Corrigenda
Print
Corrigenda
Corrigenda: Three new and one little-known species of Hypogastruridae (Collembola) from Russia’s northeast. ZooKeys 1005: 1–20. https://doi.org/10.3897/zookeys.1005.54882
expand article infoAnatoly Babenko, Boris Efeykin§, Mikhail Bizin
‡ Severtsov Institute of Ecology & Evolution, Russian Academy of Sciences, Moscow, Russia
§ Kharkevich Institute for Information Transmission Problems, Russian Academy of Sciences, Moscow, Russia
Open Access

After our recent publication (Babenko et al. 2020), Dr. Cyrille A. D’Haese, of the Muséum national d’Histoire naturelle, Paris, France, called our attention to the errors contained in Table 1 (column: COI sequence number). We would like to take this opportunity to sincerely thank him and correct the following errors:

Table 1.

Species used for molecular study, primers, and GenBank accession numbers of the sequences.

Species Forward primer Reverse primer COI sequence number Sequence size
Hypogastrura variata sp. nov. colfol-for: tttcaacaaatcataargayatygg colfol-rev: taaacttcnggrtgnccaaaaaatca MW518020 647 bp
MW518021
MW518022
Hypogastrura yosii Stach, 1964 colfol-for: tttcaacaaatcataargayatygg colfol-rev: taaacttcnggrtgnccaaaaaatca MW507473 647 bp
MW507474
MW507475
Xenylla arnei sp. nov. LCO1490_t1: tgtaaaacgacggccagtgg tcaacaaatcataaagatattgg HCO2198_t1: caggaaacagctatgactaaacttc agggtgaccaaaaaatca MW517749 658 bp
MW549335
MW549336

Other corrections:

Page 3, Additional material to Hypogastrura variata sp. nov., lines 3–4: Their partial COI genes were… deposited in the GenBank under the sample ID: MW518020MW518022.

Page 8, Material to Hypogastrura yosii Stach, 1964, lines 3–4: Their partial COI genes were… deposited in the GenBank under the sample ID: MW507473MW507475.

Page 13, Additional material to Xenylla arnei sp. nov., lines 2–4: Their partial COI genes were…deposited in the GenBank under the sample ID: MW517749, MW549335MW549336.

Reference