MZ355560 | MZ355416 | MZ355447 | MZ355485 |
25 | Rana sangzhiensis |
|
China: Hunan: Sangzhi County: Tianping Mountain | MZ338004 | MZ355519 | MZ355561 | MZ355417 | MZ355448 | MZ355486 |
26 | Rana sangzhiensis |
|
China: Hunan: Sangzhi County: Tianping Mountain | MZ338005 | MZ355520 | MZ355562 | MZ355418 | MZ355449 | MZ355487 |
27 | Rana sangzhiensis |
|
China: Hunan: Sangzhi County: Tianping Mountain | MZ338006 | MZ355521 | MZ355563 | MZ355419 | MZ355450 | MZ355488 |
28 | Rana zhengi | SCUM 0405190CJ | China: Sichuan: Hongya County: Zhangcun | KX269206 | / | / | / | / | / |
29 | Rana sangzhiensis |
|
China: Hunan: Sangzhi County: Tianping Mountain | MZ338007 | MZ355522 | / | MZ355420 | MZ355451 | MZ355489 |
30 | Rana jonhsi | NNU 1910030 | China: Guangxi: Shiwandashan Mountains | MZ338008 | MZ355523 | MZ355564 | / | MZ355452 | / |
31 | Rana jonhsi | NNU 1910023 | China: Guangxi: Shiwandashan Mountains | MZ338009 | MZ355524 | MZ355565 | / | MZ355453 | / |
32 | Rana jonhsi | NNU 1910010 | China: Guangxi: Shiwandashan Mountains | MZ338010 | MZ355525 | MZ355566 | MZ355421 | MZ355454 | MZ355490 |
33 | Rana jonhsi | NNU 1910032 | China: Guangxi: Shiwandashan Mountains | MZ338011 | MZ355526 | MZ355567 | / | MZ355455 | / |
34 | Rana jonhsi | NNU 1910009 | China: Guangxi: Shiwandashan Mountains | MZ338012 | MZ355527 | MZ355568 | / | MZ355456 | / |
35 | Rana jonhsi | NNU 1910001 | China: Guangxi: Shiwandashan Mountains | MZ338013 | MZ355528 | MZ355569 | / | MZ355457 | MZ355491 |
36 | Rana jonhsi | NNU 1910035 | China: Guangxi: Shiwandashan Mountains | MZ338014 | MZ355529 | MZ355570 | / | MZ355458 | / |
37 | Rana jonhsi | NNU 1910021 | China: Guangxi: Shiwandashan Mountains | MZ338015 | MZ355530 | MZ355571 | / | MZ355459 | / |
38 | Rana jonhsi | NNU 1910017 | China: Guangxi: Shiwandashan Mountains | MZ338016 | MZ355531 | MZ355572 | / | MZ355460 | / |
39 | Rana jonhsi | NNU 1910002 | China: Guangxi: Shiwandashan Mountains | MZ338017 | MZ355532 | MZ355573 | / | MZ355461 | MZ355492 |
40 | Rana jonhsi |
|
China: Guangxi: Jinxiu County | MZ338018 | MZ355533 | MZ355539 | / | / | MZ355493 |
41 | Rana jonhsi |
|
China: Guangxi: Jinxiu County | MZ338019 | MZ355534 | / | MZ355422 | / | / |
42 | Rana jonhsi | IEBR.A 4849 | Vietnam: Cao Bang Province | MZ338020 | MZ355535 | MZ355574 | MZ355423 | MZ355462 | MZ355494 |
43 | Rana jonhsi | IEBR.A 4848 | Vietnam: Cao Bang Province | MZ338021 | MZ355536 | MZ355575 | MZ355424 | MZ355463 | MZ355495 |
44 | Rana jonhsi |
|
Vietnam: Cao Bang Province | MZ338022 | MZ355537 | MZ355577 | / | / | / |
45 | Rana weiningensis |
|
China: Guizhou: Weining County | MZ338023 | MZ355538 | MZ355576 | MZ355425 | MZ355464 | MZ355496 |
46 | Rana amurensis | Tissue ID: MSUZP-SLK-RUS49 | Russia: Tomskaya: Teguldetskii district | KX269203 | KX269349 | KX269418 | / | / | / |
47 | Rana areolata | KU 204370 | USA: Kansas: Lyon: just S of Hartsford | AY779229 | KX269300 | KX269369 | / | / | / |
48 | Rana arvalis | Tissue ID: MSUZP-SLK-MKR21 | Russia: Mordovia: Chamzinskii district | KX269197 | KX269344 | KX269413 | / | / | / |
49 | Rana asiatica | Tissue ID: KIZ-XJ0251 | China: Xinjiang: 47tuan | KX269200 | KX269346 | KX269415 | / | / | / |
50 | Rana aurora | MVZ 188961 | USA: California: Del Norte Co. Kings Valley | KX269212 | / | KX269427 | / | / | / |
51 | Rana berlandieri | JSF 1136 | USA: Texas: Hays: San Marcos | AY779235 | KX269301 | KX269370 | / | / | / |
52 | Rana blairi | JSF 830 | USA: Kansas: Douglas: Lawrence | AY779237 | / | / | / | / | / |
53 | Rana boylii | MVZ 148930 | USA: California: Lake Co. along Butts Creek | KX269178 | KX269299 | KX269368 | / | / | / |
54 | Rana bwana | QCAZ 13964 | Ecuador: Loja: Río Alamor | AY779212 | / | / | / | / | / |
55 | Rana capito | TNHC 60195 | USA: Florida: Marion: Archibold Biological Station | AY779231 | / | / | / | / | / |
56 | Rana cascadae | TNHC-GDC 5297 | no data | KX269176 | KX269302 | KX269371 | / | / | / |
57 | Rana catesbeiana | SCUM 0405176CJ | Pet trade | KX269208 | KX269354 | KX269423 | / | / | / |
58 | Rana chaochiaoensis | SCUM 0405170CJ | China: Sichuan: Zhaojue | KX269192 | KX269339 | KX269408 | / | / | / |
59 | Rana chensinensis | KIZ RD05SHX01 | China: Shaanxi: Huxian | KX269186 | KX269333 | KX269402 | / | / | / |
60 | Rana chiricahuensis | KU 194442 | Mexico: Durango: Río Chico at Mexico Hwy | AY779225 | KX269303 | KX269372 | / | / | / |
61 | Rana clamitans | JSF 1118 | USA: Missouri: Montgomery: 3 km W Danville | AY779204 | KX269304 | KX269373 | / | / | / |
62 | Rana coreana | MMS 223 | South Korea | KX269202 | KX269348 | KX269417 | / | / | / |
63 | Rana culaiensis | KIZ SD080501 | China: Shandong: Culaishan shan | KX269190 | KX269337 | KX269406 | / | / | / |
64 | Rana dabieshanensis | AHU 2016R001 | China: Anhui: Dabie Mountains | MF172963 | / | / | / | / | / |
65 | Rana dalmatina | Tissue ID: MSUZP-NPUA-R-21-1 | Ukraine: Zakarpatska: Uzhgorod District: Tschop | KX269198 | / | / | / | / | / |
66 | Rana dunni | KU 194527 | Mexico: Michoácan: Tintzuntzan: Lago Pátzcuaro | AY779222 | KX269305 | KX269374 | / | / | / |
67 | Rana dybowski | Tissue ID: MSUZP-IVM-1d | Russia: Primorye region: Khasanskii District | KX269188 | KX269335 | KX269404 | / | / | / |
68 | Rana forreri | KU 194581 | Mexico: Sinaloa: 37.9 km S | AY779233 | GU184219 | GU184250 | / | / | / |
69 | Rana graeca | ZMMU A-4293-1 | Crna Gora (Montenegro): Niksic environs | KX269199 | KX269345 | KX269414 | / | / | / |
70 | Rana grylio | MVZ 175945 | USA: Florida: Leon: Tall Timbers Research Station | AY779201 | / | / | / | / | / |
71 | Rana hanluica | KIZ GX07112915 | China: Guangxi: Maoershan shan | KX269191 | KX269338 | KX269407 | / | / | / |
72 | Rana heckscheri | MVZ 164908 | USA: Florida: Gadsen-Leon | AY779205 | / | / | / | / | / |
73 | Rana huanrensis | MMS 231 | South Korea | KX269183 | KX269330 | KX269400 | / | / | / |
74 | Rana iberica | ZMMU A-4292-1 | Portugal: Porto: Valongo environs | KX269195 | KX269342 | KX269411 | / | / | / |
75 | Rana japonica | Tissue ID: KIZ-YPX11775 | Japan: Isumi-shi: Chiba Prefecture | KX269220 | KX269364 | KX269434 | / | / | / |
76 | Rana jiemuxiensis | KIZ HUN0708013 | China: Hunan: Jiemuxi | KX269221 | KX269365 | / | / | / | / |
77 | Rana jiulingensis | SYS a005519 | China: Jiangxi: Mt Guanshan | MT408985 | / | / | / | ||
78 | Rana juliani | TNHC 60324 | Belize: Cayo District: Little Vaqueros Creek | AY779215 | / | KX269375 | / | / | / |
79 | Rana kobai | KUHE: 10051 | Japan: Amami | AB685778 | / | / | / | / | / |
80 | Rana kukunoris | KIZ CJ06102001 | China: Qinghai: Qinghai Lake | KX269185 | KX269332 | KX269401 | / | / | / |
81 | Rana kunyuensis | KIZ HUI040001 | China: Shandong: Kunyu shan | KX269201 | KX269347 | KX269416 | / | / | / |
82 | Rana latastei | Veith 2003 | Italy: Campagna: Seseglio 2 km | AY147946 | AY147967 | / | / | / | / |
83 | Rana longicrus | NMNS 15022 | China: Taiwan: Xiangtianhu: Miaosu | KX269189 | KX269336 | KX269405 | / | / | / |
84 | Rana luteiventris | MVZ 225749 | USA: Washington: Pend Oreille Co. western | KX269213 | KX269358 | KX269428 | / | / | / |
85 | Rana macrocnemis | Tissue ID: MSUZP-LFM-12 | Russia: Daghestan: Agulskiy District | KX269194 | KX269341 | KX269410 | / | / | / |
86 | Rana macroglossa | UTA A-17185 | Guatemala: Sololá: Panajachel: Lake Atitlan | AY779243 | KX269306 | KX269376 | / | / | / |
87 | Rana maculata | KU 195258 | Mexico: Oaxaca: Colonia Rodulfo Figueroa | AY779207 | KX269307 | KX269377 | / | / | / |
88 | Rana magnaocularis | KU 194592 | Mexico: Sonora: Arroyo Hondo: 15.2 km N | AY779239 | KX269308 | KX269378 | / | / | / |
89 | Rana montezumae | KU 195251 | Mexico: Morelos: Lagunas Zempoala | AY779223 | KX269309 | KX269379 | / | / | / |
90 | Rana muscosa | MVZ 149006 | USA: California: Mono: Meadows western | AY779195 | / | / | / | / | / |
91 | Rana neovolcanica | KU 194536 | Mexico: Michoacan: Zurumbueno | AY779236 | KX269310 | KX269380 | / | / | / |
92 | Rana okaloosae | no voucher | USA: Florida: Santa Rosa: 5 km E | AY779203 | / | / | / | / | / |
93 | Rana omeimontis | SCUM 0405196CJ | China: Sichuan: Zhangcun: Hongya | KX269193 | KX269340 | KX269409 | / | / | / |
94 | Rana omiltemana | KU 195179 | Mexico: Guerrero: Agua de Obispo Mexican Plateau | AY779238 | KX269311 | KX269381 | / | / | / |
95 | Rana onca | LVT 3542 | USA: Nevada: Clark: Blue Point Spring Mexican | AY779249 | / | / | / | / | / |
96 | Rana ornativentris | Tissue ID: KIZ-JP080101 | Japan: Kyoto | KX269187 | KX269334 | KX269403 | / | / | / |
97 | Rana palmipes | AMNH A-118801 | Venezuela: Amazonas: Río Mawarinuma | AY779211 | / | / | / | / | / |
98 | Rana palustris | ROM 21658 | USA: New York: Middleburg eastern | KX269207 | KX269353 | KX269422 | / | / | / |
99 | Rana pipiens | JSF 1119 | USA: Ohio: Ottawa: Little Portage State Park | AY779221 | / | / | / | / | / |
100 | Rana pirica | Tissue ID: MSUZP-NPFE-R-08-42 | Russia: Sakhalinskaya Province: Makorovskiy District | KX269184 | KX269331 | / | / | / | / |
101 | Rana psilonota | KU 195119 | Mexico: Jalisco: 2.4 km NW Tapalpa | AY779217 | KX269312 | KX269382 | / | / | / |
102 | Rana pustulosa | KU 200776 | Mexico: Sinaloa: 2.1 km NE Santa Lucia | AY779220 | KX269313 | KX269383 | / | / | / |
103 | Rana pyrenaica | ZFMK 65447-65448 | Spain: Zuriza: Aragón | AY147950 | AY147971 | / | / | / | / |
104 | Rana sakuraii | Tissue ID: KIZJP080104 | Japan: Tokyo | KX269205 | KX269351 | KX269420 | / | / | / |
105 | Rana sauteri | SCUM 0405175CJ | China: Taiwan: Kaohsiung | KX269204 | KX269350 | KX269419 | / | / | / |
106 | Rana septentrionalis | TNHC 72500 | Canada: Ontario: Grey | KX269179 | KX269314 | KX269384 | / | / | / |
107 | Rana sevosa | TNHC 60194 | USA: Mississippi: Harrison | AY779230 | / | / | / | / | / |
108 | Rana shuchinae |
|
China: Sichuan: Zhaojue | KX269210 | KX269356 | KX269425 | / | / | / |
109 | Rana sierrae | MVZ 149007 | USA: California: Mono Co. Meadows | KX269211 | KX269357 | KX269426 | / | / | / |
110 | Rana sierramadrensis | KU 195181 | Mexico: Guerrero: Agua de Obispo | AY779216 | KX269315 | KX269385 | / | / | / |
111 | Rana spectabilis | KU 195186 | Mexico: Hidalgo: La Estanzuela | AY779227 | KX269320 | KX269390 | / | / | / |
112 | Rana sphenocephala | JSF 845 | USA: Kansas: Cherokee eastern | AY779251 | KX269321 | KX269391 | / | / | / |
113 | Rana sylvatica | ID: MSUZP-SUNY-R-4-3 | USA: New York: St. Lawrence Co. | KX269209 | KX269355 | KX269424 | / | / | / |
114 | Rana tagoi | ID: MSUZP-NPJP-R-08-69 | Japan: Kyoto | KX269214 | KX269359 | KX269429 | / | / | / |
115 | Rana tarahumarae | KU 194596 | Mexico: Sonora: 14.4 km E Yecora | AY779218 | KX269322 | KX269392 | / | / | / |
116 | Rana temporaria | ZMMU A-4288-1 | Ukraine: Zakarpatska: Uzhgorod district | KX269196 | KX269343 | KX269412 | / | / | / |
117 | Rana tlaloci | KU 194436 | Mexico: Distrito Federal: Xochimilco | AY779234 | KX269323 | KX269393 | / | / | / |
118 | Rana tsushimensis | NAP 4191 | Japan: Nagasaki: Tsushima | KX269181 | KX269329 | KX269399 | / | / | / |
119 | Rana uenoi | KIZ YPX36615 | Japan: Nagasaki: Tsushima | KX269177 | / | / | / | / | / |
120 | Rana ulma | OKW 135 | Japan: Ryukyu Islands | KX269215 | KX269360 | KX269430 | / | / | / |
121 | Rana vaillanti | KU 195299 | Mexico: Oaxaca: 5.6 mi NE Tapanatepec | AY779214 | / | KX269394 | / | / | / |
122 | Rana vibicaria | TNHC GDC2266 | Costa Rica: Cartago: El Emplame | KX269180 | KX269324 | KX269395 | / | / | / |
123 | Rana warszewitschii | JSF 1127 | Panama | AY779209 | KX269325 | KX269396 | / | / | / |
124 | Rana yavapaiensis | KU 194423 | USA: Arizona: Greenlee: Apache National Forest | AY779240 | KX269319 | / | / | / | / |
125 | Rana zhenhaiensis | KIZ 803271 | China: Zhejiang: Zhenhai | KX269218 | JF939105 | KX269433 | / | / | / |
126 | Odorrana versabilis | HNNU A0019L | China: Hainan: Limu shan | KX269223 | KX269367 | KX269436 | / | / | / |
127 | Pelophylax nigromaculatus | SCUM 045199CJ | China: Sichuan: Hongya | KX269216 | KX269361 | KX269431 | / | / | / |
128 | Rugosa tientaiensis | SCUM 0405192CJ | China: Anhui: Huang shan region | KX269222 | KX269366 | KX269435 | / | / | / |
129 | Hylarana guentheri | SCUM H002CJ | China: Hainan: Sanya | KX269219 | KX269363 | / | / | / | / |
Locations for specimens used in this study. 1. the type locality of Rana wuyiensis sp. nov., Wuyi Mountain, Fujian Province, China; 2. the type locality of R. sangzhiensis, Sangzhi County, Hunan Province, China; 3. the type locality of R. zhengi, Hongya County, Sichuan Province, China; 4. another locality of R. zhengi, Gulin County, Sichuan Province, China; 5. the locality for R. johnsi in Caobang Province, Vietnam; 6. the locality for R. johnsi in Jinxiu County, Guangxi Province, China; 7. the locality for R. johnsi in Shiwandashan Mountains, Guangxi Province, China; 8. the type locality of R. weiningensis, Weining County, Guizhou Province, China.
A total of 40 samples collected in this study was used in molecular analyses, encompassing twelve unnamed specimens from Wuyi Mountain, six R. sangzhiensis, six R. zhengi, 15 R. johnsi, and one R. weiningensis (Table
Locus | Primer name | Sequences (5’ end 3’ end) | Temperature (°C) | Source |
16S | 16SAR | AACGCTAAGATGAACCCTAAAAAGTTCT | 55 | Kocher et al. (1989) |
R16 | ATAGTGGGGTATCTAATCCCAGTTTGTTTT | 55 | Sumida et al. (2000) | |
ND2 | HERP322 | TYCGARGACAGAGGTTTRAG | 50 |
|
HERP323 | CAYCCACGRGCYATYGAA | 51 |
|
|
Cyt b | HERP328 | GAAAARCTRTCGTTGTWATTCAACTA | 52 |
|
HERP329 | CTACKGGTTGTCCYCCRATTCATGT | 53 |
|
|
Tyr | Tyr1G | TGCTGGGCRTCTCTCCARTCCCA | 57 | Bossuyt and Milinkovitch (2000) |
Tyr1B | AGGTCCTCYTRAGGAAGGAATG | 57 | Bossuyt and Milinkovitch (2000) | |
RAG1 | AmpF2 | ACNGGNMGICARATCTTYCARCC | 50 | Hoegg et al. (2004) |
AmpR2 | GGTGYTTYAACACATCTTCCATYTCRTA | 50 | Hoegg et al. (2004) | |
BDNF | BDNF 2F | GAGTGGGTCAAGAGGAGG | 55 | Zhou et al. (2012) |
BDNF_2R | ACTGGGTAGTTCGGCATT | 55 | Zhou et al. (2012) |
For phylogenetic analyses, the corresponding sequences for congeners especially for the topotypes of species in the subgenus Rana were downloaded from GenBank (Table
Sequences were assembled and aligned using the ClustalW module in BioEdit v.7.0.9.0 (
All six adult specimens of the undescribed species were measured (Suppl. material
ED eye diameter (distance from the anterior corner to the posterior corner of the eye);
FIIIL third finger length (distance from base to tip of finger III);
FIIL second finger length (distance from base to tip of finger II);
FIL first finger length (distance from base to tip of finger I);
FIVL fourth finger length (distance from base to tip of finger IV);
FL foot length (distance from tarsus to the tip of fourth toe);
HAL hand length (distance from tip of third digit to proximal edge of inner palmar tubercle);
HDL head length (distance from the tip of the snout to the articulation of jaw);
HDW maximum head width (greatest width between the left and right articulations of jaw);
IND internasal distance (minimum distance between the inner margins of the external nares);
IOD interorbital distance (minimum distance between the inner edges of the upper eyelids);
LAL length of lower arm and hand (distance from the elbow to the distal end of the Finger IV);
LW lower arm width (maximum width of the lower arm);
SL snout length (distance from the tip of the snout to the anterior corner of the eye);
SNT distance between the nasal the posterior edge of the vent;
SVL snout-vent length (distance from the tip of the snout to the posterior edge of the vent);
TFL length of foot and tarsus (distance from the tibiotarsal articulation to the distal end of the Toe IV);
THL thigh length (distance from vent to knee);
TL tibia length (distance from knee to tarsus);
TW maximal tibia width;
TYD maximal tympanum diameter;
UEW upper eyelid width (greatest width of the upper eyelid margins measured perpendicular to the anterior-posterior axis).
To reduce the impact of allometry in adults, the correct value from the ratio of each character to SVL was calculated, and then was log-transformed for the following morphometric analyses. One-way ANOVA tests were conducted to test the significance of differences on morphometric characters between the undescribed species and its closely related species. The significance level was set at 0.05.
The morphological description follows the definition in
ML and BI trees of the mitochondrial DNA dataset presented almost consistent topology (Fig.
Phylogenetic relationships of Rana wuyiensis sp. nov. and its relatives A maximum likelihood (ML) tree reconstructed based on the 16S, ND2 and Cyt b gene sequences B a part of the tree highlighting the relationships of the R. johnsi group. ML bootstrap supports/Bayesian posterior probability was denoted beside each node. Sample 1–44 refer to Table
The R. johnsi group is phylogenetically clustered into the subgenus Rana, but this group could be identified from other species of the subgenus Rana by the tip of toes with lateroventral grooves (vs. absent in other species of subgenus Rana). The undescribed species could be assigned to this species group by a series of morphological characters: tip of toes flat with lateroventral grooves; body size medium, SVL 41.4–45.6 mm (42.9 ± 1.9 mm, n = 4) in adult males and 47.6–50.3 mm (n = 2) mm in adult females; dorsolateral fold distinct and thin, extending straight from posterior margin of upper eyelid to above groin; tympanum distinct, oval; tibio-tarsal articulation reaching forward beyond tip of snout when leg starched forward; skin ridges distinctly arranged on the dorsal surface of thighs and tibias; adult males with a pair of internal subgular vocal sacs; breeding males possess creamy white nuptial pad with tiny hoar velvety spines on the dorsal surface of the first finger, divided into three parts.
Although the R. johnsi group and R. weiningensis both have lateroventral grooves on the tip of toes, the undescribed species in the R. johnsi group could be easily distinguished from R. weiningensis by the following characters: males with internal subgular vocal sacs (vs. absent in the latter); males with lager body size (41.4–45.6 mm, n = 4 vs. 32.8–37.4 mm, n = 3 in the latter); and more developed webbing between toes (webbing on fourth toes reaching tip of toe vs. reaching distal subarticular tubercle in the latter).
In the R. johnsi group, the undescribed species could be identified from its closely related species on morphology. ANOVA tests indicated that on the number of transverse skin ridges on the dorsal surface of thighs and tibias, the undescribed species significantly differs from its closely related species (all p-values < 0.01; Table
Comparisons on number of skin ridges on thighs and tibias between Rana wuyiensis sp. nov. and its closely related species. P-value was resulted from One-way ANOVA test. Significant level at 0.05.
Rana wuyiensis sp. nov. (RW) | R. sangzhiensis (RS) | R. zhengi (RZ) | R. johnsi Vietnam (RJV) | R. johnsi Guangxi, China (RJC) | P-value | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
n = 6 | n = 7 | n = 25 | n = 3 | n = 9 | ||||||||||
Range | Mean ± SD | Range | Mean ± SD | Range | Mean ± SD | Range | Mean ± SD | Range | Mean ± SD | RW vs. RS | RW vs. RZ | RW vs. RJV | RW vs. RJC | |
Number of skin ridges on thighs | 12–16 | 14.0 ± 1.7 | 7–11 | 9.7 ± 1.3 | 7–15 | 10.0 ± 1.8 | 8–12 | 9.3 ± 2.3 | 9–12 | 10.3 ± 0.9 | 0.000 | 0.000 | 0.000 | 0.000 |
Number of skin ridges on tibias | 9–15 | 12.5 ± 2.0 | 8–11 | 10.1 ± 1.1 | 6–12 | 8.1 ± 1.3 | 8–10 | 9.0 ± 1.0 | 6–12 | 8.8 ± 1.8 | 0.005 | 0.000 | 0.001 | 0.000 |
Total number of skin ridges on thighs and tibias | 22–29 | 26.5 ± 2.7 | 17–22 | 19.9 ± 1.8 | 15–22 | 18.1 ± 2.7 | 16–22 | 18.3 ± 3.2 | 16–22 | 19.1 ± 2.0 | 0.000 | 0.000 | 0.000 | 0.000 |
Morphometric comparisons between the adult male specimens of Rana wuyiensis sp. nov. and its closely related species. Units given in mm. See abbreviations for the morphological characters in Materials and methods section. P-value was resulted from One-way ANOVA test. Significant level at 0.05. P-value < 0.05 denoted as bold.
Rana wuyiensis sp. nov. (RW) | R. sangzhiensis (RS) | R. zhengi (RZ) | R. johnsi Vietnam (RJV) | R. johnsi Guangxi, China (RJC) | P-value for male | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
n = 4 | n = 5 | n = 22 | n = 2 | n = 8 | ||||||||||
Range | Mean ± SD | Range | Mean ± SD | Range | Mean ± SD | Range | Mean ± SD | Range | Mean ± SD | RW vs. RS | RW vs. RZ | RW vs. RJV | RW vs. RJC | |
SVL | 41.4–45.6 | 42.9 ± 1.9 | 44.5–51.4 | 46.9 ± 2.8 | 37.9–45.7 | 42 ± 2.0 | 44.3–47.2 | 45.7 ± 2.1 | 40.7–46.2 | 44.3 ± 1.6 | 0.005 | 0.457 | 0.113 | 0.243 |
HDL | 10.3–14.7 | 12.7 ± 2.2 | 14.1–16.6 | 15.2 ± 1 | 12.4–15.3 | 14.2 ± 0.8 | 14.0–15.6 | 14.8 ± 1.2 | 14.0–16.2 | 15.2 ± 0.7 | 0.052 | 0.001 | 0.125 | 0.001 |
HDW | 12.3–15 | 13.5 ± 1.3 | 14.5–15.2 | 14.9 ± 0.3 | 13.1–15.9 | 14.1 ± 0.7 | 13.3–14.6 | 13.9 ± 0.9 | 13.4–15.9 | 15 ± 0.8 | 0.559 | 0.004 | 0.400 | 0.004 |
SL | 5.7–7.1 | 6.4 ± 0.7 | 6.3–7.2 | 6.6 ± 0.4 | 5.2–6.2 | 5.7 ± 0.2 | 6.3 | 6.3 ± 0.0 | 6.2–7.5 | 7.0 ± 0.4 | 0.207 | 0.016 | 0.148 | 0.109 |
SNT | 2.2–3.2 | 2.8 ± 0.5 | 3.2–3.5 | 3.4 ± 0.1 | 2.4–3.2 | 2.8 ± 0.2 | 3.4–3.8 | 3.6 ± 0.3 | 2.8–3.5 | 3.2 ± 0.3 | 0.021 | 0.296 | 0.003 | 0.014 |
IND | 4.1–5 | 4.6 ± 0.4 | 4.6–5.1 | 4.8 ± 0.2 | 3.4–4.9 | 4.1 ± 0.4 | 3.5–3.9 | 3.7 ± 0.3 | 3.8–4.6 | 4.2 ± 0.3 | 0.509 | 0.033 | 0.000 | 0.003 |
IOD | 3.5–4.1 | 3.8 ± 0.2 | 3.4–4.2 | 3.7 ± 0.3 | 2.6–3.7 | 3.2 ± 0.3 | 4.3–4.9 | 4.6 ± 0.4 | 3.5–4.3 | 3.9 ± 0.3 | 0.045 | 0.002 | 0.159 | 0.654 |
UEW | 2.5–2.8 | 2.6 ± 0.1 | 3.3–3.9 | 3.5 ± 0.2 | 2.5–3.6 | 3.1 ± 0.3 | 2.7–2.9 | 2.8 ± 0.1 | 3.2–4.4 | 3.7 ± 0.4 | 0.000 | 0.000 | 0.967 | 0.000 |
ED | 5.0–5.7 | 5.3 ± 0.3 | 4.8–5.6 | 5.2 ± 0.3 | 4.3–5.7 | 5.1 ± 0.4 | 4.5–4.8 | 4.6 ± 0.2 | 4.6–5.5 | 5.1 ± 0.3 | 0.005 | 0.704 | 0.000 | 0.023 |
TYD | 3.7–4.5 | 3.9 ± 0.4 | 3.4–4.4 | 3.8 ± 0.4 | 2.9–3.6 | 3.2 ± 0.2 | 3.2–4.3 | 3.7 ± 0.7 | 3.3–4.3 | 3.8 ± 0.4 | 0.009 | 0.000 | 0.061 | 0.124 |
LAL | 8.9–20.7 | 14.8 ± 6.6 | 9.7–10.8 | 10.3 ± 0.5 | 8.6–10.6 | 9.6 ± 0.5 | 20.4–22.6 | 21.5 ± 1.5 | 18.6–22.6 | 20.8 ± 1.3 | 0.000 | 0.000 | 0.002 | 0.000 |
HAL | 11.4–11.8 | 11.5 ± 0.2 | 10.5–12.6 | 11.6 ± 0.8 | 10.0–12.4 | 11.0 ± 0.6 | 11.3–12.2 | 11.7 ± 0.6 | 10.4–14.5 | 12.1 ± 1.2 | 0.044 | 0.503 | 0.396 | 0.724 |
LW | 3.5–4.4 | 3.9 ± 0.4 | 5.1–5.7 | 5.4 ± 0.2 | 3.6–5.4 | 4.4 ± 0.4 | 4.4–5.0 | 4.7 ± 0.4 | 4.7–6.1 | 5.4 ± 0.4 | 0.000 | 0.000 | 0.016 | 0.000 |
FIL | 4.6–5.3 | 5.0 ± 0.3 | 5.0–6.1 | 5.4 ± 0.4 | 4.4–5.9 | 5.1 ± 0.4 | 5.1–6.6 | 5.8 ± 1.0 | 3.9–5.3 | 4.6 ± 0.5 | 0.835 | 0.485 | 0.259 | 0.020 |
FIIL | 4.0–4.3 | 4.2 ± 0.1 | 4.2–4.7 | 4.4 ± 0.3 | 3.0–5.0 | 4.1 ± 0.4 | 4.8–5.2 | 5.0 ± 0.2 | 3.7–5.1 | 4.3 ± 0.4 | 0.645 | 0.921 | 0.176 | 0.823 |
FIIIL | 6.8–7.5 | 7.1 ± 0.3 | 7.3–8.8 | 8.1 ± 0.6 | 6.4–8.2 | 7.3 ± 0.4 | 7.7–8.1 | 7.9 ± 0.3 | 6.0–7.8 | 6.8 ± 0.5 | 0.448 | 0.231 | 0.548 | 0.021 |
FIVL | 4.6–4.7 | 4.6 ± 0.1 | 4.5–5.6 | 5.2 ± 0.5 | 4.0–4.9 | 4.4 ± 0.3 | 4.8–5.7 | 5.2 ± 0.6 | 4.2–5.4 | 4.6 ± 0.4 | 0.741 | 0.470 | 0.436 | 0.399 |
THL | 23.2–26.6 | 24.8 ± 1.5 | 23–26.8 | 24.6 ± 1.5 | 19.9–26.0 | 22.9 ± 1.2 | 24–27.3 | 25.3 ± 1.4 | 23–27.3 | 25.3 ± 1.4 | 0.001 | 0.011 | 0.884 | 0.649 |
TL | 26.4–29.3 | 27.8 ± 1.2 | 27.1–30.1 | 28.5 ± 1.3 | 23.4–27.7 | 25.4 ± 1.0 | 26.9–31.2 | 29.1 ± 3.1 | 26.6–30.9 | 28.7 ± 1.5 | 0.015 | 0.002 | 0.518 | 0.928 |
TW | 4.3–4.5 | 4.4 ± 0.1 | 5.5–6.9 | 6.3 ± 0.5 | 4.5–5.9 | 5.1 ± 0.4 | 4.9 | 4.9 ± 0.0 | 4.5–6.2 | 5.3 ± 0.6 | 0.000 | 0.000 | 0.398 | 0.001 |
TFL | 34.8–38 | 36.7 ± 1.4 | 35.2–39.5 | 37.9 ± 1.9 | 31–37.7 | 35 ± 1.6 | 36.0–40.4 | 38.2 ± 3.1 | 33.9–40 | 36.4 ± 2.1 | 0.035 | 0.202 | 0.440 | 0.083 |
FL | 24.1–26.4 | 25.4 ± 1 | 24.1–27.1 | 25.8 ± 1.4 | 21.2–25.7 | 23.7 ± 1.1 | 24.7–27.5 | 26.1 ± 2.0 | 23.4–27 | 25.2 ± 1.4 | 0.013 | 0.045 | 0.309 | 0.117 |
Box-plot showing the difference on the number of transverse skin ridges on the dorsal surface of thighs and tibias between different species. Specimens of different species: the holotype
On morphometric characters, the results of One-way ANOVA showed that in male, the undescribed species was significantly different from R. sangzhiensis on SVL, HDL, SNT, IOD, UEW, ED, TYD, LAL, HAL, LW, THL, TL, TW, TFL, and FL (all p-values < 0.05), significantly different from R. zhengi on HDL, HDW, SL, IND, IOD, UEW, TYD, LAL, LW, THL, TL, TW, and FL (all p-values < 0.05), significantly different from R. johnsi from Vietnam on SVL, SNT, IND, ED, TYD, and LAL (all p-values < 0.05), and significantly different from R. johnsi from Guangxi, China on HDL, HDW, SNT, IND, UEW, ED, LAL, LW, FIL, FIIIL, and TW (all p-values < 0.05; Table
In total, molecular phylogenetic analyses and morphological comparisons indicated that our specimens from Wuyi Mountain, Fujian Province, China should be classified into the R. johnsi group, and are significantly divergent from its closely related species. The specimens should represent a new species which is described as following section.
Holotype
(Figs
Six tadpoles collected from the same place as holotype (Table
Rana wuyiensis sp. nov. is distinguished by a combination of the following morphological characters: body size medium, SVL 41.4–45.6 mm (42.9 ± 1.9 mm, n = 4) in adult males, and 47.6–50.3 mm (n = 2) in adult females; lateroventral grooves present on tip of toes; transverse skin ridges distinctly present on the dorsal surface of thighs and tibias, the number large (mean 26.5 ± 2.7, range 22–29, n = 6); adult male with a pair of internal subgular vocal sacs; webbing on fourth toes reaching the tip of toe; breeding males possess creamy white nuptial pad with tiny hoar velvety spines on the dorsal surface of the first finger, divided into three parts.
The specific name wuyiensis is in reference to the type locality, Wuyi Mountain, Fujian Province, China.
Wuyi Brown Frog (in English), Wuyi Lin Wa (in Chinese; 武夷林蛙).
(Figs
Forearms moderate, width 0.09 ratio of SVL; hand 0.27 ratio of SVL; fingers elongated, with narrow lateral fringes, rudimentary webbed, webbing formula I 3⅔ – 2⅔ II 2½ – 3½ III 3½– 3 IV; tips of fingers rounded, not swollen, without lateroventral groove; finger II distinctly shorter than I, relative finger lengths II < I < IV < III; subarticular tubercles prominent, rounded; supernumerary tubercles indistinct, oval, present on bases of all fingers; inner metacarpal tubercle distinct, near oval, positioned near inner surface of base of finger I, inner side partially covered with nuptial pad; two outer metacarpal tubercles partially separated near the joint of metacarpals of fingers III and IV, the inner oval and larger, the outer elongated and smaller; nuptial pad present on inner and dorsal surface of finger I, covered with velvety spines, partially divided into three parts, the basal part on inner side of inner metacarpal tubercle, the middle part largest, on third phalanx, the distal part smallest, on first and second phalanxes.
Hindlimbs long, tibia 0.64 ratio of SVL and length of foot and tarsus 0.84 ratio of SVL; thigh shorter than tibia, heels overlap when hindlimbs flexed at right angles to axis of body; tibio-tarsal articulation reaching far beyond snout when hindlimb stretched forward along body; toes entirely webbed, inner edge of toe I and outer edge of toe V with narrow lateral fringe, relative toe lengths I < II < III < V < IV, toes webbing formula: 1⅓ – 2 II 1⅓ – 2⅓ III 1½ – 2⅔ IV 3 – 1⅓ V; tip of toes somewhat flat, lateroventral grooves present on all tip of toes and disconnected at middle of front edge; subarticular tubercles prominent and oval; supernumerary tubercles absent; inner metatarsal tubercle oval and prominent, outer metatarsal tubercle rounded, indistinct.
Dorsal skin smooth, supratympanic fold absent; dorsolateral folds distinct, narrow, extending from edge of upper eyelid to hip, not curve above tympanum. Ventral skin smooth, skins around cloaca with numerous flat tubercles. Skin on hindlimbs with transvers paralleled ridges, eight on both thighs, six and seven on left and right tibias, four and two on left and right tarsal. Tarsal fold present.
(Fig.
(Fig.
Breeding males with nuptial pad on dorsal surface of finger I, covered with velvety spines, divided into three parts. Male with a pair of internal subgular vocal sacs.
For measurements of type series specimens see Tables
Currently, Rana wuyiensis sp. nov. is known from Wuyishan National Park, Wuyishan City, Fujian Province, China. In our surveys from 2017 to 2021, the species was found only at one site. All individuals of the new species used in this work were collected from a stream and nearby grassland under the evergreen broad-leaf forest (Fig.
Our results based on mitochondrial DNA and nuclear DNA of several populations of R. zhengi and R. sangzhiensis indicated that the two groups have very low genetic divergence. This is identical to the results of previous molecular phylogenetic analyses in
Moreover, the divergence between Rana wuyiensis sp. nov. and its closely related species in the R. johnsi group is likely corresponding to their separated distributional ranges (Fig.
However, to date, Rana wuyiensis sp. nov. was found only at one site in Wuyi Mountain, and it probably has a low population size according to our eleven-times surveys which included forty sites every time in April, June, and August from 2018 to 2021. Although this site is in the central part of the Wuyishan National Park, the breeding habitat is vulnerable due to local human activities especially tea plantation (Fig.
We thank the editor and reviewers for their helpful suggestions on our work. This work was supported by Project of Biological Resources Survey in Wuyishan National Park. We thank Zhonghao Luo, Binqing Zhu, and Ningning Lu for their help with field work.
Table S1
Data type: morphological measurements of adults
Explanation note: Measurements of adult specimens of Rana wuyiensis sp. nov. and its closely related species. Units given in mm. See abbreviations for the morphological characters in Materials and methods section.