Corrigenda |
Corresponding author: Anatoly Babenko ( lsdc@mail.ru ) Academic editor: Louis Deharveng
© 2021 Anatoly Babenko, Boris Efeykin, Mikhail Bizin.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Babenko A, Efeykin B, Bizin M (2021) Corrigenda: Three new and one little-known species of Hypogastruridae (Collembola) from Russia’s northeast. ZooKeys 1005: 1–20. https://doi.org/10.3897/zookeys.1005.54882. ZooKeys 1028: 161-162. https://doi.org/10.3897/zookeys.1028.65169
|
After our recent publication (
Species used for molecular study, primers, and GenBank accession numbers of the sequences.
Species | Forward primer | Reverse primer | COI sequence number | Sequence size |
---|---|---|---|---|
Hypogastrura variata sp. nov. | colfol-for: tttcaacaaatcataargayatygg | colfol-rev: taaacttcnggrtgnccaaaaaatca | MW518020 | 647 bp |
MW518021 | ||||
MW518022 | ||||
Hypogastrura yosii Stach, 1964 | colfol-for: tttcaacaaatcataargayatygg | colfol-rev: taaacttcnggrtgnccaaaaaatca | MW507473 | 647 bp |
MW507474 | ||||
MW507475 | ||||
Xenylla arnei sp. nov. | LCO1490_t1: tgtaaaacgacggccagtgg tcaacaaatcataaagatattgg | HCO2198_t1: caggaaacagctatgactaaacttc agggtgaccaaaaaatca | MW517749 | 658 bp |
MW549335 | ||||
MW549336 |
Other corrections:
Page 3, Additional material to Hypogastrura variata sp. nov., lines 3–4: Their partial COI genes were… deposited in the GenBank under the sample ID: MW518020– MW518022.
Page 8, Material to Hypogastrura yosii Stach, 1964, lines 3–4: Their partial COI genes were… deposited in the GenBank under the sample ID: MW507473– MW507475.
Page 13, Additional material to Xenylla arnei sp. nov., lines 2–4: Their partial COI genes were…deposited in the GenBank under the sample ID: MW517749, MW549335–MW549336.