Research Article |
Corresponding author: David H. Kavanaugh ( dkavanaugh@calacademy.org ) Academic editor: Thorsten Assmann
© 2021 David H. Kavanaugh, David R. Maddison, W. Brian Simison, Sean D. Schoville, Joachim Schmidt, Arnaud Faille, Wendy Moore, James M. Pflug, Sophie L. Archambeault, Tinya Hoang, Jei-Ying Chen.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Kavanaugh DH, Maddison DR, Simison WB, Schoville SD, Schmidt J, Faille A, Moore W, Pflug JM, Archambeault SL, Hoang T, Chen J-Y (2021) Phylogeny of the supertribe Nebriitae (Coleoptera, Carabidae) based on analyses of DNA sequence data. In: Spence J, Casale A, Assmann T, Liebherr JК, Penev L (Eds) Systematic Zoology and Biodiversity Science: A tribute to Terry Erwin (1940-2020). ZooKeys 1044: 41-152. https://doi.org/10.3897/zookeys.1044.62245
|
The phylogeny of the carabid beetle supertribe Nebriitae is inferred from analyses of DNA sequence data from eight gene fragments including one nuclear ribosomal gene (28S), four nuclear-protein coding genes (CAD, topoisomerase 1, PEPCK, and wingless), and three mitochondrial gene fragments (16S + tRNA-Leu + ND1, COI (“barcode” region) and COI (“Pat/Jer” region)). Our taxon sample included 264 exemplars representing 241 species and subspecies (25% of the known nebriite fauna), 39 of 41 currently accepted genera and subgenera (all except Notiokasis and Archileistobrius), and eight outgroup taxa. Separate maximum likelihood (ML) analyses of individual genes, combined ML analyses of nuclear, nuclear protein-coding, and mitochondrial genes, and combined ML and Bayesian analyses of the eight-gene-fragment matrix resulted in a well-resolved phylogeny of the supertribe, with most nodes in the tree strongly supported. Within Nebriitae, 167 internal nodes of the tree (out of the maximum possible 255) are supported by maximum-likelihood bootstrap values of 90% or more. The tribes Notiophilini, Opisthiini, Pelophilini, and Nebriini are well supported as monophyletic but relationships among these are not well resolved. Nippononebria is a distinct genus more closely related to Leistus than Nebria. Archastes, Oreonebria, Spelaeonebria, and Eurynebria, previously treated as distinct genera by some authors, are all nested within a monophyletic genus Nebria. Within Nebria, four major clades are recognized: (1) the Oreonebria Series, including eight subgenera arrayed in two subgeneric complexes (the Eonebria and Oreonebria Complexes); (2) the Nebriola Series, including only subgenus Nebriola; (3) the Nebria Series, including ten subgenera arrayed in two subgeneric complexes, the Boreonebria and Nebria Complexes, with the latter further subdivided into three subgeneric subcomplexes (the Nebria, Epinebriola, and Eunebria Subcomplexes)); and (4) the Catonebria Series, including seven subgenera arrayed in two subgeneric complexes (the Reductonebria and Catonebria Complexes). A strong concordance of biogeography with the inferred phylogeny is noted and some evident vicariance patterns are highlighted. A revised classification, mainly within the Nebriini, is proposed to reflect the inferred phylogeny. Three genus-group taxa (Nippononebria, Vancouveria and Archastes) are given revised status and seven are recognized as new synonymies (Nebriorites Jeannel, 1941 and Marggia Huber, 2014 = Oreonebria Daniel, 1903; Pseudonebriola Ledoux & Roux, 1989 = Boreonebria Jeannel, 1937; Patrobonebria Bänninger, 1923, Paranebria Jeannel, 1937 and Barbonebriola Huber & Schmidt, 2017 = Epinebriola Daniel & Daniel, 1904; and Asionebria Shilenkov, 1982 = Psilonebria Andrewes, 1923). Six new subgenera are proposed and described for newly recognized clades: Parepinebriola Kavanaugh subgen. nov. (type species: Nebria delicata Huber & Schmidt, 2017), Insulanebria Kavanaugh subgen. nov. (type species: Nebria carbonaria Eschscholtz, 1829), Erwinebria Kavanaugh subgen. nov. (type species Nebria sahlbergii Fischer von Waldheim, 1828), Nivalonebria Kavanaugh subgen. nov. (type species: Nebria paradisi Darlington, 1931), Neaptenonebria Kavanaugh subgen. nov. (type species: Nebria ovipennis LeConte, 1878), and Palaptenonebria Kavanaugh subgen. nov. (type species: Nebria mellyi Gebler, 1847). Future efforts to better understand relationships within the supertribe should aim to expand the taxon sampling of DNA sequence data, particularly within subgenera Leistus and Evanoleistus of genus Leistus and the Nebria Complex of genus Nebria.
DNA, evolutionary tree, ground beetles, molecular phylogenetics, nomenclature, systematics, taxonomy
The carabid beetle supertribe Nebriitae is a moderately diverse group comprised of small to medium-sized beetles, varied in form (see Figs
Among these, Notiokasiini is the least diverse, represented by a single known species (Fig.
Habitus images of Nebriitae A Notiokasis chaudoiri Kavanaugh & Nègre B Pelophila borealis (Paykull) C Opisthius richardsoni Kirby D Paropisthius indicus chinensis Bousquet & Smetana E Notiophilus palustris Duftschmid F Archileistobrius hwangtienyuni Shilenkov & Kryzhanovskij. Scale bars: 1.0 mm. Photograph credits: A, C David Maddison; B, E Kiril Makarov; D, F Alexander Anischenko.
Pelophilini includes only two described species, both in genus Pelophila Dejean, 1821 (Fig.
Opisthiini is comprised of six described species-group taxa, with one species in the Nearctic genus Opisthius Kirby, 1837 (Fig.
Notiophilini includes ca. 60 described species and six additional subspecies, all in genus Notiophilus Duméril, 1806 (Fig.
Nebriini is the most diverse tribe of the supertribe with ca. 1,000 described species and subspecies, and additional new species are discovered, mainly in Asia, almost every year. The tribe is Holarctic in distribution, with more than 90% of the described species-group taxa and most of the genus-group taxa found in the Palearctic Region. The number of extant genera currently recognized as distinct ranges from four to seven, depending on the authors. At present, the widely accepted genera include Leistus Frölich, 1799, Nebria Latreille, 1802, Archastes Jedlička, 1935, and Archileistobrius Shilenkov & Kryzhanovskij, 1983.
Archileistobrius (Fig.
Genus Leistus (Fig.
Archastes (Fig.
Habitus images of Nebriini A Leistus (Nebrileistus) nubivagus Wollaston B L. (Leistus) ferruginosus Mannerheim C Archastes solitarius (Ledoux & Roux) D Nippononebria (Vancouveria) virescens (Horn) E Nebria (Oreonebria) castanea Bonelli F N. (Eurynebria) complanata (Linnaeus). Scale bars: 1.0 mm. Photograph credits: A, D–F David Maddison; B, C Alexander Anischenko.
Nebria (Figs
Genus-group names in supertribe Nebriitae. All published genus-group names are represented in this list in order of publication and include author, year of publication, type species and current taxonomic status (
Genus group name | Type species | Current status | Type | Div | Rep | % Rep | Proposed status | Result |
---|---|---|---|---|---|---|---|---|
Leistus Frölich, 1799 | Leistus testaceus Frölich = Carabus ferrugineus Linnaeus | valid genus and subgenus | Y | 52 | 11 | 21 | valid genus and subgenus | |
Pogonophorus Latreille, 1802 | Carabus spinibarbis Fabricius | valid subgenus of Leistus | N | 60 | 3 | 5 | valid subgenus of Leistus | |
Nebria Latreille, 1802 | Carabus brevicollis Fabricius | valid genus and subgenus | Y | 109 | 6 | 6 | valid genus and subgenus | |
Manticora Panzer, 1803 | Manticora pallipes Panzer = Leistus spinibarbis Fabricius | junior homonym of Manticora |
N | – | – | – | junior homonym of Manticora |
|
Notiophilus Duméril, 1805 | Cicindela aquatica Linnaeus | valid genus | N | 66 | 4 | 6 | valid genus | |
Alpaeus Bonelli, 1810 | Carabus hellwigii Panzer | subjective junior synonym of Nebria s. str. | N | – | – | – | subjective junior synonym of Nebria s. str. | |
Pelophila Dejean, 1821 | Carabus borealis Paykull | valid genus | Y | 2 | 2 | 100 | valid genus | |
Helobia Stephens, 1828 | Carabus brevicollis Fabricius | objective junior synonym of Nebria s. str. | Y | – | – | – | objective junior synonym of Nebria s. str. | |
Eonebria Semenov & Znojko, 1828 | Nebria komarovi Semenov & Znojko | valid subgenus of Nebria | Y | 77 | 6 | 7 | valid subgenus of Nebria | |
Opisthius Kirby, 1837 | Opisthius richardsoni Kirby | valid genus | Y | 1 | 1 | 100 | valid genus | |
Harpazobia Gistel, 1856 | Carabus brevicollis Fabricius | objective junior synonym of Nebria s. str. | Y | – | – | – | objective junior synonym of Nebria s. str. | |
Eurynebria Ganglbauer, 1891 | Carabus complanatus Linnaeus | valid subgenus of Nebria | Y | 1 | 1 | 100 | valid subgenus of Nebria | |
Leistidius Daniel, 1903 | Leistus piceus Frölich | subjective junior synonym of Leistus s. str. | N | – | – | – | subjective junior synonym of Leistus s. str. | |
Oreonebria Daniel, 1903 | Alpaeus castaneus Bonelli | valid subgenus of Nebria | Y | 26 | 9 | 35 | valid subgenus of Nebria | |
Oreobius Daniel, 1903 | Leistus gracilis Fuss | subjective junior synonym of Pogonophorus | N | – | – | – | subjective junior synonym of Pogonophorus | |
Nebriola Daniel, 1903 | Nebria laticollis Dejean | valid subgenus of Nebria | Y | 19 | 2 | 11 | valid subgenus of Nebria | |
Epinebriola Daniel & Daniel, 1904 | Nebria oxyptera Daniel & Daniel | valid subgenus of Nebria | Y | 28 | 6 | 21 | valid subgenus of Nebria | |
Chaetoleistus Semenov,1904 | Leistus relictus Semenov | subjective junior synonym of Pogonophorus | N | – | – | – | subjective junior synonym of Pogonophorus | |
Acroleistus Reitter, 1905 | Leistus denticollis Reitter | subjective junior synonym of Leistus s. str. | N | – | – | – | subjective junior synonym of Leistus s. str. | |
Euleistulus Reitter, 1905 | Leistus ellipticus Reitter = Leistus fulvus Chaudoir | subjective junior synonym of Leistus s. str. | Y | – | – | – | subjective junior synonym of Leistus s. str. | |
Leistophorus Reitter, 1905 | Leistus fulvibarbis Dejean | subjective junior synonym of Leistus s. str. | Y | – | – | – | subjective junior synonym of Leistus s. str. | |
Spelaeonebria Peyerimhoff, 1911 | Spelaeonebria nudicollis Peyerimhoff | valid subgenus of Nebria | Y | 2 | 1 | 50 | valid subgenus of Nebria | |
Eurinoleistus Breit, 1914 | Leistus depressus Breit | subjective junior synonym of Pogonophorus | N | – | – | – | subjective junior synonym of Pogonophorus | |
Paropisthius Casey, 1920 | Opisthius indicus Chaudoir | valid genus | Y | 5 | 4 | 80 | valid genus | |
Patrobonebria Bänninger, 1923 | Nebria desgodinsi Oberthür | valid subgenus of Nebria | Y | 11 | 4 | 36 | subjective junior synonym of Epinebriola | New Synonymy |
Psilonebria Andrewes, 1923 | Nebria superna Andrewes | valid subgenus of Nebria | Y | 4 | 2 | 50 | valid subgenus of Nebria | |
Nebrileistus Bänninger, 1925 | Leistus ellipticus Wollaston | valid subgenus of Leistus | N | 2 | 1 | 50 | valid subgenus of Leistus | |
Archastes Jedlička, 1935 | Archastes sterbai Jedlička | valid genus | N | 42 | 1 | 2 | valid subgenus of Nebria | New Status |
Boreonebria Jeannel, 1937 | Carabus rufescens Ström = Carabus gyllenhali Schönherr | valid subgenus of Nebria | Y | 42 | 19 | 45 | valid subgenus of Nebria | |
Eunebria Jeannel, 1937 | Carabus psammodes Rossi | valid subgenus of Nebria | Y | 54 | 15 | 28 | valid subgenus of Nebria | |
Paranebria Jeannel, 1937 | Carabus lividus Linnaeus | valid subgenus of Nebria | Y | 3 | 2 | 67 | subjective junior synonym of Epinebriola | New Synonymy |
Neonebria Hatch, 1939 | none designated | nomen nudum | – | – | – | – | nomen nudum | |
Nebriorites Jeannel, 1941 | Alpaeus gagates Bonelli | valid subgenus of Nebria | Y | 2 | 1 | 50 | valid subgenus of Nebria | |
Alpaeonebria Csiki, 1946 | Nebria fuscipes Fuss | valid subgenus of Nebria | N | 32 | 1 | 3 | subjective junior synonym of Nebria s. str. | New Synonymy |
Nippononebria Uéno, 1955 | Nebria pusilla Uéno | valid subgenus of Nebria | N | 7 | 2 | 29 | valid genus and subgenus | New Status |
Agonoamara Jedlička, 1962 | Agonoamara chujoi Jedlička = Nebria chalceola Bates | subjective junior synonym of Nippononebria | Y | – | – | – | subjective junior synonym of Nippononebria s. str. | |
Evanoleistus Jedlička, 1965 | Leistus nepalensis Jedlička | valid subgenus of Leistus | N | 154 | 9 | 5 | valid subgenus of Leistus | |
Neoleistus Erwin, 1970 | Leistus ferruginosus Mannerheim | valid subgenus of Leistus | Y | 3 | 3 | 100 | subjective junior synonym of Leistus s. str. | New Synonymy |
Germaria Jeanne, 1972 | Nebria bremii Germar | junior homonym of Germaria Robineau-Desvoidy, 1830 | Y | – | – | – | junior homonym of Germaria Robineau-Desvoidy, 1830 | |
Catonebria Shilenkov, 1975 | Carabus nitidulus Fabricius = Nebria banksii Crotch | valid subgenus of Nebria | Y | 42 | 39 | 93 | valid subgenus of Nebria | |
Orientonebria Shilenkov, 1975 | Nebria coreica Solsky | valid subgenus of Nebria | Y | 1 | 1 | 100 | valid subgenus of Nebria | |
Reductonebria Shilenkov, 1975 | Nebria ochotica Sahlberg | valid subgenus of Nebria | Y | 17 | 15 | 83 | valid subgenus of Nebria | |
Sardoleistus Perrault, 1980 | Leistus sardous Baudi di Selve | valid subgenus of Leistus | Y | 1 | 1 | 100 | valid subgenus of Leistus | |
Tetungonebria Shilenkov, 1982 | Nebria tetungi Shilenkov | subjective junior synonym of Eunebria | N | – | – | – | incertae sedis | |
Asionebria Shilenkov, 1982 | Nebria roborowskii Semenov | valid subgenus of Nebria | Y | 9 | 3 | 33 | subjective junior synonym of Psilonebria | New Synonymy |
Notiokasis Kavanaugh & Nègre, 1983 | Notiokasis chaudoiri Kavanaugh & Nčgre | valid genus | N | 1 | 0 | 0 | valid genus | |
Archileistobrius Shilenkov & Kryzhanovskij, 1983 | Archileistobrius hwangtienyuni Shilenkov & Kryzhanovskij | valid genus | N | 1 | 0 | 0 | incertae sedis | |
Germarina Jeanne, 1985 | Nebria bremii Germar | junior homonym of Germarina Mesnil 1963 | Y | – | – | – | junior homonym of Germarina Mesnil 1963 | |
Himalayonebria Ledoux, 1985 | Nebria nouristanensis Ledoux | subjective junior synonym of Epinebriola | N | – | – | – | incertae sedis | |
Pseudonebriola Ledoux & Roux, 1989 | Nebria saurica Shilenkov | valid subgenus of Nebria | N | 18 | 7 | 39 | subjective junior synonym of Boreonebria | New Synonymy |
Latviaphilus Barsevskis, 1994 | Elaphrus biguttatus Fabricius | subjective junior synonym of Notiophilus | N | – | – | – | subjective junior synonym of Notiophilus | |
Makarovius Barsevskis, 1994 | Notiophilus rufipes Curtis | subjective junior synonym of Notiophilus | N | – | – | – | subjective junior synonym of Notiophilus | |
Sphodronebria Sciaky & Pavesi, 1994 | Nebria paradoxa Sciaky & Pavesi = Nebria tetungi Shilenkov | objective junior synonym of Tetungonebria | N | – | – | – | objective junior synonym of Tetungonebria | |
Vancouveria Kavanaugh, 1995 | Nebria virescens Horn | valid subgenus of Nebria | Y | 3 | 3 | 100 | valid subgenus of Nippononebria | |
Ledouxnebria Deuve, 1998 | Ledouxnebria brisaci Deuve | valid genus (fossil only) | – | 1 | – | – | valid genus (fossil only) | |
Epispadias Ledoux & Roux, 1999 | Nebria janschneideri Ledoux & Roux | valid subgenus of Nebria | N | 2 | 1 | 50 | valid subgenus of Nebria | |
Falcinebria Ledoux & Roux, 2005 | Nebria reflexa Bates | valid subgenus of Nebria | Y | 16 | 2 | 13 | valid subgenus of Nebria | |
Nakanebria Ledoux & Roux, 2005 | Nebria kurosawai Nakane | valid subgenus of Nebria | N | 6 | 1 | 17 | valid subgenus of Nebria | |
Sadonebria Ledoux & Roux, 2005 | Nebria sadona Bates | valid subgenus of Nebria | N | 17 | 4 | 24 | valid subgenus of Nebria | |
Tyrrhenia Ledoux & Roux, 2005 | Carabus rubicundus Quesnel | valid subgenus of Nebria | Y | 18 | 2 | 11 | valid subgenus of Nebria | |
Marggia Huber, 2014 | Nebria bremii Germar | valid subgenus of Nebria | Y | 2 | 1 | 50 | subjective junior synonym of Oreonebria | New Synonymy |
Barbonebriola Huber & Schmidt, 2017 | Nebria barbata Andrewes | valid subgenus of Nebria | N | 6 | 1 | 17 | subjective junior synonym of Epinebriola | New Synonymy |
Archaeonebria Kavanaugh & Schmidt, 2019 | Archaeonebria inexspectata Schmidt & Kavanaugh | valid genus (fossil only) | – | 1 | – | – | valid genus (fossil only) | |
Parepinebriola subgen. nov. | Nebria delicata Huber & Schmidt | part of Epinebriola Daniel | Y | 5 | 5 | ? | new subgenus | New Subgenus |
Insulanebria subgen nov. | Nebria snowi Bates | part of Reductonebria Shilenkov | Y | 2 | 2 | 100 | new subgenus | New Subgenus |
Erwinebria subgen. nov. | Nebria sahlbergii Fisher von Waldheim | part of Reductonebria Shilenkov | Y | 21 | 20 | 95 | new subgenus | New Subgenus |
Nivalonebria subgen. nov. | Nebria paradisi Darlington | part of Nakanebria Ledoux & Roux | Y | 2 | 2 | 100 | new subgenus | New Subgenus |
Neaptenonebria subgen. nov. | Nebria ovipennis LeConte | part of Catonebria Shilenkov | Y | 6 | 6 | 100 | new subgenus | New Subgenus |
Palaptenonebria subgen. nov. | Nebria mellyi Gebler | part of Catonebria Shilenkov | Y | 14 | 11 | 79 | new subgenus | New Subgenus |
Habitus images of Nebria A N. (Eonebria) djakonovi Semenov & Znojko B N. (Orientonebria) coreica Solsky C N. (Spelaeonebria) nudicollis Peyerimhoff D N. (Psilonebria) superna Andrewes E N. (Reductonebria) ochotica Sahlberg F N. (Catonebria) banksii Crotch. Scale bars: 1.0 mm. Photograph credits: A, B, F Kiril Makarov; C, D David Maddison; E Alexander Anischenko.
Two additional nebriine genera have been described from fossil remains. Ledouxnebria
The taxonomic history of nebriite carabids began with Linnaeus, who, in the Tenth Edition of his Systema Naturae (
As the number of described species increased rapidly in the 19th and 20th centuries and it became clear that groups of more or less similar species could be recognized, the description of nebriite genera and subgenera began, first through extracting species from genus Carabus of Linnaeus and then adding new genus-group taxa to accommodate species unknown to Linnaeus as needed. The first of these described was genus Leistus Frölich, 1799, followed by Nebria Latreille, 1802 and Notiophilus Duméril, 1805, and each of these included Linnaean species. Subsequently, Pelophila Dejean, 1821, Opisthius Kirby, 1837, Eurynebria Ganglbauer, 1891b, Paropisthius Casey, 1920, Archastes Jedlička, 1935, Nippononebria Uéno, 1955, Notiokasis Kavanaugh & Nègre, 1983, and Archileistobrius Shilenkov & Kryzhanovskij, 1983 were described. For three of these genera, one or more additional subgenera have been proposed.
The suprageneric classification of nebriites has been relatively stable during the last century and a half compared with that of many other carabid groups, although the ranking and inclusiveness of various taxa has changed somewhat through time. The post-Linnaean era of carabid classification, which
Few studies have explored phylogenetic relationships among the nebriite taxa through formal analyses and most of them have used morphological data.
Until now, the use of molecular data for phylogenetic studies of nebriites has been very limited.
Working with insights gained from phylogenetic studies based on morphological data gathered during the past 50 years and guided by
In total, 264 exemplar specimens were used in this study. These included representatives of 241 different nebriite species-group taxa plus 14 replicates and eight outgroup taxa plus one replicate (Table
Sampling of Nebriitae and outgroup species. The ID column indicates how each voucher specimen was identified. A number indicates that the specimen was identified by the lead author (DK) using the corresponding numbered references as follows: (1)
All but nine of the specimens used in this study were collected directly into 95–100% ethanol, which was subsequently replaced with fresh ethanol at least once. Six specimens were collected directly into silica gel and allowed to fully desiccate. All specimens were stored as soon as possible in a freezer at -20 °C awaiting DNA extraction. The remaining three specimens were pinned museum specimens killed by unknown means. Depositories for all voucher specimens are listed in Appendix
Nearctic Nebria and Nippononebria specimens were identified by DHK, based on his revision (
DNA was extracted from specimens preserved in ethanol or desiccated in silica gel using Qiagen DNeasy (Qiagen) Blood & Tissue kits and the manufacturer’s recommended protocol. The first 25 extractions (in 2004) were made using thoracic muscle tissue; but all subsequent extractions were made from one or more legs, depending on the size of the specimen. The eight gene fragments used in this study and their abbreviations are: 28S: ca. 955 bases of the nuclear ribosomal DNA subunit 28S (D1–D3 regions); 16S-ND1: ca. 812 bases of the mitochondrial gene fragment including 16S ribosomal RNA gene (partial sequence), tRNA-leucine gene (complete sequence), and NADH dehydrogenase subunit 1 (ND1) (partial sequence); COI BC: 658 bases of the “barcode” region of mitochondrial protein-coding cytochrome c oxidase subunit I; COI PJ: 829 bases of the ”Pat/Jer” region of mitochondrial protein-coding cytochrome c oxidase subunit I (no overlap with COI BC); CAD2: 804 bases of the nuclear protein-coding carbamoyl-phosphate synthetase domain of the “rudimentary” gene, corresponding to region 2 of
Gene fragments were amplified successfully using polymerase chain reaction (PCR) on several different thermal cyclers, including an Eppendorf Mastercycler 5333, an MJ Research PTC-100 Thermal Cycler, or a BioRad MyCycler Thermal Cycler, and using different Taq polymerases, including Eppendorf Hotmaster Taq, Invitrogen Taq, or TaKaRa Ex Taq, each with the basic protocols recommended by the manufacturer. Cycling conditions and primers used in this study are presented in Appendix
Multiple chromatograms for each gene fragment were assembled using SEQUENCHER (several versions, concluding with v 5.2.2) (Gene Codes Corporation) or PHRED (
Three of the specimens from which DNA was extracted were pinned specimens whose killing and preservation history was unknown: Nebria coreica DRM4721, Nebria komarovi DRM5171, and Nebria oxyptera DRM5172. We prepared specimens following
The extracted DNA was quantified using a Qubit Fluorometer (Life Technologies) with a Quant-iT dsDNA HS Assay Kit. The fragment length distribution was measured using a 2100 Bioanalyzer (Agilent Technologies) using the High Sensitivity DNA Analysis Kit and 1 μl of sample. The DNA of Nebria oxyptera was treated with NEBNext FFPE DNA Repair Mix (New England BioLabs) to repair damaged bases prior to library preparation. Libraries were prepared using NEBNext DNA Ultra II (New England BioLabs) kits and dual-indexed using NEBNext Multiplex Oligos for Illumina. Sequencing (150 base paired-end) was performed at the Oregon State University Center for Genome Research and Biocomputing on an Illumina HiSeq 3000. The Nebria libraries were sequenced on two separate lanes with libraries of other carabids (including bembidiines, chlaeniines, oodines, licinines, and scaritines). Nebria coreica DRM4721 was the only Nebriitae on its lane, while Nebria komarovi DRM5171 and Nebria oxyptera DRM5172 were sequenced on the same lane. In the latter case, the two Nebria libraries were given unique multiplex indices to minimize the possibility of adapter cross-talk.
Demultiplexing was performed using bcl2fastq v2 Conversion Software (Illumina). Paired-end reads were imported into CLC GENOMICS WORKBENCH version 9.5.3 (QIAGEN Aarhus A/S), using default options except for the minimum and maximum paired-read distances, which we determined by analyzing a dilution of the enriched library on a Bioanalyzer 2100 (Agilent Technologies). Failed reads were removed during import. We used the “Trim Sequences” tool in CLC (with default parameters) to remove read ends with low quality, ambiguous base calls, and adapter contamination.
De novo assemblies were generated using CLC GENOMICS WORKBENCH from paired, trimmed reads using an automatic word and bubble size, with the minimum contig length set to 200. The assemblies were converted to local, BLASTable databases using NCBI’s makeblastdb tool, and these databases were queried using the local BLAST tool in MESQUITE. The query sequences were those from Nebria (Boreonebria) gouleti DHK0027, chosen because it is expected to be equally distant from all expected placements for the pinned specimens that were sequenced. For each BLAST conducted, up to ten top matches from each database with eValues less than 1 E -80 were imported into the matrix in MESQUITE for analysis.
Two reference-based assemblies were conducted for each of the three pinned specimens. The first reference-based assembly for each used sequences of Nebria (Catonebria) piperi DHK0965 for the reference; the second used sequences from Nippononebria virescens DHK0348. Reference based assembly was performed using the “Map Reads to Reference” tool in CLC GENOMICS WORKBENCH. Default settings were used except for the “Length Fraction” and Similarity Fraction” parameters, which were both increased to 0.8 to decrease the possibility of spurious read mappings.
Some contigs produced by de novo and reference-based assemblies were discarded. For the de novo assembly, several samples yielded multiple contigs; in these cases, one of the contigs was much larger than the remainder (e.g., two contigs were returned when 16S-ND1 was BLASTed to the Nebria komarovi de novo assembly, one of 4677 bases, the other of 528 bases). In such cases, the shorter contig always appeared to be a contaminant, with one exception. The apparent contaminants were identical to a non-nebriine that was included in the multiplex pool on the same Illumina lane [e.g., Clivina bipustulata (Fabricius), Chlaenius tomentosus (Say)], suggesting that cross-talk occurred (
In order to judge the consistency of the two or three sequences (de novo assembly, reference-based to Nippononebria, and reference-based to Catonebria) from each pinned specimen, preliminary analyses were conducted on each of the seven genes and on the concatenated data. After model choice with JMODELTEST version 2.1.10 (
The gene fragments containing ribosomal DNA were aligned differently from the protein-coding genes. An alignment of 28S was conducted in MAFFT version 7.130b (Katoh and Standley 2013), using the L-INS-i search option and otherwise default parameter values. Boundaries of 16S, tRNA leu and ND1 were determined by aligning our sequences to the annotated complete mitochondrial genome of Trachypachus inermis (GenBank Accession NC_011329;
The methods used to align the protein-coding genes varied from gene to gene. COI BC, COI PJ, and Topo showed no evident insertion or deletion events in the history of the taxa studied, and so they could easily be aligned by inspection. Variation in wg suggested several insertion or deletion events present in the history of that taxa. This gene was aligned by first translating the sequence to amino acids in MESQUITE, aligning amino acids in MAFFT, and then forcing that amino acid alignment onto the original nucleotide alignment using MESQUITE. CAD2 and PEPCK contained introns, but few other insertions and deletions, so they were most easily aligned by inspection within MESQUITE’s data editors. CAD2 contained one intron present in Trachypachus, as well as one three-base insertion in Metrius; there were no insertions or deletions evident within nebriites. PEPCK contained one variable-length intron present in most nebriites as well as Pterostichus and Scaphinotus. In addition, there were two three-base deletions in two lineages of Nebria.
Site exclusion also varied from gene to gene. For the protein-coding genes, introns were excluded as well as starting region of PEPCK and Topo, as that region was sequenced in only a few taxa. For 28S and 16S-ND1, sites were excluded from consideration using the modified GBLOCKS (
Models of nucleotide evolution for single genes (except for the 16S-ND1 fragment) were chosen with the aid of JMODELTEST. For concatenated analyses and for the 16S-ND1 fragment, PARTITIONFINDER was used to determine the optimal partitioning, using the greedy algorithm and Bayesian Information Criterion (BIC). The beginning partition for the PARTITIONFINDER analysis had each codon position in each protein-coding gene in a separate part, and the components of the 16S-ND1 fragment in separate parts; thus, for the full concatenated matrix, the initial partition had 25 parts (three parts for each of COI BC, COI PJ, CAD2, ND1, PEPCK, Topo, and wg, as well as one part for each of 28S, 16S, tRNA-Leu, and the non-coding section of the 16S-ND1 fragment). For the final, concatenated matrix the “--raxml” option was used in PARTITIONFINDER, as otherwise program failure occurred during optimization.
Maximum likelihood estimates of phylogenetic relationships were reconstructed using RAXML version 8.2.12 (
Bayesian analyses were conducted on the eight-fragment concatenated matrix (8G B) with MRBAYES v 3.2.7 (
Bootstrap support for and against various clades was calculated using MESQUITE’s “Clade Frequencies in Trees” feature and the bootstrap trees produced by RAXML. Alternative trees with specific contradictory nodes were also included among the bootstrap support trees, and support values for or against those specific nodes were calculated by the same method. Bayesian posterior probability (BPP) values for and against clades were calculated in similar fashion, but using the trees produced by the Bayesian sampling.
To find unique molecular synapotypies for clades, MESQUITE’s “With State Distinguishing Selected Taxa” feature was used. In brief, the “Select Taxa in Clade” tool was used in the tree window, and then the “With State Distinguishing Selected Taxa” feature selected all characters with a unique state in the selected taxa. The unique state was then determined by visually examining those characters in the data matrix. Unique amino acids characterizing clades were found using the same procedure after converting each protein-coding gene to the implied amino acids using MESQUITE’s “Translate DNA to Protein” feature. To find unique base insertions and deletions in 28S sequences, the aligned matrix, including well-aligned internal portions of sequences excluded from ML and Bayesian analyses, was examined visually. Unique amino acid insertions and deletions in protein-coding gene sequences were identified by visually examining the matrix for each fragment converted to a protein matrix.
New sequences generated in this study have been deposited in GenBank with accession numbers MW359101 through MW361062. Two files have been deposited in the Dryad Digital Repository, at https://doi.org/10.5061/dryad.6wwpzgmxn: (1) a NEXUS file containing aligned sequence data as well as inferred maximum likelihood trees, and (2) a NEXUS file containing data about PEPCK intron lengths and the ancestral state reconstruction shown in Suppl. material
We were able to acquire sequence data for 97% (2041) of the 2112 possible sequences for the eight gene fragments for our 264 exemplar specimens (see Table
28S | 16S-ND1 | COI PJ | COI BC | CAD | PEPCK | TOPO | wg | totals | |
---|---|---|---|---|---|---|---|---|---|
specimens sampled | 264 | 264 | 264 | 264 | 264 | 264 | 264 | 264 | 2112 |
sequences obtained | 262 | 260 | 264 | 264 | 259 | 228 | 251 | 253 | 2041 |
% success | 99 | 98 | 100 | 100 | 98 | 86 | 95 | 96 | 97 |
The 16S-ND1 sequences for Nebria piute DHK1098 and N. catenata DHK1067 each contain a stop codon in the ND1 gene, providing evidence that those particular sequences might be nuclear copies of the mitochondrial genes (“numts”,
The only gene fragment for which we obtained less than 95% of the possible number was PEPCK; we speculate that failures in this gene may be the result of the variable-length intron within the gene, which may be long enough in some specimens to prevent amplification under the protocols we used. Of the 228 taxa from which we obtained sequences of PEPCK, 208 shared an intron, although the length of the intron varied between 27 and 830 bases. The intron was lacking from all outgroups except for Pterostichus and Scaphinotus; within nebriites it was absent from Notiophilus, Nebria (Parepinebriola), and the Orientonebria-Archastes-Oreonebria clade, but otherwise present. The only large group in which PEPCK was sequenced in all species was the Catonebria Series, a group in which the intron is relatively short.
GTR+I+G was chosen by the BIC for all single-gene analyses. This includes the 16S-ND1 fragment, for which PARTITIONFINDER found that the optimal partition had all sites in one part.
For the concatenated matrices, the best model scheme chosen by PARTITIONFINDER for all parts was GTR+I+G. The optimal partition scheme varied among concatenated matrices. For the eight-gene concatenated matrices (with or without the merging of the pinned specimens’ sequences), third positions of the mitochondrial genes were in one part, and all of the remaining sites in a second part. For the concatenated nuclear protein-coding gene matrix and concatenated nuclear gene matrix, all sites were in one part. For the concatenated mtDNA matrix, all third positions were in one part, with all remaining sites in a second part.
From both ML and Bayesian analyses, we infer a well-resolved tree (Fig.
Support for or against various clades. All columns provide maximum likelihood bootstrap values for or against a particular clade, except for column “8G B,” which shows the Bayesian posterior probability estimates for the eight-gene matrix. “8G ML” shows the bootstrap values for the eight-gene concatenated matrix, “Nuc G” for the concatenated nuclear genes, “NPC G” for the concatenated nuclear protein-coding genes, and “Mito G” for the concatenated mitochondrial genes. The remaining eight columns provide values for the single gene analyses. All values are expressed as percentages, with positive numbers indicating support for a clade and negative numbers indicating support for a contradictory clade having the highest support. Specific contradictory clades from alternative trees are highlighted in medium grey. Cells with bootstrap values ≥ 90 are shown in black, with values between 75 and 89 in dark grey, and values from 50 to 74 in light grey. Cells in white indicate clades present in the ML tree, but with bootstrap values < 50. Cells in red have bootstrap values for a contradictory clade ≥ 50. Cells in pink have bootstrap values for or against a clade < 50, and the clade is not present in the ML tree. A “-“ in a cell indicates that taxon sampling for that gene was not sufficient to assess monophyly of that clade. “#g” shows the number of single-gene analyses (maximum of eight) that support a clade with bootstrap values of 50 or more.
ML trees and majority rule consensus trees of bootstrap trees resulting from analyses of concatenated matrices for Nuc G, NPC G, and Mito G and for each of the single-gene matrices are presented in Suppl. material
Unique bases found to support particular clades are listed in Suppl. material
The intron length of PEPCK varies across the phylogeny, with some clades having small or no introns, and with a few clades with longer introns (Suppl. material
Morphology has provided only weak support for the monophyly of a supertribe Nebriitae because most features that have been used to characterize it are both plesiomorphic within carabids and not unique to this group.
Based on results from analyses of our molecular data, we find very strong evidence for a monophyletic Nebriitae (Fig.
Monophyly of the tribes Notiophilini, Pelophilini, and Opisthiini are well supported morphologically (
In spite of the fact that the diverse Nebriini is not well characterized morphologically, being recognized mainly on the basis of symplesiomorphic features, monophyly of the tribe is strongly supported by our molecular data. Both ML and Bayesian analyses of the eight-gene matrix and ML analyses of the concatenated nuclear gene and nuclear protein-coding gene matrices produced support values of 100 for the tribe (Chart 1, line 11). Nebriini is also strongly supported in analyses for CAD2 and Topo, moderately supported in the wg analysis and weakly supported in the 28S and PEPCK analyses (Chart 1, line 11), as well as by one unique amino acid (Suppl. material
Phylogenetic relationships among the nebriite tribes remain somewhat less clearly defined than their monophyly. Our results show moderate to strong support for a clade including Opisthiini, Pelophilini and Nebriini as sister to Notiophilini (Fig.
Our results do not strongly speak to the treatment of Pelophila as belonging to a separate monogeneric tribe. Pelophila had been included among the Nebriini (see
As noted in the Introduction, there have been differences of opinion among taxonomists concerning the number of distinct genera that should be recognized among the Nebriini as defined here (i.e., excluding Pelophila). Nevertheless, Leistus has been universally accepted as a distinct genus, based on its wonderful suite of mouthpart co-adaptations for small prey capture. Nebria also has been universally regarded as a distinct genus, but its inclusiveness has differed among authors. In the following sections, we discuss how our results provide new evidence to support phylogenetic relationships among Leistus subgenera and species and better determine which groups are part of a monophyletic genus Nebria and which ones are not.
The monophyly of genus Leistus is strongly supported in all of our concatenated and single-gene analyses (see Fig.
We had only one of the two known species of subgenus Nebrileistus Bänninger, 1925 in our sample, so we cannot comment further on its monophyly. In our analyses, Nebrileistus is shown as sister to a clade including the other Leistus subgenera (Figs
Subgenus Sardoleistus Perrault, 1980 is monobasic, as it includes only Leistus sardous Baudi di Selve, 1883. Results from our analyses suggest that this subgenus is sister to a clade including Pogonophorus Latreille, 1802, Evanoleistus Jedlička, 1965 and Leistus s. str. (Fig.
The subgenus Pogonophorus is strongly supported as monophyletic in all concatenated gene analyses and all single-gene analyses except for 28S (Chart 1, line 20). In the tree from the 28S analysis (Suppl. material
A clade including Evanoleistus and Leistus s. str. is strongly supported as monophyletic in all concatenated gene analyses and strongly to moderately supported in all single-gene ML analyses except for PEPCK (Chart 1, line 21). It is also supported by one base unique among nebriites (Suppl. material
Evanoleistus is the most diverse subgenus of Leistus with more than 150 species described. Our sample included only nine species, two of which are undescribed, so our sampling was small (ca. 5%) relative to that diversity and our results must be judged in that light. Nonetheless, the species in our sample form a monophyletic group (Figs
Leistus s. str. currently includes ca. 50 species and our sample represents a little more than 20% of them. Our sample of this subgenus is strongly supported as monophyletic in all concatenated analyses except for the Mito G analysis (Chart 1, line 24), in which it is only weakly supported (MLB = 42). This clade is shown also in ML trees for all but three of the single-gene analyses (COI BC, COI PJ and PEPCK; Suppl. material
Results from our analyses of molecular data provide strong support for a clade including only Nippononebria and Leistus (Chart 1, line 12). Our 8G ML, 8G B, Nuc G, and NPC G concatenated analyses and CAD2 single-gene analyses show strong support for this clade, PEPCK shows moderate support, and Mito G and 16S-ND1 show weak support. Conversely, a clade including only Nippononebria and Nebria (Chart 1, line 13) is unsupported, except weakly so by the 28S single gene analysis (MLB = 41). Monophyly of Nippononebria (including both Nippononebria s. str. and Vancouveria) (Chart 1, line 14) is also strongly supported in all concatenated analyses except Mito G and in 28S, CAD2, PEPCK and wg analyses. Two unique amino acids also support this clade (Suppl. material
Unlike Nippononebria, Archastes (Fig.
All our concatenated analyses, as well as 28S and Topo single-gene analyses, very strongly support a clade including Archastes within Nebria (Chart 1, line 26). Conversely, a Nebria clade excluding Archastes is strongly contra-indicated. This is shown whether Archastes is excluded alone (Chart 1, line 29) or along with the other Nebria subgenera to which our results show close its relationship (see further discussion below and Chart 1, lines 27 and 28). Consequently, we conclude that Archastes does not warrant status as a separate genus, but should be classified within genus Nebria.
Just as for Archastes, our analyses strongly support a monophyletic Nebria including Oreonebria (Chart 1, line 26), and a Nebria clade excluding Oreonebria is strongly contra-indicated. This is shown whether Oreonebria is excluded alone (Chart 1, line 30) or along with the other Nebria subgenera found from our analyses to be closely related (see further discussion below and Chart 1, lines 27). We conclude that Oreonebria does not warrant status as a separate genus and should be classified within genus Nebria.
Eurynebria was described as a new genus by
Once again, our analyses strongly support genus Nebria including Eurynebria as monophyletic (Chart 1, line 26) and a Nebria clade excluding Eurynebria as strongly contra-indicated (see further discussion below and Chart 1, line 31). We conclude that this taxon does not warrant generic status and should be classified within genus Nebria.
As noted above, the evidence for the monophyly of Nebria, including Archastes, Oreonebria, and Eurynebria while excluding Nippononebria and Vancouveria, is strong. All concatenated analyses and the 28S analysis yielded MLB support values ≥ 97 (Chart 1, line 26). The Topo analysis also provides solid support (MLB value = 89) for this clade, and it appears in ML trees from five of the remaining six single-gene analyses (Suppl. material
Results of our analyses of molecular data also support several large clades within Nebria, most including multiple subgenera. Following the system of informal hierarchic ranks between genus and subgenus used by
The first of these is the Oreonebria Series (Fig.
The Oreonebria Series is an endemic Eurasian lineage that includes more than 180 described species-group taxa. This clade occupies a disjunct geographical distribution comprising the Alps mountain system of Europe in the west and central Asia to far eastern Asia, including Japan and Taiwan, in the east. It includes two groups of subgenera, the Eonebria and Oreonebria Complexes (Fig.
The remaining three series of Nebria are strongly supported as a monophyletic group in both 8G ML and 8G B analyses (Fig.
The Nebriola Series, which includes only subgenus Nebriola Daniel, 1903, is a small group comprised of only 19 described species-group taxa. Members of all described species are small and flightless due to atrophied hindwings. Their combined geographical distribution is confined to mountain systems of western Europe, from the Pyrenees Mountains of northern Spain and southern France northeast through the Alps to the Jura Mountains of eastern France and Switzerland and the Black Forest of southern Germany.
The Nebria Series is the most diverse and widespread group in the genus. More than 320 species-group taxa have been described, and the geographical range of the group encompasses most of the Holarctic Region and the northern edge of the Oriental Region in Asia. The group includes two main groups of subgenera, the Boreonebria and Nebria Complexes, and the latter includes three subgeneric subgroups, the Nebria, Epinebriola and Eunebria Subcomplexes (Fig.
The Catonebria Series is a moderately diverse group with 104 described species, representing a majority of Nearctic Nebria species. It has a Holarctic distribution with a geographical range extending from central Asia east to eastern North America. It includes two subgeneric groups, the Reductonebria and Catonebria Complexes (Fig.
Although our results provide evidence that the Nebriola, Nebria, and Catonebria Series together form a clade and that each individually is monophyletic, relationships among them are not yet as clear. Trees from both the 8G ML (Fig.
The group of subgenera that we refer to as the Eonebria Complex (Figs
The most diverse subgenus in this clade is Eonebria (Fig.
Diversity within subgenus Sadonebria has increased from the three species recognized by
One of the most unexpected results of our study was the discovery of the group of five species represented in our sample, including Nebria delicata Huber & Schmidt, 2017 and Nebria retingensis Huber & Schmidt, 2017 and three undescribed species (Figs
The monophyly of a group including Sadonebria and Eonebria as sister to Parepinebriola (Fig.
The Oreonebria Complex of subgenera (Figs
Within the complex, two main groups of subgenera are apparent. The first is a clade including Falcinebria Ledoux & Roux, 2005 and Epispadias Ledoux & Roux, 2005. It is well supported (MBL and BPP values ≥ 96) in all our analyses except for wg (Chart 1, line 39), as well as by three unique amino acids (Suppl. material
The other major group of subgenera in this complex includes Orientonebria Shilenkov, 1975, Archastes and Oreonebria (Fig.
The Boreonebria Complex is comprised of two subgenera, Boreonebria and Nakanebria. This group includes 66 species-group taxa with a combined geographical range that covers most of the Holarctic Region. It differs from
Subgenus Boreonebria includes the 60 remaining species of this complex. Their combined geographical range extends across the Holarctic region, from Greenland and Iceland eastward across Eurasia, Beringia and across North America from Alaska to Ellesmere Island and the Island of Newfoundland. In Eurasia, they range from above the Arctic Circle to southern Europe (but not northern Africa), the Tian Shan, Altai, and Qilian mountain systems of central Asia, northern China, North Korea, and northern Japan. In North America, they range south into the northern Sierra Nevada in California, the southern Rocky Mountains in northern New Mexico, and into the southern Appalachian Mountains of Tennessee and North Carolina.
Within Boreonebria, several well-supported clades can be recognized (Fig.
Our results suggest that sister to the nivalis group is a clade that includes all the species currently assigned to subgenus Pseudonebriola and the remaining Boreonebria species, which we call the gyllenhali group Fig.
Our gyllenhali group of Boreonebria is only partially equivalent to that of
We have not had the opportunity to include in our study several of the species of Boreonebria that Ledoux and Roux included in this group from southern and eastern Europe, China (including Tibet), Kazakhstan, or Afghanistan. However, those authors provided illustrations of the female bursa copulatrix and spermathecal duct and reservoir for several of these, all but one of which appear to have the spermathecal duct inserted ventrally or apicoventrally on the bursa. The lone exception is Nebria klapperichi Bänninger, 1956, which appears to have the duct inserted mid-dorsally on the bursa (
The group of taxa that we recognize as the Nebria Complex (Fig.
This group of subgenera is equivalent to the “Nebrides” of
Tyrrhenia includes 18 species-group taxa with a combined geographical range extending from Portugal and Morocco across southern Europe and northern Africa to southeastern Turkey. Although we had only two species of this subgenus represented in our sample, they form a well- supported clade in all our analyses (Chart 1, line 66). Two base insertions and two deletions in 28S are unique to the clade (Suppl. material
Spelaeonebria includes a single species, Nebria nudicollis Peyerimhoff, 1911, restricted to the Djurdjura Mountains of northern Algeria, where these large and elegant beetles (3C) live in limestone caves at high elevation. Alpaeonebria, as currently comprised, includes 33 species-group taxa arrayed in nine species groups (
The number of taxa represented in our sample for this group is low in relation to its high diversity. While this prevents us from drawing firm conclusions about relationships within it, our results allow us to clarify a few issues. First, our representatives of both Alpaeonebria (Nebria germarii Heer, 1837) and Spelaeonebria (N. nudicollis) are nested within a Nebria clade in ML trees from all concatenated and single-gene analyses except for Topo (Suppl. material
This group is comprised of 46 described species-group taxa currently arrayed among four subgenera: Epinebriola, Barbonebriola Huber & Schmidt, 2017, Patrobonebria Bänninger, 1923 and Paranebria Jeannel, 1937.
Our analyses of relationships within this clade have produced some unexpected findings. As already noted above, two described species (N. delicata and N. retingensis) previously included in Epinebriola have been shown instead to be part of the Eonebria Complex. A clade including them with members of the Epinebriola Subcomplex is contra-indicated by all of our results (Chart 1, line 73). Patrobonebria is well supported as a clade in all of our analyses (Chart 1, line 79) and Paranebria is supported as monophyletic (Chart 1, line 78) in all trees except the 28S ML tree (Suppl. material
We only had access to a very old pinned specimen of Nebria oxyptera Daniel & Daniel, 1904, the type species of Epinebriola, for DNA extraction. This may explain why we were unable to obtain sequence data from it for any of the nuclear protein-coding genes. Consequently, this important taxon is missing from several of our analyses and resulting ML trees. Nonetheless, in five of the eight ML trees in which it appears, it is shown as sister to the Paranebria species, forming a clade with them that is sister to Patrobonebria (Fig.
Nebria kagmara is not the most genetically distinct taxon within our Epinebriola sample. That distinction belongs to a clade including Nebria businskyorum Ledoux & Roux, 1997 and Nebria laevistriata Ledoux & Roux, 1998, two of the three species
Supertribe Nebriitae |
Tribe Notiokasiini |
[Genus Notiokasis Kavanaugh & Nègre, 1983] |
Tribe Notiophilini |
Genus Notiophilus Duméril, 1805 |
Tribe Opisthiini |
Genus Opisthius Kirby, 1837 |
Genus Paropisthius Casey, 1920 |
Tribe Pelophilini |
Genus Pelophila Dejean, 1821 |
Tribe Nebriini |
[Genus Archaeonebria Kavanaugh & Schmidt, 2019 Fossil] |
Genus Nippononebria Uéno, 1955 Revised Status |
Subgenus Nippononebria Uéno, 1955 |
Subgenus Vancouveria Kavanaugh, 1995 Revised Status |
Genus Leistus Frölich, 1799 |
Subgenus Nebrileistus Bänninger, 1925 |
Subgenus Sardoleistus Perrault, 1980 |
Subgenus Pogonophorus Latreille, 1802 |
[Manticora Panzer, 1803] |
[Oreobius Daniel, 1903] |
[Chaetoleistus Semenov, 1904] |
Eurinoleistus Breit, 1914 |
Subgenus Evanoleistus Jedlička, 1965 |
Subgenus Leistus Frölich, 1799 |
[Leistidius Daniel, 1903] |
[Acroleistus Reitter, 1905] |
Euleistus Reitter, 1905 |
Leistophorus Reitter, 1905 |
Neoleistus Erwin, 1970 |
Genus Nebria Latreille, 1802 |
Oreonebria Series |
Eonebria Complex |
Subgenus Parepinebriola New Subgenus |
Subgenus Sadonebria Ledoux & Roux, 2005 |
Subgenus Eonebria Semenov & Znojko, 1828 |
Oreonebria Complex |
Subgenus Epispadius Ledoux & Roux, 1999 |
Subgenus Falcinebria Ledoux & Roux, 2005 |
Subgenus Orientonebria Shilenkov, 1975 |
Subgenus Archastes Jedlička, 1935 New Status |
Subgenus Oreonebria Daniel, 1903 |
Nebriorites Jeannel, 1941 New Synonymy |
Germaria Jeanne, 1972 |
Germarina Jeanne, 1985 |
Marggia Huber, 2014 New Synonymy |
Nebriola Series |
Subgenus Nebriola Daniel, 1903 |
Nebria Series |
Boreonebria Complex |
Subgenus Nakanebria Ledoux & Roux, 2005 |
Subgenus Boreonebria Jeannel, 1937 |
Pseudonebriola Ledoux & Roux, 1989 New Synonymy |
Nebria Complex |
Nebria Subcomplex |
Subgenus Tyrrhenia Ledoux & Roux, 2005 |
Subgenus Nebria Latreille, 1802* |
Alpaeus Bonelli, 1810 |
Helobia Stephens, 1828 |
Harpazobia Gistel, 1856 |
Subgenus Spelaeonebria Peyerimhoff, 1911 |
Subgenus Alpaeonebria Csiki, 1946 |
Epinebriola Subcomplex |
Subgenus Epinebriola Daniel & Daniel, 1904 |
Patrobonebria Bänninger, 1923 New Synonymy |
Paranebria Jeannel, 1937 New Synonymy |
[Himalayonebria Ledoux, 1985] |
Barbonebriola Huber & Schmidt, 2016 New Synonymy |
Eunebria Subcomplex |
Subgenus Psilonebria Andrewes, 1923 |
Asionebria Shilenkov, 1982 New Synonymy |
Subgenus Eurynebria Ganglbauer, 1891 |
Subgenus Eunebria Jeannel, 1937 |
[Tetungonebria Shilenkov, 1982] |
[Sphodronebria Sciaky & Pavesi, 1994] |
Catonebria Series |
Reductonebria Complex |
Subgenus Insulanebria New Subgenus |
Subgenus Reductonebria Shilenkov, 1975 |
Subgenus Erwinebria New Subgenus |
Catonebria Complex |
Subgenus Nivalonebria New Subgenus |
Subgenus Neaptenonebria New Subgenus |
Subgenus Palaptenonebria New Subgenus |
Subgenus Catonebria Shilenkov, 1975 |
Incerta sedis |
[Genus Archileistobrius Shilenkov & Kryzhanovskij, 1983] |
[Genus Ledouxnebria Deuve, 1998 Fossil] |
This subcomplex includes 68 described species-group taxa presently arrayed in four subgenera: Asionebria, Eunebria, Psilonebria and Eurynebria.
Relationships among the taxa included in our analyses proved to be somewhat unexpected. The group is clearly divided into two well-supported clades (Fig.
The second clade in the Eunebria Subcomplex includes Eurynebria (N. complanata) and the remaining species of Eunebria in our sample (Fig.
We had only ten (22%) of the described taxa included in our sample of this subcomplex, so our results represent only a preliminary assessment of relationships within the group. With respect to the relationship between Eurynebria and Eunebria, several possibilities remain viable. There is some support for a clade including all Eunebria as sister to Eurynebria (Chart 1, line 86) from the 8G ML (Fig.
Given the conflicting evidence from our results, we cannot establish unambiguously whether Eurynebria is sister to Eunebria or nested within it. This is an important distinction for taxonomy because Eurynebria, which has included only N. complanata since its introduction, has priority over Eunebria if the two groups are united. We choose to leave these subgenera as separate pending additional evidence supporting the alternative.
This complex corresponds to subgenus Reductonebria as treated by
The second lineage in the complex is subgenus Reductonebria (Fig.
The Nearctic group of Reductonebria is comprised of 12 species (Fig.
The third lineage in the Reductonebria Complex (Fig.
Relationships among the three lineages also remain ambiguous. Results from the 8G ML, 8G B and Mito G concatenated analyses and the 16S-ND1, PEPCK, and wg analyses (Chart 1, line 98) support a clade including Reductonebria and Erwinebria as sister to Insulanebria. This relationship is also supported by two unique bases (Suppl. material
At present, this complex includes a single subgenus, Catonebria, named for the chain-like appearance of alternating elytral intervals seen in many but not all members of this group (Fig.
Within the complex, three distinct lineages are evident (Fig.
The second lineage in the complex is comprised of 20 described species-group taxa, which
The third lineage in the Catonebria Complex is subgenus Catonebria itself. In our concept of the subgenus, it is comprised of 42 species-group taxa with a combined geographical range equal to that of the entire complex. Ten species and one additional subspecies occur in the Palearctic Region, while the remaining 31 species are endemic to western North America. Both faunas include both widespread and geographically restricted species, as well as taxa with full-sized hindwings and others with reduced hindwings incapable of supporting flight. Some of the beetles in this subgenus possess vivid and stunning metallic reflection and coloration, as well as the most well-developed catenation of the elytral intervals (Fig.
A clade including Palaptenonebria and Neaptenonebria with Catonebria as sister to Nivalonebria (Fig.
Although many of the deeper nodes in the phylogeny were reconstructed with confidence, we found poor resolution among recently diverged (terminal) taxa. Within several of the species groups, we could not confidently reconstruct phylogenetic relationships based upon the data at hand. This was particularly true for groups within subgenera of the Catonebria Series. Given the low genetic divergences observed, as indicated by the short branches within these groups in the phylogenetic trees, this is not surprising, for two reasons. Only ca. 5100–5600 bases were analyzed for most species, which is likely insufficient because of the low per-site differences observed; a larger fraction of the genome is likely needed to ensure that the short internal branches are represented in the data by derived bases marking the presence of those branches. In addition, the short internal branches suggest short intervals between speciation events, and thus are likely regions of the tree with at least some incomplete lineage sorting (
A summary of phylogenetic relationships among the tribes, genera, and subgenera of supertribe Nebriitae based on our analyses is presented in Fig.
A sound hypothesis of phylogenetic relationships within any group of taxa is an essential prerequisite for interpreting the evolutionary and biogeographic significance of their observed geographical relationships. Facilitating a better understanding of the biogeographic and evolutionary histories of the Nebriitae, and particularly of the nebriines, was a prime motivation for this project. Although our sampling of several of the larger subgenera of Leistus and Nebria was inadequate to encompass their full diversity, a few overall conclusions can be drawn from our results. First and most importantly, we recognize a general consistency between the phylogenetic structure suggested by our analyses, particularly within the Nebriini, and the geographic cohesion of the clades recognized. This provides us with an added measure of confidence in our phylogenetic results. Although additional molecular sampling will be required to establish the geographical relationships of species groups in several subgenera, particularly within Leistus s. str., Evanoleistus, Eonebria, Boreonebria, Nebria s. str., Epinebriola, and Eunebria, a few clear and concordant vicariance patterns are already evident among the better-represented groups. For example, we recognize vicariance relationships between eastern Asia and western North America in one generic pair (Opisthius vs. Paropisthius), two subgeneric pairs (Nippononebria s. str. vs. Vancouveria and Neaptenonebria vs. Palaptenonebria) and at least four species group pairs (Leistus niger and related species vs. Nearctic species [formerly assigned to Neoleistus] in Leistus s. str.; Nebria gyllenhali and related species vs. N. castanipes and related species in Boreonebria; Palearctic vs. Nearctic Reductonebria species; and the Palearctic species vs. the N. metallica + N. labontei + N. trifaria group clade of Nearctic Catonebria).
Our results suggest that dispersal resulting in amphi-Pacific disjunct distributional patterns occurred at different times in the evolutionary history of Nebriitae. Deep splits such as in Opisthius/Paropisthius and Nippononebria s. str./Vancouveria may have resulted from dispersal events to western North America simultaneously with the Late Cretaceous-Paleogene formation of the Cordilleran Mountain system as it was hypothesized for metriine beetles (
Similarly, vicariance relationships are evident between Central Asia and the Asian Far East in one subgeneric pair (Archastes vs. Orientonebria) and at least two potential species group pairs (most Eonebria species vs. N. komarovi and related species and N. yunnana and related species vs. the species pair, N. lewisi + N. uenoi, in Eunebria). Vicariance between subgenus Oreonebria in the Alps and its sister group, Archastes + Orientonebria, in central and far eastern Asia is a pattern seen in some other carabid groups, such as within the broscine genus Broscosoma Rosenhauer, 1846 and the scaritine genus Reicheiodes Ganglbauer, 1891. As one last example, we cite vicariance relationships evident between eastern North America and the Rocky Mountain region of western North America. This pattern is shown by two species group pairs (the N. lacustris + N. bellorum clade vs. the N. hudsonica + N. gouleti clade of Boreonebria and the N. pallipes + N. appalachia clade vs. N. georgei and related species of Reductonebria). These and other vicariance patterns are likely to be clarified and/or replicated with additional molecular sampling; and because some involve sister taxa at different hierarchic levels (that is, between generic, subgeneric or species groups pairs), they likely reflect different divergence times. Future efforts will be directed at further examination of the spatial and temporal relationships implied by the phylogeny. Time calibration of our tree should help to correlate these and other biogeographically interesting vicariance relationships more precisely with events in Earth’s history, but that task was not part of the present study.
Based on results from this study, we present a revised classification of the supertribe Nebriitae to the genus-group level as summarized in Table
The most significant question that we had to address in establishing the classification presented here was whether to retain Nebria as a single large genus, as did
Explanation of certain morphological characters used in diagnoses and discussions. We use the term standardized body length (SBL) as a measure of body size. It is the sum of three separate measures: head length, measured along the midline from the apical margin of the clypeus to a point level with the posterior margin of the eyes; pronotal length, measured from apical to basal margin along the midline; and elytral length, measured along the midline from the apex of the scutellum to a point level with the apex of the longer elytron. This measure of total length eliminates problems with misalignment or telescoping of the three body tagmata, but it also underestimates overall body length by ca. 15%. What we call the “mid-shaft” of the median lobe of the aedeagus of males is the middle section of this tubular structure basal to the apical orifice. We use the term “gonocoxa” for the basal part of the female ovipositor, which
Epinebriola
Daniel & Daniel, 1904 (in part);
Nebria delicata Huber & Schmidt, 2017:59, by present designation.
Body size small or very small, SBL = 8.0 to 9.9 mm. Head moderately wide, slightly constricted behind eyes; vertex with a single central pale spot or a larger pale area and with a single pair of supraorbital setae present. Eyes slightly to moderately reduced in size, moderately to markedly convex. Antennal scape with one or two subapicodorsal setae; antennomeres 3 and 4 not laterally compressed, without extra setae. Labrum with three or four pairs of apical setae. Maxillary stipes typical for genus, with setae inserted flush on smooth surface. Penultimate labial palpomere with three setae. Pronotum with one midlateral seta (a second lateral seta present unilaterally in a few specimens) and one basolateral seta present on each side. Elytral intervals smooth, without macrosculpture, interval 3 with one to seven setiferous pores, intervals 5 and 7 without setiferous pores, intervals 3, 5, and 7 without catenations. Hindwings reduced to short, membranous lobes with only faint vestiges of venation. Metepisterna smooth to sparsely and faintly punctate. Protarsomeres 1–3 expanded in males; mesotarsomeres 2–4 longer than their apical width; tarsi dorsally glabrous or with only a few fine setae. Abdominal sternites IV to VI without paralateral setae. Median lobe of male aedeagus sclerotized dorsally at least to midlength on shaft; basal bulb only slightly expanded relative to shaft diameter and broadly open basally and with lateral and dorsal basal collar, without or with only slightly developed laterobasal lobes; sagittal aileron present at base as a small midline fin attached to collar; mid-shaft slightly tapered apically and with lateral right face unmodified; apical orifice mid-dorsal. Right paramere slender and moderately long. Female valvifers with vestiture; gonopods VIII fused to dorsomedial bases of gonocoxae; gonocoxae with ventral diagonal row of setiform setae and mediodorsal row of setae present. Bursa copulatrix without or (in one species) with dorsal paramedial sclerotized plates in vestibular chamber; spermathecal chamber broadly wedge-shaped, triangular in dorsal aspect, without a posterodorsal extension from its longitudinal axis in lateral aspect and without dorsal, anterodorsal or ventral sclerites; spermathecal duct of medium length, slender and uniform in diameter throughout or nearly so or (in one species) distinctly and abruptly thicker proximally, inserted basodorsally on spermathecal chamber; spermathecal reservoir moderately long.
The subgeneric epithet is a noun of feminine gender and a combination of the Greek word, para, meaning near, and the genus-group name, Epinebriola, in reference to the marked similarity of members of this group to those of subgenus Epinebriola.
As noted above in the Discussion section, the described members of this group were previously assigned to subgenus Epinebriola. We had no reason to doubt this assignment until after we had reviewed the results of our analyses. Two of the three undescribed species had also been tentatively identified as Epinebriola spp. The third shared more external features with Eonebria species than with Epinebriola species and had been identified initially as belonging to the former group. A subsequent, more detailed re-examination of both external and internal morphological features revealed a few differences that appear to distinguish members of this group from those of Epinebriola. In males: the median lobe of the male genitalia has a basal bulb without or with only slightly developed laterobasal lobes, whereas these lobes are moderately- to well-developed in Epinebriola; a sagittal aileron is present dorsobasally as a small midline fin attached to a basal collar, but the aileron is absent or present only as a flat, lightly sclerotized collar in Epinebriola; and the apical orifice is mid-dorsal, but moderately to markedly deflected right in Epinebriola. In females: the spermathecal chamber of the bursa copulatrix is simple, without a posterodorsal extension from the longitudinal axis in lateral view, while it has a slight posterodorsal extension in Epinebriola; the spermathecal duct is moderately long and slender (except distinctly thickened proximally only in one species, but short and moderately thick throughout in Epinebriola. We note that all Parepinebriola members in our sample have a small to large central pale area on the vertex of the head, whereas all the Epinebriola members in our sample lack such a pale area. However, we do not know if this distinction holds for the remaining Epinebriola not in our sample. Parepinebriola members also appear to differ morphologically with those of Nakanebria and Eonebria. In members of both of these groups, the head is not at all constricted behind the eyes, there is no trace of a sagittal aileron at the base of the male aedeagal median lobe, the basal bulb is quadrate with an expanded basal sleeve, the apical orifice is markedly deflected right, the female spermathecal chamber has a posterodorsal extension from the longitudinal axis in lateral view, the spermathecal duct is inserted mediodorsally on the spermathecal chamber and the spermathecal duct is slightly to extremely long.
Known distribution and diversity. The known geographical range of this clade extends from the central Trans-Himalaya (Gangdise Shan) of southern Tibet eastward to the Gaoligong Shan of northwestern Yunnan Province, China. Presently, it includes five species. Two of these (N. delicata and N. retingensis) have been described and previously included in Epinebriola (Huber & Schmidt, 2017), and the remaining three species are new and will be described in a separate paper.
Reductonebria
Shilenkov, 1975 (in part); = “carbonaria” group sensu
Nebria carbonaria Eschscholtz, 1829:24, by present designation.
Body size small, SBL = 8.2 to 9.5 mm (1–2). Head width medium to slightly broadened, not constricted behind eyes; vertex with a pair of paramedial pale spots and a single pair of supraorbital setae (13). Eyes of moderate size, moderately to markedly convex. Antennal scape with one subapicodorsal seta; antennomeres 3 and 4 not laterally compressed, without extra setae. Labrum with three pairs of apical setae. Maxillary stipes typical for genus, with setae inserted flush on smooth surface. Penultimate labial palpomere with three setae. Pronotum with midlateral setae absent, a single pair of basolateral setae present. Elytral intervals smooth, without macrosculpture, interval 3 with five to eight or more setiferous pores, interval 5 without setae (except one seta present in a few specimens) and interval 7 with zero or two or more setiferous pores, intervals 3, 5 (if setose), and 7 (if setose) moderately catenate. Hindwings reduced to short membranous lobes with only vestigial venation evident. Metepisterna smooth, impunctate. Protarsomeres 1–3 expanded in males; mesotarsomeres 2–4 longer than their apical width; tarsi dorsally glabrous. Abdominal sternites IV–VI with two to four pairs of posterior paramedial setae, without paralateral setae. Median lobe of male aedeagus sclerotized dorsally at least to midlength on shaft, only faintly deflected right in dorsal aspect; basal bulb expanded, triangular or quadrate, broadly open basally and closed dorsally, without a sagittal aileron present at base or with only a lightly sclerotized collar; mid-shaft parallel-sided in lateral aspect, circular or only slightly compressed in cross-section, with right lateral face unmodified; apical orifice slightly to moderately deflected right. Right paramere slender and moderately long. Female valvifers without vestiture; gonopods VIII fused to dorsomedial bases of gonocoxae; gonocoxae with ventral diagonal row of setiform setae and mediodorsal row of setae present. Bursa copulatrix without dorsal sclerites in vestibular chamber and with longitudinal axis slightly arched basodorsally in lateral aspect; spermathecal chamber broadly cordate in dorsal aspect, and without dorsal or anterodorsal sclerites, insemination duct sclerotized as a long, narrow plate ventrally in the chamber; spermathecal duct slightly long, uniform in diameter throughout or nearly so, inserted sub-basodorsally on spermathecal chamber; spermathecal reservoir of medium length.
The subgeneric epithet is a noun of feminine gender and a combination of the Latin word, insula, meaning island, and the genus name, Nebria, in reference to the occurrence of both known species of this clade in Kuril Island Archipelago of far eastern Asia.
Members of this group are easily identified as members of the Reductonebria Complex using the
The geographical range of this clade is restricted to the Kamchatka Peninsula and Kuril Islands Archipelago. It includes only two species, N. carbonaria and N. snowi, both of which have previously been included in subgenus Reductonebria.
= “gregaria group” sensu
Reductonebria
Shilenkov, 1975 (in part); = “sahlbergi” + “gregaria” groups sensu
Nebria sahlbergii Fischer von Waldheim, 1828:254, by present designation.
Body size small to medium, SBL = 7.1 to 11.7 mm. Head width medium to slightly broadened, not constricted behind eyes; vertex with a pair of paramedial pale spots and a single pair of supraorbital setae. Eyes slightly reduced to moderate in size, moderately to markedly convex. Antennal scape with one (two in very few specimens) subapicodorsal seta; antennomeres 3 and 4 not laterally compressed, without extra setae. Labrum with three pairs of apical setae. Maxillary stipes typical for genus, with setae inserted flush on smooth surface. Penultimate labial palpomere with three setae. Pronotum with midlateral setae absent, a single pair of basolateral setae present. Elytral intervals smooth, without macrosculpture, interval 3 with three to eight or more setiferous pores, intervals 5 and 7 without setiferous pores, interval 3 not or only faintly catenate, intervals 5 and 7 not catenate. Hindwings full-sized or slightly to markedly reduced in size. Metepisterna smooth or faintly punctulate. Protarsomeres 1–3 expanded in males; mesotarsomeres 2–4 longer than their apical width; tarsi dorsally glabrous or with a few fine setae. Abdominal sternites IV–VI with two to four pairs of posterior paramedial setae, without paralateral setae. Median lobe of male aedeagus sclerotized dorsally at least to midlength on shaft, moderately to markedly deflected right in dorsal aspect; basal bulb expanded, quadrate, broadly open basally and closed dorsally, without a sagittal aileron present at base or with only a lightly sclerotized collar; mid-shaft parallel-sided or slightly to moderately narrowed basally in lateral aspect, slightly compressed in cross-section, with right lateral face unmodified; apical orifice markedly to extremely deflected right. Right paramere slender and moderately long. Female valvifers with vestiture (a few specimens of some species without vestiture); gonopods VIII fused to dorsomedial bases of gonocoxae; gonocoxae with ventral diagonal row of setiform setae and mediodorsal row of setae present. Bursa copulatrix without dorsal sclerites in vestibular chamber and with longitudinal axis of the bursa moderately to markedly sigmoid dorsally in lateral aspect; spermathecal chamber broadly cordate in dorsal aspect, without (in Nebria lyelli Van Dyke, 1925 and Nebria quileute Kavanaugh, 1979) or with a small to large midline sclerotized dorsal plate, insemination duct not sclerotized; spermathecal duct medium-length to slightly long, uniform in diameter throughout or nearly so, inserted basodorsally on spermathecal chamber; spermathecal reservoir of medium length.
The subgeneric epithet is a noun of feminine gender and a combination of the surname of Terry L. Erwin, in whose honor we name this subgenus, and the genus name, Nebria.
Members of this group are easily identified as members of the Reductonebria Complex using the
The geographical range of this clade covers much of western North America, from the outer Aleutian Islands in the northwest, south to eastcentral California, northern Arizona, and New Mexico and east to the eastern edge of the Rocky Mountain system from Yukon Territory in Canada south to northcentral New Mexico.
Twenty-one species in this clade have been described.
= “ovipennis group” (in part) sensu
Nakanebria Ledoux & Roux, 2005 (in part)
Nebria paradisi Darlington, 1931:24, by present designation.
Body size small to medium, SBL = 8.7 to 11.3 mm. Head markedly broadened, not constricted behind eyes; vertex with a single medial pale area and a single pair of supraorbital setae. Eyes moderate in size, moderately convex. Antennal scape with one subapicodorsal seta; antennomeres 3 and 4 not laterally compressed, without extra setae. Labrum with three pairs of apical setae. Maxillary stipes typical for genus, with setae inserted flush on smooth surface. Penultimate labial palpomere with three setae. Pronotum with one midlateral and one basolateral seta present on each side. Elytral intervals smooth, without macrosculpture, interval 3 with one to seven setiferous pores, interval 5 with zero to two and interval 7 with zero to two or more setiferous punctures, intervals with setae only faintly catenate; elytral medial margins diverge slightly and arcuate from the midline apically. Hindwings reduced to short, slender strap-like vestiges. Metepisterna smooth, impunctate. Protarsomeres 1–3 expanded in males; mesotarsomeres 2–4 longer than their apical width; tarsi dorsally glabrous. Abdominal sternites IV–VI with one to four pairs of posterior paramedial setae, without paralateral setae. Median lobe of male aedeagus sclerotized dorsally at least to midlength on shaft, symmetrical in dorsal aspect; basal bulb expanded, quadrate, broadly open basally and closed dorsally, without a sagittal aileron present at base or with only a lightly sclerotized collar; mid-shaft parallel-sided in lateral aspect, slightly compressed in cross-section, with right lateral face unmodified; apical orifice markedly deflected right. Right paramere slender and very long. Female valvifers without vestiture; gonopods VIII fused to dorsomedial bases of gonocoxae; gonocoxae with ventral diagonal row of setiform setae and mediodorsal row of setae present. Bursa copulatrix with a pair of large dorsal paramedial sclerotized plates in vestibular chamber, with its longitudinal axis moderately sigmoid dorsally in lateral aspect; spermathecal chamber broadly cordate in dorsal aspect, without dorsal sclerites (in some N. paradisi) or with a small midline plate (other N. paradisi) or large and broad dorsal plate (in N. turmaduodecima); spermathecal duct very long and of uniform diameter throughout or nearly so, inserted basodorsally on spermathecal chamber; spermathecal reservoir of medium length.
The subgeneric epithet is a noun of feminine gender and a combination of the Latin word, nivalis, meaning snow, and the genus name, Nebria, in reference to the occurrence of all known members of this clade in the vicinity of montane snowfields and glaciers.
Members of this subgenus can be distinguished from those of subgenus Nakanebria, to which they were assigned by
The geographical range of this clade includes two disjunct areas of western North America, each with a single endemic species: (1) the northern Cascade Range of Washington and northern Oregon, from North Cascades National Park in the north to Mount Hood in the south (with N. paradisi endemic to that area); and (2) the Trinity Alps of northwestern California (with N. turmaduodecima endemic there).
= “ovipennis group” (in part) sensu
Catonebria
Shilenkov, 1975 (in part); = “kincaidi group” sensu
Nebria ovipennis LeConte, 1878:477, by present designation.
Body size small to medium, SBL = 9.4 to 12.8 mm. Head width medium or slightly to markedly broadened, not constricted behind eyes; vertex with a pair of paramedial pale spots on vertex and one pair of supraorbital setae. Eyes moderate in size or slightly reduced, moderately convex. Antennae slightly to moderately elongate; antennal scape with one subapicodorsal seta; antennomeres 3 and 4 not laterally compressed, without extra setae. Labrum with three pairs of apical setae. Maxillary stipes typical for genus, with setae inserted flush on smooth surface. Penultimate labial palpomere with three setae (except only two present in Nebria carri Kavanaugh, 1979 specimens). Pronotum markedly to extremely cordate in dorsal aspect, with lateral margination faintly impressed and slightly narrow at middle; one midlateral seta and one basolateral seta present on each side (except basolateral setae absent from N. carri, Nebria balli Kavanaugh, 1979 and Nebria kincaidi Schwarz, 1900 specimens). Elytral intervals smooth, moderately convex, without macrosculpture; elytral interval 3 with two to seven setiferous pores, interval 5 with zero or one setiferous pore, and interval 7 with zero to two or more setiferous pores; umbilicate series comprised of from ten to 17 setae; intervals bearing setae faintly to moderately catenate. Hindwings reduced to short, slender strap-like vestiges. Metasternum very markedly to extremely short. Metepisterna smooth, impunctate. Protarsomeres 1–3 expanded in males (except all five tarsomeres expanded in males from some populations of N. ovipennis LeConte, 1878); mesotarsomeres 2–4 longer than their apical width (except expanded in specimens from some populations of N. ovipennis); tarsi dorsally glabrous. Abdominal sternites IV–VI with from one (seen only in some specimens of N. balli) to five or more pairs of posterior paramedial setae and with from zero to five pairs of posterior paralateral setae; sternite VII with one pair of paramedial apical setae in males, two pairs in females. Median lobe of male aedeagus sclerotized dorsally at least to midlength on shaft, symmetrical to slightly deflected right in dorsal aspect; basal bulb expanded, quadrate, broadly open basally and closed dorsally, without a sagittal aileron present at base or with only a lightly sclerotized collar; mid-shaft parallel-sided in lateral aspect, slightly to moderately compressed in cross-section, with right lateral face with a distinctly and deeply invaginated pouch; apical orifice extremely deflected right. Right paramere narrow and slightly shortened. Female hemisternites VIII with basal apodeme very deeply emarginated. Female valvifer without vestiture; gonopods VIII fused to dorsomedial bases of gonocoxae; gonocoxae with ventral diagonal row of setiform setae and mediodorsal row of setae present, mediodorsal row oriented obliquely relative to longitudinal axis of gonocoxa. Bursa copulatrix without dorsal sclerites in vestibular chamber and without a posterodorsal extension from its longitudinal axis in lateral aspect; spermathecal chamber broadly cordate in dorsal aspect, without dorsal sclerites (in most species) or with a simple flat plate on dorsal surface of an accessory lobe (in N. kincaidi and N. balli); spermathecal duct medium to slightly short in length and of uniform diameter throughout or nearly so, inserted basodorsally on spermathecal chamber or on a dorsal accessory lobe of that chamber; spermathecal duct slightly short to medium length; spermathecal reservoir of medium length.
The subgeneric epithet is a noun of feminine gender and combination of the Greek word, neos, meaning new, in reference to the Nearctic (New World) distribution of the group, the Greek word, aptenos, meaning unable to fly, and the genus name, Nebria, in reference to the observation that all known members of this clade have extremely reduced hindwings incapable of supporting flight.
Members of this group are easily identified as members of the Catonebria Complex using the
A few additional features distinguish members of this clade from most members of the Palaptenonebria clade. Most adults of Neaptenonebria species are medium-sized with SBL > 10 mm, whereas all Palaptenonebria adults are smaller, with SBL ≤ 9.5 mm; but smallest the members of the former clade (SBL = 9.4 mm) overlap in size with the largest members of the latter (SBL = 9.5 mm). In Neaptenonebria species, the pronotal shape is more extremely cordate with the lateral pronotal margination more faintly impressed and less narrowed at the middle than in Palaptenonebria species. The elytra are more convex in Neaptenonebria species than in Palaptenonebria species, and the elytral umbilicate series is comprised of 11–17 setae in Neaptenonebria species but only 8–12 setae in Palaptenonebria species. The length of the metasternum is greatly reduced in both of these clades but more extremely so among Neaptenonebria adults. Most members of all species of the Neaptenonebria clade except N. ovipennis have paralateral setae on sternites IV–VI, and, when present, these setae are inserted much nearer to the posterior than the anterior margin of the sternite. All specimens examined of several species of the Palaptenonebria clade lack paralateral setae and, in the other species and those individuals in which these setae are seen, they are inserted in a more anterior position on the ventrites. In all Neaptenonebria species, all males examined have a single pair of apical paramedial setae on sternite VII and females have two pairs of these setae, whereas in all Palaptenonebria species at least some if not most or all males have two or more pairs of setae and at least some females have three or more pairs of setae. Finally, the basal apodemes of the female hemisternites VIII are more deeply emarginate in all Neaptenonebria females than in any Palaptenonebria females.
The geographical range of this clade is restricted to western North America. It includes six species that together occupy a disjunct geographical distribution, with three species endemic to the Sierra Nevada of California and westernmost Nevada, one endemic to the mountains of Central Idaho and the Bitterroot Mountains of westernmost Montana, one to the Cascade Range of southern Washington and northern Oregon, and one to the western slope of Coast Ranges of southeastern Alaska and British Columbia south to Vancouver Island and the Olympic Peninsula of Washington.
Catonebria
Shilenkov, 1975 (in part); = “mellyi” group sensu
Nebria mellyi Gebler, 1847:312, by present designation.
Body size small, SBL = 7.2 to 9.5 mm. Head width medium or slightly broadened, not constricted behind eyes; vertex with a pair of paramedial pale spots on vertex and one pair of supraorbital setae. Eyes slightly to moderately reduced in size, moderately convex. Antennae medium length to slightly elongate; antennal scape with one subapicodorsal seta (or two in Nebria roddi Dudko & Shilenkov, 2001 and Nebria baenningeri korgonica Dudko & Shilenkov, 2001); antennomeres 3 and 4 not laterally compressed, without extra setae. Labrum with three pairs of apical setae. Maxillary stipes typical for genus, with setae inserted flush on smooth surface. Penultimate labial palpomere with three setae. Pronotum moderately cordate in dorsal aspect, with lateral margination shallowly to moderately impressed and markedly narrow at middle; one midlateral seta and one basolateral seta present on each side. Elytral intervals smooth, slightly to moderately flattened, without macrosculpture, elytral interval 3 with one to seven setiferous pores, intervals 5 and 7 with zero to two setiferous pores; umbilicate series comprised of eight to ten setae; intervals bearing setae faintly to moderately catenate. Hindwings reduced to short, slender strap-like vestiges. Metasternum moderately to markedly short. Metepisterna smooth, impunctate. Protarsomeres 1–3 expanded in males; mesotarsomeres 2–4 longer than their apical width; tarsi dorsally glabrous (or with few sparse and fine setae in Nebria mellyi Gebler, 1847 specimens). Abdominal sternites IV–VI with from two to five or more pairs of posterior paramedial setae and with zero to three pairs of anterior paralateral setae; sternite VII with one or two pairs of paramedial apical setae in males, two to three or more pairs in females. Median lobe of male aedeagus sclerotized dorsally at least to midlength on shaft, symmetrical to slightly deflected right in dorsal aspect; basal bulb expanded, quadrate, broadly open basally and closed dorsally, without a sagittal aileron present at base or with only a lightly sclerotized collar; mid-shaft parallel-sided in lateral aspect, slightly to moderately compressed in cross-section, right lateral face with a shallow longitudinal groove or shallow indentation; apical orifice moderately (in Nebria lyubechanskii Dudko, 2008 specimens only) or extremely deflected right. Right paramere narrow and slightly shortened. Female hemisternites VIII with basal apodeme faintly to moderately emarginated. Female valvifer without vestiture; gonopods VIII fused to dorsomedial bases of gonocoxae; gonocoxae with ventral diagonal row of setiform setae and mediodorsal row of setae present, mediodorsal row oriented parallel to longitudinal axis of gonocoxa. Bursa copulatrix without dorsal sclerites in vestibular chamber and without a posterodorsal extension from its longitudinal axis in lateral aspect; spermathecal chamber broadly cordate in dorsal aspect, without dorsal sclerites (in most species) or with a simple, broad and convoluted plate anterior to spermathecal duct insertion (in Nebria sajana sarlyk Dudko & Shilenkov, 2001, N. s. dubatolovi Dudko & Shilenkov, 2001 and N. s. sitnikovi Dudko & Shilenkov, 2001); spermathecal duct slightly short in length and of uniform diameter throughout or nearly so, inserted basodorsally on spermathecal chamber or on a dorsal accessory lobe of that chamber (in Nebria sajana sajana Dudko & Shilenkov, 2001); spermathecal reservoir of medium length.
The subgeneric epithet is a noun of feminine gender and combination of the Greek word, palaios, meaning old, in reference to the Palearctic (Old World) distribution of the group, aptenos, meaning unable to fly, and the genus name, Nebria, in reference to observation that all known members of this clade have extremely reduced hindwings incapable of supporting flight.
As for members of subgenus Neaptenonebria, those of this group are easily identified as members of the Catonebria Complex using the
The geographical range of this clade is restricted to the Altai-Sayan region of southern Siberia, including the Altai, Western Sayan and Tannu-Ola Mountain systems, and presently includes six taxa ranked as species and another eight ranked as subspecies.
A better understanding of relationships among nebriite carabids should be achieved with additional taxon sampling for molecular data. Atop the list of taxa that remain unsampled are Notiokasis and Archileistobrius. Molecular data should allow us to confirm whether or not the former is a member of this clade and just how the latter is related to other Nebriini. Within genus Nebria, several groups remain inadequately sampled. This is especially true for the diverse Nebria Complex, including the currently non-monophyletic subgenus Nebria s. str. The addition of species from any part of the range of this subgenus would be useful, but especially those from the Caucasus Mountains region and Asia Minor, the Balkan and Italian Peninsulas, and the Carpathian Mountains system. Subgenera Tyrrhenia and Alpaeonebria are also under-represented in our sample, and each includes groups that, together, might not comprise a single clade. Our sample did not include any representatives of subgenus Boreonebria from the southern part of its range, across mid-latitudes in Asia from North Korea to Kazakhstan. Consequently, relationships of species from these areas to other members of the subgenus remain unclear. Additional sampling within Epinebriola, including additional western and central Himalayan species and species currently assigned to Patrobonebria, could help to clarify relationships within that clade. Data from additional Eunebria species should help determine whether Eurynebria is sister to Eunebria or just where within the latter it is nested. Although we do not anticipate that the sampling of DNA from additional Archastes species will alter the relationships of this group to other Nebria suggested by this study, genetic diversity within the group deserves further examination. It is not yet clear how the central Asian and Far East Asian Eonebria species are related, whether they represent distinct clades or if they share more complicated relationships. Additional samples from both of these areas could help resolve this question. Finally, although sampling of the Reductonebria and Catonebria Complexes has been extensive, a few species not included in our sample remain of interest. Among Reductonebria, N. angustula from the Kamchatka Peninsula, Russia and N. nicolasi from the Qionglai Mountains of central Sichuan Province, China exhibit some morphological features atypical for the subgenus. Among Catonebria, N. scaphelytra and N. suensoni are outliers, morphologically and geographically, respectively. Adding these taxa to the molecular taxon sample should help to clarify phylogenetic relationships for each of them and for the subgenera to which they belong.
Many of the species yet to be sampled for DNA are from areas not easy or even possible to visit safely for collecting fresh material, and others are known only from one or a few specimens deposited in collections. The use of high-throughput and ancient DNA sequencing technologies offers an opportunity to access DNA non-destructively from dried and pinned specimens of many of these species. Future research should make use of this source of new DNA sequence data whenever possible.
We have not yet been able to carry out a molecular clock analysis of the nebriite phylogenetic tree using our data. Recent additions to the fossil record for nebriites may allow us to better estimate dates for at least some major nodes in the tree, but this work remains for the future.
Much classical taxonomic work using morphology is also still ahead. Many of the clades we recognize based on analyses of DNA sequence data currently have few if any concordant morphological synapomorphies that support them. A re-examination of internal and external morphology of members of these new clades in particular may yield new synapomorphic features previously overlooked, or perhaps also from new character systems, if we focus our sampling on these clades and their boundaries. The re-examination of morphological features is particularly important among members of the Epinebriola and Eunebria species that were unavailable to use for this study. For each of these subgenera, groups of species formerly assigned to them were found to be more closely related to other subgenera. Nebria delicata and N. retingensis have been transferred from Epinebriola to subgenus Parepinebriola subgen. nov. Outstanding questions include which, if any, of the species still included in Epinebriola should also be transferred to Parepinebriola, and do the morphological features tentatively recognized as distinguishing the two subgenera hold true? Similarly, three members of the przewalskii group of Eunebria have been shown instead to be members of Psilonebria. Do the other members of the przewalskii group not examined in our study, or perhaps those other species still included in Eunebria, share the morphological features now associated with Psilonebria? Re-examination of morphological features in these groups may help to answer these questions.
Additional morphological characters are also needed before we can generate useful keys for the identification of the subgeneric series, complexes and subcomplexes and even some of the subgenera within Nebria as we have proposed. Characters used in these keys will need to be well illustrated.
We have noted and lamented the general inability of the results of our analyses of molecular data to resolve clearly phylogenetic relationships among many of the terminal taxa in our species trees. The divergences of many of these taxa are associated with very short branch lengths, suggesting that they are relatively recent events. In addition, we have used single specimens to represent all but a few of the species-group taxa in our sample. Recent phylogeographic studies by
The lead author is honored to dedicate this contribution to the memory of his dear colleague, coauthor, and friend of more than fifty years, Terry Lee Erwin. Terry was an unwavering source of inspiration and support for him and for the entire community of systematists and ecologists.
During the 25 years since work on this molecular phylogenetic project began, vital assistance has been received from many sources. Fieldwork associated with the project was supported by grants to the first author from the National Science Foundation (Grant DEB-0103795 Biotic Surveys and Inventories Program), the National Geographic Society, the John D. and Catherine T. MacArthur Foundation, the Boreal Institute for Northern Studies (University of Alberta, Edmonton) and by the Lindsay Fund for Field Research, In-House Research Fund, and donors to the China Natural History Project at the California Academy of Sciences (CAS). Fieldwork of SDS and DHK in the Altai and Sayan Mountains of central Asia was supported by the National Geographic Society (Grant 8993-11). Fieldwork of JS in the Himalaya and Tibet was partly supported by the German Research Council (grants DFG-SCHM 3005/2-1, DFG-SPP 1372).The first author also gratefully acknowledges permits issued to him by the Navajo Department of Fish and Wildlife, Grand Canyon National Park, Mountain Rainier National Park, Olympic National Park, and Yosemite National Park for collecting specimens unique to these protected areas. The Institutes of Botany and Zoology in Kunming provided crucial logistical support for important fieldwork in Yunnan Province, China.
We especially wish to acknowledge and thank the following individuals who joined one or more of us in the field for collecting specimens for this study: Salah Aït Mouloud (Université Mouloud Mammeri, Tizi Ouzou, Algeria), Charles Bourdeau (Rebigue, France), Roberta L. Brett (CAS), Da-Zhi Dong (Kunming Institute of Zoology, Yunnan, China), Roman Dudko (Institute of Systematics and Ecology of Animals, Novosibirsk, Russia), Javier Fresneda (Llesp, Spain), Gay C. Hunter (Olympic National Park, Washington), Jeffrey L. Kavanaugh (University of Alberta, Edmonton), Michael D. Kavanaugh (San Francisco, California), Thomas W. Kavanaugh (Alameda, California), James R. LaBonte (Oregon Department of Agriculture, Salem), Hong-Bin Liang (Institute of Zoology, Chinese Academy of Sciences, Beijing), Chun-Lin Long (Minzu University of China, Beijing), Paul E. Marek (Virginia Tech University, Blacksburg), Ignacio Ribera (Institute of Evolutionary Biology, Barcelona, Spain), Jere S. Schweikert (CAS), Victor G. Shilenkov (Irkutsk State University, Irkutsk, Russia), Hong-Liang Shi (College of Forestry, Beijing Forestry University, China), Yi-Ming Weng (University of Wisconsin, Madison), and Kipling W. Will (University of California, Berkeley). We also thank the following individuals who provided one or more specimens which added greatly to the breadth of our taxon sampling: Mauro Bastianini (Instituto di Scienze Marine, Venezia, Italy), Sandra Brantley (University of New Mexico, Albuquerque), Achille Casale (Università di Sassari, Sassari, Italy), John P. Dumbacher (CAS), Henri Goulet (Agriculture and Agri-Food Canada, Ottawa), Kathryn M. Kavanaugh (Petaluma, California), Antonio Machado (La Laguna, Teneriffe, Canary Islands, Spain), Seiji Morita (Toyko, Japan), Robert Nelson (Colby College, Waterville, Maine), Koji Sasakawa (Chiba University, Chiba, Japan), Riccardo Sciaky (Università degli Studi di Milano, Italy), Larry Stephens (University of Northern Arizona, Flagstaff), Alexander Szallies (Zürich University of Applied Sciences, Switzerland), and Peter H. Wimberger (Universty of Puget Sound, Tacoma, Washington).
Boni Cruz, Athena Lam, Joel Ledford, Anna Selas, and Laura Zamorano in the Center for Comparative Genomics at CAS and John Sproul in the Maddison Lab at Oregon State University provided helpful advice and/or technical support for the molecular work for this project. Illumina sequencing was funded by the Harold E. and Leona M. Rice Endowment Fund at Oregon State University.
Thierry Deuve (Museum National d’Histoire Naturelle, Paris), Philippe Ledoux (Paris, France), Jean-Michel Lemaire (Muséum d’Histoire Naturelle de Nice), and Pierre Moret (Université de Toulouse) provided copies of literature important to the project. Philippe Roux provided unpublished information about the analytical methods that he and George Ledoux used in constructing their classification and phylogeny of Nebria. Michael Raupach and Jose Serrano provided careful reviews of the submitted manuscript and made numerous helpful suggestions for its improvement, and we thank them for their efforts.
Finally, the lead author wishes to acknowledge and thank his wife, Beverly, and children, Michael, Jeffrey, Thomas, Rebecca, and Kathryn, for giving him the freedom and their love and support to pursue his passion for these wonderful beetles during the last five decades.
For each specimen, DNA voucher number is listed under “DNA ID” and its depository is listed under “Dep” (AF = A. Faille collection;
Taxon | DNA ID | Locality | Dep |
---|---|---|---|
Leistus birmanicus | DHK0084 | China, Yunnan, Gongshan County, Dulongjiang Township, Bapo, Miliwang, 1956 m, 27.72383°N, 098.36117°E |
|
Leistus crenatus | DHK1939 | Algeria, Central Djurdjura, Anou Boussouil, 1718 m, 36.4690°N, 4.1914°E |
|
Leistus ferrugineus | DHK1903 | Italy, Piedmont, Cuneo, Po River Valley at Paesano, 618 m, 44.67584°N, 7.27709°E |
|
Leistus ferruginosus | DHK0336 | USA, Oregon, Benton County, Alsea Falls, 326 m, 44.31949°N, 123.49750°W |
|
Leistus frateroides | SDS13-123A | Russia, Altai Republic, Evrechala Mt., 1891 m, 51.47490°N, 087.42992°E |
|
Leistus fulvibarbis | DHK1937 | France, Eure, La Saussaye, 49.25326°N, 0.99201°E |
|
Leistus fulvus | DHK1938 | Azerbaijan, Qax, forest litter in road to Qax, 580 m, 41.39828°N, 46.92153°E |
|
Leistus gaoligongensis | DHK0340 | China, Yunnan, Longyang County, Luoshuidong, 2308 m, 24.94833°N, 98.75667°E |
|
Leistus kryzhanovskii | SDS13-330A | Russia, Altai Republic, Aigulaksky Range, 2555 m, 50.44896°N, 087.40025°E |
|
Leistus lihengae | DHK0343 | China, Yunnan, Longyang County, Luoshuidong, 2308 m, 24.94833°N, 98.75667°E |
|
Leistus longipennis | DHK0338 | USA, California, Del Norte County, 8.3 miles N of Crescent City, 18 m, 41.86559°N, 124.13906°W |
|
Leistus madmeridianus | DHK0339 | USA, California, Sonoma County, Salt Point State Park, 91 m, 38.56823°N, 123.31916°W |
|
Leistus niger | DHK1761 | Russia, Republic of Khakassia, Karasibo River, 750 m, 52.30713°N, 90.12761°E |
|
Leistus niitakaensis | DHK1800 | Taiwan, Chiayi County, Alishan District, west slope Yu Shan, 3429 m, 23.46641°N, 120.95041°E |
|
Leistus nitidus | DHK1888 | France, Hautes-Alpes, Ristolas, 1643 m, 44.77196°N, 6.95399°E |
|
Leistus nokoensis | DHK1834 | Taiwan, Tiachung City, Xueshan, Black Forest, 3340 m, 24.39359°N, 121.24936°E |
|
Leistus nubivagus | DHK0502 | Canary Islands, Tenerife, La Victoria, Barranco del Madroño, 1435 m |
|
Leistus parvicollis | DHK2107 | Greece, Kefallonia, Enos, 1000–1600 m |
|
Leistus pyrenaeus | DHK1941 | Spain, Lleida, Llastarri, Minas de Canal |
|
Leistus rufomarginatus | DHK1394 | Belgium, West Flanders, Wijnendale Forest |
|
Leistus sardous | DHK1942 | Italy, Sicily, Piana degli Albanesi – Grotta del Garrone | AF |
Leistus smetanai | DHK1860 | Taiwan, Taichung City, Xueshan, Black Forest, 3460 m, 24.39373°N, 121.25114°E |
|
Leistus sp JIL 2 | SDS12-202 | China, Jilin, northern slope of Changbai Shan, 1772 m, 42.04913°N, 128.05782°E |
|
Leistus sp NEP | DHK2108 | Nepal, Lapchi Kang range, Chera, 4400 m, 27.89861°N, 86.06278°E |
|
Leistus sp SCH | DHK0634 | China, Sichuan, Litang County, Shalulishan, Haizishan Yakou, 4610 m, 29.47366°N, 100.21921°E |
|
Leistus sp YUN 1 | DHK0015 | China, Yunnan, Gongshan County, Heiwadi, 2070 m, 27.79650°N, 98.58267°E |
|
Leistus sp YUN 2 | DHK0224 | China, Yunnan, Shibali Yakou, second cirque, 3700 m, 27.20333°N, 98.69303°E |
|
Leistus taiwanensis | DHK1838 | Taiwan, Nantou County, Tatajia at Dongpu Cabin, 2563 m, 23.48438°N, 120.88591°E |
|
Nebria acuta | DHK0018 | USA, Alaska, Wrangell Mts., Kennicott, National Creek, 615 m, 61.48469°N, 142.88696°W |
|
Nebria aenea | DHK1445 | Russia, Altai Krai, Charyshsky District, Altai Mts., Gorelyi, Korgon River, 1000 m, 53.0°N, 83.8°E |
|
Nebria albimontis | SDS05-018 | USA, California, Mono County, North Fork Perry Eiken Creek, 3278 m, 37.63879°N, 118.22910°W |
|
Nebria altaica | DHK0404a | Russia, Buryat Republic, Tunka Mts., East Branch Kingarga River, 1500 m, 51.97275°N, 102.45970°E |
|
Nebria angustata | DHK1653 | Switzerland, Bern, Guttannen, Furtwangsattel |
|
Nebria angusticollis | DHK1896 | France, Hautes-Alpes, Col d’Agnel, 2704 m, 44.68499°N, 6.97789°E |
|
Nebria appalachia | DHK0507 | USA, Tennessee, Sevier County, Great Smoky Mountains National Park, Ramsey Prong, 1084 m, 35.7088°N, 83.3129°W |
|
Nebria arinae | SDS12-063E | Russia, Altai Republic, Holzun Mts., 2162 m, 50.20821N°, 084.55408°E |
|
Nebria arkansana | DHK0838 | USA, Colorado, Summit County, Quandary Peak, 3763 m, 39.39159°N, 106.11371°W |
|
Nebria austriaca | DHK1654 | Austria, Lower Austria, The Oscher |
|
Nebria baenningeri | SDS12-025A | Russia, Altai Republic, Holzun Mts., 2018 m, 50.31269°N, 084.61154°E |
|
Nebria baicalica | DHK0386a | Russia, Irkutsk Oblast, Lake Baikal at Bolschie Koty, 450 m, 51.90405°N, 105.08014°E |
|
Nebria balli | DHK0930 | USA, Washington, Mt. Rainier National Park, Paradise area, Edith Creek Basin, 1807 m, 46.79678°N, 121.72711°W |
|
Nebria banksii | DHK0406 | Russia, Kamchatka, Avancha River, 11 m, 53.18297°N, 158.39328°E |
|
Nebria baumanni | DHK1814A | USA, Nevada, Clark County, Spring Mts., Deer Creek, 2570 m, 36.31018°N, 115.62334°W |
|
Nebria bellorum | DHK0510 | USA, Tennessee, Sevier County, Great Smoky Mountains National Park, Middle Fork Little Pigeon River, 630 m, 35.7031°N, 83.3581°W |
|
Nebria beverlianna | DHK0804 | USA, Wyoming, Sublette County, Hoback River, 1930 m, 43.27364°N, 110.52606°W |
|
Nebria boschi | DHK1509 | Germany, Baden-Wüttemberg, Tübingen, Bad Urach, Höhle, 670 m, 48.480°N, 9.368°E |
|
Nebria bremii | DHK1648 | Switzerland, Uri, Schlossberglücke |
|
Nebria brevicollis OR | DHK0717 | USA, Oregon, Polk County, 1.5 miles W of Dallas, 160 m, 44.90748°N, 123.35466°W |
|
Nebria brevicollis SP | DHK0009 | Spain, Albacete, Peñascosa, 38.67305°N, 2.40324°E |
|
Nebria businskyorum | DHK0676 | China, Xizang, Medog, Baibung, E of Doxong Pass, 3937 m, 29.48748°N, 94.95791°E |
|
Nebria calva | DHK0430a | USA, Arizona, Apache County, West Fork Little Colorado River, 2814 m, 33.95821°N, 109.51614°W |
|
Nebria capillosa | DHK2029 | Nepal, Dolpo district, Rupghat Khola valley E of Juphal, 2150–2500 m, 29.97°N, 82.85°E |
|
Nebria carbonaria | DHK0459a | Russia, Kuril Islands, Paramushir, inland from Severo-Kurilsk, east slope Ebeko Volcano, 50.67533°N, 156.09550°E |
|
Nebria carri | DHK0208 | USA, Idaho, Camas County, Carrie Creek, 2426 m, 43.59555°N, 114.69264°W |
|
Nebria cascadensis | DHK0899 | USA, Washington, Whatcom County, North Fork Nooksack River, 222 m, 48.90471°N, 121.99183°W |
|
Nebria castanea | DHK1519 | Italy, Trentino-Alto, Passo di Gávia, 2547 m, 46.35983°N, 10.50054°E |
|
Nebria castanipes | DHK0001 | Canada, British Columbia, Alexander Creek, 3.6 miles W of Crowsnest Pass, 1308 m, 49.65580°N, 114.73222°W |
|
Nebria catenata | DHK1067 | USA, Utah, Grand County, La Sal Mts., Mill Creek, 2545 m, 38.50914°N, 109.28248°W |
|
Nebria catenulata | DHK0405a | Russia, Buryat Republic, Tunka Mts., East Branch Kingarga River, 1500 m, 51.97275°N, 102.45970°E |
|
Nebria changaica | DHK1451 | Russia, Altai Republic, Altai Mts., Ukok Upland near Murzdy-Bulak Lake, 2700–3100 m, 49.28°N, 87.65°E |
|
Nebria charlottae | DHK1254 | Canada, British Columbia, Haida Gwaii, Graham Island, north shore at Tow Hill, 3 m, 54.07382°N, 131.66662°W |
|
Nebria chinensis | DHK0600 | China, Shaanxi, Zhouzhi County, Houzhenzi village, 1271 m, 33.85190°N, 107.83776°E |
|
Nebria chuskae | DHK0437a | USA, Arizona, Apache County, Lukachukai Creek, 2200 m, 36.44443°N, 109.17993°W |
|
Nebria coloradensis | DHK0852 | USA, Colorado, Lake County, Lake Creek, 2927 m, 39.06532°N, 106.42093°W |
|
Nebria complanata | DHK1949 | Italy, Grosseto, Parco Regionale della Maremma, Monti dell’Uccellina, 42.63284°N, 11.07733°E |
|
Nebria coreica | DRM4721 | Russia: Primorsky Krai, 20 km W of Nachodka |
|
Nebria crassicornis | DHK0021 | USA, Washington, Olympic National Park, Hurricane Ridge, 1580 m, 47.97166°N, 123.49000°W |
|
Nebria dabanensis | DHK0402b | Russia, Buryat Republic, Khamar-Daban Mts., Baikalsky Preserve, 1803 m, 51.34774°N, 105.13042°E |
|
Nebria danmanni | DHK1134 | USA, Washington, Olympic National Park, Mount Olympus, Snow Dome, 2050 m, 47.81165°N, 123.70196°W |
|
Nebria darlingtoni | DHK0023 | USA, California, El Dorado County, South Fork American River, 934 m, 38.76730°N, 120.48415°W |
|
Nebria delicata | DHK2082 | China, Xizang, Mt. Mendju Zari SE of Lhasa, 5200–5420m, 29.57°N, 91.22°E | JS |
Nebria cf. desgodinsi | DHK2026 | Nepal, Solu Khumbu district, near Kothe (Mosom Kharka), Inkhu Khola, 3600–3700 m, 27.67°N, 86.83°E |
|
Nebria desolata | DHK0450a | USA, Utah, Garfield County, 6.0 miles NE of Henrieville, Dry Creek, 1971 m, 36.44443°N, 109.17993°W |
|
Nebria diaphana | DHK1652 | Italy, Trentino, Passo di Brocon |
|
Nebria diversa | DHK0014 | USA, Oregon, Lincoln County, 2 miles N of Newport at Moolack Beach, 6 m, 44.70572°N, 124.06115°W |
|
Nebria dubatolovi | SDS12-092A | Russia, Altai Republic, Katunskii Mts., 2419 m, 50.00761°N, 086.25175°E |
|
Nebria edwardsi | DHK0025 | USA, Montana, Mineral County, Trout Creek, 13.4 miles NE of Hoodoo Pass, 1006 m, 47.07933°N, 114.92120°W |
|
Nebria edwardsi | DHK0463a | USA, Montana, Mineral County, Trout Creek, 13.4 miles NE of Hoodoo Pass, 1007 m, 47.07933°N, 114.92120°W |
|
Nebria eschscholtzii | DHK0022 | USA, California, Somona County, Mark West Creek, 142 m, 38.54291°N, 122.72066°W |
|
Nebria fontinalis | DHK1536 | Switzerland, Uri, Oberalp, 2036 m, 46.66236°N, 8.66794°E |
|
Nebria formosana | DHK1592 | Taiwan, Taichung City, Heiping District, Xue Shan, Black Forest, 3460 m, 24.39372°N, 121.25114°E |
|
Nebria fragariae | DHK0996 | USA, Oregon, Grant County, Strawberry Creek, 1750 m, 44.31951°N, 118.67473°W |
|
Nebria fragilis | DHK0028 | USA, Utah, Utah County, South Fork American Fork River, 2207 m, 40.43519°N, 111.63603°W |
|
Nebria frigida | DHK0005 | USA, Alaska, Wrangell Mts., Kennicott, National Creek, 615 m, 61.48469°N, 142.88696°W |
|
Nebria fulgida | DHK0409a | Russia, Buryat Republic, Tunka Mts., Kingarga River, 1380 m, 51.97478°N, 102.41099°E |
|
Nebria fulviventris | DHK1397 | Italy, Tuscany, Vallombrosa, 43.733°N, 11.557°E |
|
Nebria gagates | DHK1880 | France, Hautes-Alpes, Ristolas, Torrent de Clot Lucette, 1740 m, 44.76780°N, 6.94974°E |
|
Nebria gebleri | DHK0002 | USA, Alaska, Chichagof Island, Goulding River, 23 m, 57.77752°N, 136.25931°W |
|
Nebria georgei | DHK0501 | USA, Arizona, Grand Canyon National Park, Colorado River Mile 180, 36.187°N, 113.106°W |
|
Nebria germari AU | DHK1645 | Austria, Upper Austria, Höllengebirge, Höllkogel |
|
Nebria germari GE | DHK1646 | Germany, Bavaria, Allgäuer Alps, Ifen |
|
Nebria giulianii | SDS06-031B | USA, California, Inyo County, Milner Creek, 2241 m, 37.59480°N, 118.29763°W |
|
Nebria gouleti | DHK0006 | USA, Idaho, Idaho County, Selway River, 7.5 miles SE of Lowell, 475 m, 46.08804°N, 115.50410°W |
|
Nebria gregaria | DHK0017 | USA, Alaska, Aleutian Islands, Chuginadak Island, north shore, 10 m, 52.88447°N, 169.74653°W |
|
Nebria gyllenhali | DHK0010 | Russia, Buryat Republic, Khamar-Daban Mts., Tankhoy, 512 m, 51.53806°N, 105.112049°E |
|
Nebria haida | DHK1300 | Canada, British Columbia, Haida Gwaii, Moresby Island, ridge N of Takakia Lake, 837 m, 52.93787°N, 132.04862°W |
|
Nebria holzunensis | SDS12-033D | Russia, Altai Republic, Holzun Mts., 1981 m, 50.25637°N, 084.59192°E |
|
Nebria hudsonica | DHK0381a | USA, Wyoming, Sublette County, Hoback River, 1956 m, 43.24509°N, 110.48779°W |
|
Nebria ingens | SDS08-025G | USA, California, Inyo County, North Fork Big Pine Creek, 3446 m, 37.11192°N, 118.51174°W |
|
Nebria intermedia OR | DHK0990 | USA, Oregon, Baker County, Elkhorn Range, Anthony Lake, 2182 m, 44.96122°N, 118.23200°W |
|
Nebria intermedia UT | DHK1082 | USA, Utah, Sevier County, 8.2 miles SE of Monroe, 2707 m, 38.55808°N, 112.08167°W |
|
Nebria intermedia WY | DHK0809 | USA, Wyoming, Teton County, Togwotee Pass, 2910 m, 43.75231°N, 110.06836°W |
|
Nebria japonica | DHK1371 | Japan, Honshu, Miyagi Prefecture, Road 12 E of Mt. Zao, 1462 m, |
|
Nebria jeffreyi | DHK0039 | USA, Oregon, Harney County, Steens Mts., Little Blitzen River, 2663 m, 42.69593°N, 118.59060°W |
|
Nebria jockischi | DHK1526 | Switzerland, Valais, Talgletscher Glacier, 2316 m, 46.45237°N, 7.83339°E |
|
Nebria kagmara | DHK2120 | Nepal, Karnali, Dolpo District, Kagmara Lekh below Kagmara La, 4400 m |
|
Nebria kazabi | DHK1795 | Russia, Republic of Tuva, Western Tannu-Ola Range, 2625 m, 50.54529°N, 90.99348°E |
|
Nebria kincaidi | DHK0874 | USA, Washington, Olympic National Park, Grand Pass, 1750 m, 47.86979°N, 123.35916°W |
|
Nebria komarovi | DRM5171 | China [locality unspecified] |
|
Nebria korgonica | DHK1475 | Russia, Altai Krai, Charyshsky District, Altai Mts., Gorelyi, Belok Mt., headwaters of Sentelek River, 1900 m, 51.075°N, 83.583°E |
|
Nebria labontei | DHK0984 | USA, Oregon, Wallowa County, West Fork Wallowa River below Glacier Lake, 2479 m, 45.16528°N, 117.28163°W |
|
Nebria lacustris | DHK0004 | USA, Maryland, Montgomery County, Potomac River at Plummers Island, 17 m, 38.96967°N, 77.18517°W |
|
Nebria cf. laevistriata | DHK0492 | China, Yunnan, Gongshan County, Bingzhongluo Township, 0.9 km N of Chukuai Lake, 4050 m, 27.99075°N, 098.47512°E |
|
Nebria lafresnayei | DHK1946 | Spain, Huesca, Villanua, Sinistro (Gouffre El) |
|
Nebria lamarckensis | SDS06-648F | USA, California, Inyo County, side canyon of Pine Creek, 2350 m, 37.37605°N, 118.68400°W |
|
Nebria lassenensis | DHK0220 | USA, California, Shasta County, Lake Helen, 2485 m, 40.4689°N, 121.5131°W |
|
Nebria laticollis | DHK1529 | France, Haute-Savoie, Vallorcine, NW of Refuge Loriaz, 1962 m, 46.03847°N, 6.90832°E |
|
Nebria lewisi | DHK1378 | Japan, Honshu, Tochigi Prefecture, Fujioka, Watarase-sitch |
|
Nebria ligurica | DHK1889 | France, Hautes Alpes, 5.5 km SE of St. Véran, 2640 m, 44.66354°N, 6.92478°E |
|
Nebria limbigera | DHK2083 | China, Xinjiang, south slope of Wusunshan (= Ketmen) Mts., NNE of Zhaosu, 3080 m, 43.37667°N, 81.23861°E |
|
Nebria lindrothi | DHK0020 | USA, Colorado, Mineral County, Wolf Creek, 2 miles W of Wolf Creek Pass, 3180 m, 37.47989°N, 106.78024°W |
|
Nebria lituyae | DHK0016 | USA, Alaska, Juneau area, Mount Roberts Trail above treeline, 718 m, 58.29450°N, 134.37492°W |
|
Nebria livida | DHK0007 | Russia, Irkutsk Region, Tibielti River at Tunka Valley highway, 664 m, 51.76619°N, 103.24932°E |
|
Nebria lombarda | DHK1400 | Italy, Lombardia, Val di Scalve |
|
Nebria louiseae | DHK1278 | Canada, British Columbia, Haida Gwaii, Talunkwan Island, north shore, 2 m, 57.45150°N, 131.66662°W |
|
Nebria lyelli | DHK0054 | USA, California, Mono County, below Conness Lakes, 3134 m, 37.97600°N, 119.29690°W |
|
Nebria lyubechanskii | SDS13-286A | Russia, Republic of Tuva, Western Tannu-Ola Range, north slope, 2744 m, 50.54470°N, 91.01261°E |
|
Nebria macra | DHK1968 | China, Xizang, Nyainqentanglha Shan, N Yangpachem, Bhuda valley, 5000–5200 m, 30.18222°N, 90.48917°E |
|
Nebria macrogona | DHK1377 | Japan, Honshu, Yamagata Prefecture, Kaminoyama, Sen’nin-sawa, Mts. Zao |
|
Nebria mannerheimii | DHK0026 | USA, Idaho, Idaho County, Salmon River at Riggins, 685 m, 45.32450°N, 116.34933°W |
|
Nebria maroccana | DHK1945 | Morocco, Fèz-Meknès, Ifane, Ain Leuh to Azrou, Ifri Mkhrouga |
|
Nebria martensi | DHK2069 | Nepal, Jaljale Himal, below Paanch Pokhari, 4000–4100 m, 27.49028°N, 87.46111°E | JS |
Nebria meanyi CA | DHK1357 | USA, California, Siskiyou County, north slope of Mt. Shasta at Bolam Creek, 1850 m, 41.47177°N, 122.23174°W |
|
Nebria meanyi WA | DHK0949 | USA, Washington, Mt. Rainier National Park, Van Trump Creek above Christine Falls, 1164 m, 46.78242°N, 121.78021°W |
|
Nebria mellyi | DHK1752 | Russia, Kemerovskaya Oblast, Mustag Mt., 1290 m, 53.02153°N, 87.95143°E |
|
Nebria mentoincisa | DHK2017 | China, Xizang, Gangdise Shan, Kurum Valley NW Lhasa, SW Namba side valley, 4800–5150 m, 29.67528°N, 90.75444°E |
|
Nebria metallica | DHK0915 | USA, Washington, Pierce County, White River at Silver Creek Campground, 802 m, 46.99584°N, 121.53311°W |
|
Nebria modoc | DHK0544 | USA, California, Modoc County, Warner Mts., Thoms Creek, 1925 m, 41.56274°N, 120.27076°W |
|
Nebria morvani | DHK0065 | Nepal, Karnali, Jumla District, 2 km W of Guthichau, 2800 m, 29.20028°N, 82.30139°E |
|
Nebria murzini | DHK0378a | China, Xinjiang, Tian Shan, Usu, 1500 m |
|
Nebria nana | DHK1952 | China, Tibet, S Tanggula Pass, 5000 m, 32.68500°N, 91.87278°E |
|
Nebria navajo | DHK0451a | USA, Arizona, Navajo County, Keet Seel Creek, 1980–2040 m, 36.73423°N, 110.50803°W to 36.75269°N, 110.49601°W |
|
Nebria niitakana | DHK1595 | Taiwan, Taichung City, Heiping District, Xue Shan, Black Forest, 3460 m, 24.39372°N, 121.25114°E |
|
Nebria niohozana | DHK1372 | Japan, Honshu, Gunma Prefecture,Road 466 W of Shirane-san, 1883 m |
|
Nebria nivalis AK | DHK0388a | USA, Alaska, Katmai National Park, Brooks Lake, 23 m, 58.54625°N, 58.54625°W |
|
Nebria nivalis NU | DHK0387a | Canada, Nunavut, Baffin Island, Glasgow Inlet, Kimmirut, 40 m, 62.84728°N, 69.87410°W |
|
Nebria nivalis gr sp | DHK1802 | Russia, Republic of Tuva , Mongun-Taiga, 2490 m, 50.27584°N, 89.93906°E |
|
Nebria nudicollis | DHK1944 | Algeria, Central Djurdjura, Takouatz Guerissene, Tijdja à Tizi N´Kouilal | AF |
Nebria numburica | DHK2075 | Nepal, Solu Khumbu district, S of Dudh Kund, 4400–4600 m, 27.70°N, 86.58333°E |
|
Nebria obliqua CO | DHK0436a | USA, Colorado, La Plata County, Durango, Animas River, 1971 m, 37.25852°N, 107.87664°W |
|
Nebria obliqua UT | DHK1104 | USA, Utah, Iron County, Parowan Creek, 2.0 miles S of Parowan, 1965 m, 37.81081°N, 112.80845°W |
|
Nebria ochotica | DHK0403a | Russia, Kuril Islands, Paramushir, inland from Krasheninnikova Bay, Krasheninnikova River, 50.28517°N, 155.35650°E |
|
Nebria ohdaiensis | DHK1380 | Japan, Honshu Nara Prefecture, Kamikitayama, Mts. Ohdaigahara |
|
Nebria olivieri | DHK2046 | France, Ariège, Forêt des Hares, Etang de Laurenti, 1650–2100 m, 42.68°N, 2.03°E |
|
Nebria oowah | DHK1071 | USA, Utah, Grand County, La Sal Mts., Oowah Lake, 2678 m, 38.50171°N, 109.27390°W |
|
Nebria ovipennis | DHK0019 | USA, California, Tuolumne County, Blue Canyon, 2800 m, 38.315°N, 119.659°W |
|
Nebria oxyptera | DRM5172 | China, Xinjiang Uyghur Autonomous Region, Pishan County, Xiadulla |
|
Nebria pallipes | DHK0011 | USA, Maryland, Montgomery County, Potomac River at Plummers Island, 17 m, 38.96967°N, 77.18517°W |
|
Nebria paradisi OR | DHK1349 | USA, Oregon, Hood River County, Mt. Hood Meadows Ski Area, 1890–2000 m, 45.34272°N, 121.67799°W |
|
Nebria paradisi WA | DHK0929 | USA, Washington, Mt. Rainier National Park, Paradise area, Edith Creek Basin, 1807 m, 46.79678°N, 121.72711°W |
|
Nebria pasquineli | DHK0831 | USA, Colorado, Boulder County, Lefthand Creek, 2420 m, 40.06590°N, 105.45711°W |
|
Nebria pektusanica | SDS12-197E | China, Jilin, northern slope of Changbai Shan, 1901 m, 42.03954°N, 128.05562°E |
|
Nebria perlonga | DHK0029 | China, Xinjiang, Tian Shan, Usu, 1500 m |
|
Nebria pertinax | DHK2119 | Nepal, Mahakali/Darchula near Rapla, Shipu Lekh, 4300 m | JS |
Nebria picea | DHK1649 | Switzerland, St. Gallen, Säntis-Lisengrat |
|
Nebria picicornis | DHK1876 | France, Hautes Alpes, Aiguilles, Le Guil Torrent, 1454 m, 44.77790°N, 6.85961°E |
|
Nebria piperi | DHK0965 | USA, Washington, Mt. Rainier National Park, Nisqually River, W of Longmire, 774 m, 46.73469°N, 121.83055°W |
|
Nebria piute | DHK1098 | USA, Utah, Beaver County, North Fork Three Creeks, 3044 m, 38.32708°N, 112.37001°W |
|
Nebria praedicta | SDS08-423b | USA, California, Trinity County, Thompson Peak, upper Grizzly Lake Basin, 2411 m, 41.00458°N, 123.04799°W |
|
Nebria prezwalskii | DHK1950 | China, Qinghai, S of Mt. Maqen Gangri, 4360 m, 34.55028°N, 98.14667°E |
|
Nebria psammodes | DHK1908 | France, Vaucluse, Toulourenc River at Brantes, 473 m, 44.19050°N, 5.33387°E |
|
Nebria pseudorestias | DHK2081 | Nepal, Taplejung distr., S of Kangchenjunga Himal, Timbu(wa) Pokhari, 4350–4500 m, 27.43°N, 88.05°E |
|
Nebria purpurata CO | DHK0843 | USA, Colorado, Summit County, Quandary Peak, 3763 m, 39.39159°N, 106.11371°W |
|
Nebria purpurata NM | DHK1034 | USA, New Mexico, Taos County, Red River at Junebug Campground, 2620 m, 36.70716°N, 105.43314°W |
|
Nebria quileute | DHK0456a | USA, Washington, Olympic National Park, Boulder Creek, 47.97607°N, 123.69291°W |
|
Nebria rathvoni | DHK0734 | USA, California, Tuolumne County, Deadman Creek, 2667 m, 38.31763°N, 119.66534°W |
|
Nebria retingensis | DHK2070 | China, Xizang, Gangdise Shan, side valley S of Reting, 4500–4800 m, 30.26583°N, 91.53444°E |
|
Nebria riversi | SDS08-377G | USA, California, Mono County, lake due S of Donohue Pass, 3377 m, 37.75289°N, 119.24847°W |
|
Nebria roborowskii | DHK1955 | China, Qinghai, pass Bayankala, 4700–4800 m, 34.12694°N, 97.65722°E |
|
Nebria roddi | SDS13-086A | Russia, Altai Republic, north slope Krasnaya Mt., 2013 m, 50.07248°N, 085.22120°E |
|
Nebria rubripes | DHK1871 | France, Cantal, Le Lioran, 1212 m, 45.07996°N, 2.74542°E |
|
Nebria rubrofemorata | DHK1464 | Russia, Altai Krai, Altai Mts., watershed of Belogolosov Korgon and Inya Rivers, 2000–2250 m, 50.95°N, 83.645°E |
|
Nebria saeviens | DHK1376 | Japan, Honshu, Niigata Prefecture, Road 403 NE of Nozawaonsen, 841 m |
|
Nebria sahlbergii | DHK0968 | USA, Washington, Mt. Rainier National Park, Nisqually River, W of Longmire, 774 m, 46.73469°N, 121.83055°W |
|
Nebria sajanica | DHK0401b | Russia, Buryat Republic, Tunka Mts., Kingarga River, 1852 m, 51.98045°N, 102.37566°E |
|
Nebria sajanica gr sp 1 | DHK1452 | Russia, Republic of Tuva, Western Sayan Mts., near Kozhagar Mt., 2250–2450 m, 51.54°N, 89.17°E |
|
Nebria sajanica gr sp 1 | DHK1453 | Russia, Republic of Tuva, Western Sayan Mts., near Kozhagar Mt., 2250–2450 m, 51.54°N, 89.17°E |
|
Nebria sajanica gr sp 2 | DHK1783 | Russia, Krasnoyarsky Krai, Western Sayan Mts., Oiskiji Pass, 1385 m, 52.87277°N, 93.25745°E |
|
Nebria sarlyk | DHK1735 | Russia, Altai Republic, Sarlyk Mt., 2040 m, 51.061050°N, 85.690640°E |
|
Nebria sayana | SDS13-205A | Russia, Republic of Khakassia, Samblyl Mt., headwaters of Karasibo River, 1890 m, 52.15164°N, 090.18011°E |
|
Nebria schwarzi | DHK0427 | Canada, Alberta, Cline River at Highway 11, 1325 m, 52.16983°N, 116.48304°W |
|
Nebria sevieri | DHK1111 | USA, Utah, Iron County, Parowan Creek, 12.5 miles S of Parowan, 2785 m, 37.71458°N, 112.84760°W |
|
Nebria shiretokoana | SDS12-263A | Japan, Hokkaido, Shiretoko Peninsula, Rausu-daira, 1234 m, 44.07454°N, 145.13095°E |
|
Nebria sierrablancae | DHK0431a | USA, New Mexico, Lincoln County, Sierra Blanca Ski Area, 3000 m, 33.39998°N, 105.78932°W |
|
Nebria sierrae | DHK0052 | USA, California, Mono County, below Conness Lakes, 3134 m, 37.97600°N, 119.29690°W |
|
Nebria siskiyouensis | DHK0423a | USA, California, Trinity County, Big Flat Campground, 1490 m, 41.06465°N, 122.93493°W |
|
Nebria sitnikovi | SDS12-131A | Russia, Altai Republic, Bashchelakskii Mts., 2012 m, 51.24219°N, 84.20432°E |
|
Nebria snowi | DHK0460a | Russia, Kuril Islands, Ushishir Archipelago, Yankicha Island, inland from Kraternaya Bay, 20 m, 47.50867°N, 152.81950°E |
|
Nebria sonorae | DHK0785 | USA, California, Tuolumne County, Blue Canyon Creek, 2822 m, 38.31068°N, 119.66147°W |
|
Nebria sp GAN | DHK2068 | China Gansu, Lianhuashan, Shaltan, 2850 m |
|
Nebria sp MG 1 | DHK1138 | Mongolia, Bayankhongor Province, northern slope of Ikh Bogd Uul, 1730 m, 44.979°N, 100.638°E |
|
Nebria sp MG 2 | DHK1139a | Mongolia, Ömnögovi Province, Gobi Gurvanshaikhan National Park, Yolyn Am, 2285 m, 43.496°N, 104.089°E |
|
Nebria sp XIZ 14 | DHK0684 | China, Xizang, Mainling, Paiqu, W of Doxong Pass, 4060 m, 29.48978°N, 094.93735°E |
|
Nebria sp XIZ 16 | DHK0679 | China, Xizang, Bomi Zhamo, Garlungla, 3975 m, 29.76340°N, 95.70164°E |
|
Nebria sp XIZ 17 | DHK0681 | China, Xizang, Bomi Zhamo, Garlungla, 3975 m, 29.76340°N, 95.70164°E |
|
Nebria sp XIZ 20 | DHK2008 | China, Xizang, Transhimalaya, south slope Lungmari Mts., 4900–5300 m, 30.45°N, 86.50°E |
|
Nebria sp XIZ 5 | DHK0682 | China, Xizang, Medog, Baibung, E of Doxong Pass, 4074 m, 29.49009°N, 94.95566°E |
|
Nebria sp YUN 1 | DHK0013 | China, Yunnan, Tengchong County, Wuhe Township, Xiaodifang village, 2150 m, 24.43300°N, 098.75000°E |
|
Nebria sp YUN 4 | DHK0489a | China, Yunnan, Gongshan County, Bingzhongluo Township, 0.8 km N of Chukuai Lake, 3950 m, 27.98817°N, 098.47436°E |
|
Nebria sp YUN 6 | DHK0003 | China, Yunnan, Longling Couty, Zhen’an Township, Bangbie village, 1540 m, 24.81306°N, 098.81667°E |
|
Nebria sp YUN 9 | DHK0087 | China, Yunnan, Gongshan County, Cikai, Nu Jiang at Dashaba, 1443 m, 27.73606°N, 98.67113°E |
|
Nebria sp YUN 10-dark | DHK0024 | China, Yunnan, Tengchong County, Jietou Township, Yongangiao, 1500 m, 25.32556°N, 98.60000°E |
|
Nebria sp YUN 10-pale | DHK0366b | China, Yunnan, Tengchong County, 2 km E of Qushi, 25.23944°N, 098.61667°E |
|
Nebria sp YUN 11 | DHK0086 | China, Yunnan, Gongshan County, 0.6 km N of Dizhengdang, Dulong, 1898 m, 28.08680°N, 98.32835°E |
|
Nebria sp YUN 13 | DHK0483a | China, Yunnan, Gongshan County, Cikai Township, 0.1 km SE of Heipu Yakou, 3720 m, 27.76978°N, 098.44681°E |
|
Nebria sp YUN 18 | DHK0651 | China, Yunnan, Lijiang County, Laojunshan, 3659 m, 26.64237°N, 99.74392°E |
|
Nebria spatulata | SDS06-227B | USA, California, Fresno County, Sphinx Lakes, upper lake below Sphinx Crest, 3385 m, 36.71427°N, 118.51487°W |
|
Nebria splendida | DHK2085 | China, Xinjiang, W of Boro-Horo Mts., Mynmaral Mts., 1880 m, 44.10083°N, 82.19889°E |
|
Nebria steensensis | DHK0042 | USA, Oregon, Harney County, Steens Mts., Little Blitzen River, 2663 m, 42.69593°N, 118.59060°W |
|
Nebria subdilatata | DHK0012 | Russia, Buryat Republic, Khamar-Daban Mts., Tankhoy, 503 m, 51.53636°N, 105.10694°E |
|
Nebria cf. superna | DHK1979 | China, Xizang, Transhimalaya, pass Gyatso La S of Lhatse, 5200–5300 m, 28.95278°N, 87.43750°E |
|
Nebria suturalis AB | DHK0435 | Canada, Alberta, toe of Athabasca Glacier, 2047 m, 52.20819°N, 117.23597°W |
|
Nebria suturalis CO | DHK0837 | USA, Colorado, Clear Creek County, Mt. Evans, 4312 m, 39.58790°N, 105.64229°W |
|
Nebria suturalis NH | DHK1151 | USA, New Hampshire, Coos County, Mt. Washington, 1886 m, 44.26909°N, 71.30353°W |
|
Nebria sylvatica | DHK0415a | USA, Washington, Olympic National Park, Boulder Creek, 655 m, 47.97607°N, 123.69291°W |
|
Nebria tekesensis | DHK2084 | China, Xinjiang, Narat Mts., W of Sarytur Pass, 3280 m, 42.90417°N, 82.62139°E |
|
Nebria teletskiana | SDS12-153C | Russia, Altai Republic, Simultinskii Mts., Yambash Mt., 2006 m, 51.36033°N, 087.13060°E |
|
Nebria tibialis | DHK1395 | Italy, Tuscany, Vallombrosa, 43.733°N, 11.557°E |
|
Nebria triad | DHK0471a | USA, California, Trinity County, South Fork Salmon River at Big Flat Campground, 1500 m, 41.06465°N, 122.93493°W |
|
Nebria trifaria | DHK0434a | USA, Utah, Utah County, South Fork American Fork River, 2207 m, 40.43519°N, 111.63603°W |
|
Nebria turcica | DHK1947 | Turkey, Erzincan, Sipikor Gecidi, 2433 m, 39.88472°N, 39.56507°E |
|
Nebria turmaduodecima | SDS08-424a | USA, California, Trinity County, Thompson Peak, upper Grizzly Lake Basin, 2411 m, 41.00458°N, 123.04799°W |
|
Nebria uenoiana | DHK1588 | Taiwan, Chiayi County, AlishanTownship, Laonong River, 3020 m, 23.40131°N, 121.93831°E |
|
Nebria utahensis | DHK1075 | USA, Utah, Garfield County, Henry Mountains, Lonesome Beaver, 2510 m, 38.10945°N, 110.77838°W |
|
Nebria vandykei | DHK0932 | USA, Washington, Mt. Rainier National Park, Paradise area, Edith Creek Basin, 1807 m, 46.79678°N, 121.72711°W |
|
Nebria wallowae | DHK0980 | USA, Oregon, Wallowa County, West Fork Wallowa River below Glacier Lake, 2479 m, 45.16528°N, 117.28163°W |
|
Nebria walteriana | DHK1959 | China, Xizang, NE of pass Shogu La, 5000–5350 m, 29.91333°N, 90.14111°E to 29.95556°N, 90.13028°E |
|
Nebria wyeast | DHK0418b | USA, Oregon, Clackamas County, Mt. Hood, Timberline Lodge, 1876 m, 45.33539°N, 121.70849°W |
|
Nebria yuae | DHK0603 | China, Sichuan, Luding County, Gongga Shan, 3753 m, 29.58493°N, 102.02437°E |
|
Nebria yunnana | DHK0377a | China, Yunnan, Zhanyi Co., Huashan Reservoir, 2000 m, 25.75°N, 103.61°E |
|
Nebria zioni | DHK1108 | USA, Utah, Iron County, Parowan Creek, 12.5 miles S of Parowan, 2785 m, 37.71458°N, 112.84760°W |
|
Nippononebria altisierrae | DHK1547 | USA, California, Alpine County, Carson Pass, 2616 m, 38.69377°N, 119.98749°W |
|
Nippononebria campbelli | SDS13-388A | USA, Washington, Mt. Rainier National Park, Edith Creek Falls, 1613 m, 46.79051°N, 121.73016°W |
|
Nippononebria chalceola | SDS14-629 | Japan, Honshu, Fukui Prefecture, Ikeda Town, Mt. Heko, 1300 m |
|
Nippononebria changbaiensis | SDS12-199a | China, Jilin, northern slope of Changbai Shan, 1901 m, 42.03954°N, 128.05562°E |
|
Nippononebria virescens | DHK0348 | USA, Oregon, Benton County, 0.3–0.5 miles W of Alsea Falls, 346 m, 44.32065°N, 123.50012°W |
|
Notiophilus borealis | DHK0273b | USA, Alaska, Denali National Park, Wonder Lake, 731 m, 63.46222°N, 150.83167°W |
|
Notiophilus semistriatus | DHK1335 | USA, Idaho, Shoshone County, near Hobo Cedar Grove, 1425 m, 47.08477°N, 116.11538°W |
|
Notiophilus sierranus | DHK1490 | USA, California, El Dorado County, Blodgett Experimental Forest, 1300 m, 38.90958°N, 120.66123°W |
|
Notiophilus sylvaticus | DHK1292 | Canada, British Columbia, Haida Gwaii, Graham Island, Chinukundl Creek, 7 m, 53.32412°N, 131.95519°W |
|
Opisthius richardsoni | DHK0885 | USA, Washington, Whatcom County, Nooksack River at Cedarville, 45 m, 48.84072°N, 122.29334°W |
|
Paropisthius chinensis | DHK0612 | China, Sichuan, Luding County, Gongga Shan, 3045 m, 29.57393°N, 101.99204°E |
|
Paropisthius davidis | DHK0645 | China, Yunnan, Lijiang County, Laojunshan, 3502 m, 26.64210°N, 99.76745°E |
|
Paropisthius indicus | DHK0329a | China, Yunnan, Cikae Township, Dabadi,3022 m, 27.79655°N, 98.50562°E |
|
Paropisthius masuzoi | DHK1583 | Taiwan, Nantou County, Ren’ai Township, Hehuanshan, 3090 m, 24.14367°N, 121.28075°E |
|
Pelophila borealis AK | DHK0334b | USA, Alaska, Kodiak Island, Buskin River, 20 m, 57.76541°N, 152.52016°W |
|
Pelophila borealis RFE | DHK2064 | Russia, Kamtschatka, os. Asabatsch’e and river Kamtschatka, 56.22278°N, 162.01917°E |
|
Pelophila rudis | DRM2376 | USA, Alaska, Fairbanks, east shore of Smith Lake, 150 m, 64.8622°N, 147.8616°W |
|
outgroup specimens | |||
Bembidion antiquum | DRM1963 | USA, Missouri, Carter County, Current River at Van Buren, 135 m, 36.99037°N, 91.01672°W |
|
Calosoma scrutator | DHK1712 | USA, Oklahoma, Sequoyah County, Sallisaw, 245 m, 35.53371°N, 94.62467°W |
|
Calosoma scrutator | DRM2249 | USA, Arizona, Santa Cruz County, Pena Blanca, 31.3852°N, 111.0931°W |
|
Loricera pilicornis | DHK1185 | Canada, Newfoundland, Deer Lake, north shore, 5 m, 49.18058°N, 57.45150°W |
|
Metrius contractus | DHK1424 | USA, California, Mendocino County, Angelo Reserve, Skunk Creek, 420 m, 39.72554°N, 123.64412°W |
|
Pterostichus melanarius | DRM2311 | USA, Wisconsin, Dane County, Madison, 43.086°N, 89.425°W |
|
Scaphinotus petersi | DRM0878 | USA, Arizona, Pima County, Mt. Lemmon Ski Valley, 2500 m, 32.447°N, 110.777°W |
|
Trachypachus inermis | DHK0738a | USA, California, Tuolumne County, Sonora Pass, 2920 m, 38.32961°N, 119.63857°W |
|
Trachypachus slevini | DHK0513a | USA, Oregon, Lincoln County, Moolack Beach, 8 m, 44.71078°N, 124.06035°W |
|
We obtained sequence data for more than 97% of those possible for the eight gene fragments for our taxon sample using the protocols and primers listed below.
PCR thermal cycling conditions for recommended protocols. The Pattern column indicates cycling pattern. “S”, for standard reaction pattern, included a starting phase of 2 or 3 minutes at 94 °C, followed by the cycling phase, with each cycle consisting of 20–30 seconds of denaturing at 94 °C, 20–30 seconds of annealing at the annealing temperature, and an extension phase at the temperature specified by the Taq manufacturer. “T”, for touchdown reaction, is like the standard reaction but with three cycling phases, each with a separate annealing temperature. The Cycles column lists the usual number of cycles, with all variant numbers used successfully to generate at least one sequence given in parentheses. For touchdown reactions, the numbers are given for each cycling phase, separated by commas. The Ta column lists the usual annealing temperature in °C (with less used but successful temperatures in parentheses). For touchdown reactions, the annealing temperatures are given for each cycling phase, separated by commas. The Ext column lists the duration of the extension phase in seconds, with less used but successful durations in parentheses. The Gene column lists the gene(s) successfully amplified with each set of conditions. Subscripts “ex” and “in” refer to conditions used for outer and inner nested (or hemi-nested reactions), respectively.
# | Pattern | Cycles | Ta | Ext | Gene |
---|---|---|---|---|---|
C1 | S | 35 (36) | 52 (45, 50) | 70 | 28S, 16S-ND1, COI BC, COI PJ |
C2 | S | 37 | 52 | 120 | wg ex |
C3 | S | 35 (37) | 54 | 150 | wg in |
C4 | T | 6 (5), 6(5), 36 (35) | 57, 52, 45 | 90 (60, 120, 180, 300, 330) | CAD, Topo |
C5 | T | 6, 6, 36 | 60, 55, 50 | 120 (60, 90, 210, 300) | PEPCK ex |
C6 | S | 35 | 60 | 90 (300) | PEPCK in |
PCR primers used for both amplification and sequencing. The Dir column identifies forward (F) and reverse (R) primers and indicates external (ex) and internal (in) primers used for nested or hemi-nested PCR. The Ref column lists the reference for the original description of the primer: (1)
Gene | Primer | Dir | Sequence | Ref |
---|---|---|---|---|
28S | LS58 | F | GGGAGGAAAAGAAACTAAC | 4 |
NLF184/21 | F | ACCCGCTGAAYTTAAGCATAT | 6 | |
LS998 | R | GCATAGTTCACCATCTTTC | 4 | |
LS1041 | R | TACGGACRTCCATCAGGGTTTCCCCTGACTTC | 1 | |
16S-ND1 | 16SAR | F | CGCCTGTTTAACAAAAACAT | 7 |
ND1A | R | GGTCCCTTACGAATTTGAATATATCCT | 5 | |
CO1 PJ | Jer | F | CAACATTTATTTTGATTTTTTGG | 5 |
Pat | R | TCCAATGCACTAATCTGCCATATTA | 5 | |
CO1 BC | LCO1490 | F | GGTCAACAAATCATAAAGATATTGG | 1 |
HCO2198 | R | TAAACTTCAGGGTGACCAAAAAATCA | 1 | |
wg | wg550F | Fex | ATGCGTCAGGARTGYAARTGYCAYGGYATGTC | 9 |
wg578F | Fin | TGCACNGTGAARACYTGCTGGATG | 8 | |
wgAbR | Rin | YTCGCAGCACCARTGGAA | 9 | |
wgAbRZ | Rex | CACTTNACYTCRCARCACCARTG | 8 | |
CAD2 | CD398F | F | GARCAYACAGCNGGNCCNCAAGA | 3 |
CD581F4 | F | GGWGGWCAAACTGCWYTMAAYTGYGG | 1 | |
CD696R | R | AANGGRTCNACRTTTTCCATATT | 2 | |
PEPCK | PK282 | Fex | GAAGGATGGCTBGCNGARCAYATG | 9 |
PK330F | Fin | GAGGACCAAGCNGAYACNGTDGGTTGTTG | 9 | |
PK485R | R | GCAGCVGTNGCYTCRCTYCTCAT | 9 | |
Topo | TP643F | F | GACGATTGGAARTCNAARGARATG | 9 |
TP675F | F | GAGGACCAAGCNGAYACNGTDGGTTGTTG | 9 | |
TP932R | R | GGWCCDGCATCDATDGCCCA | 9 |
Tables S1–S3
Data type: clades data
Explanation note: Table S1. Unique bases supporting clades. Table S2. Unique amino acids supporting clades. Table S3. Unique insertions and deletions supporting clades.
Figures S1–S13
Data type: phylogenetic data
Explanation note: Figure S1. Majority rule consensus tree of 150,000 trees from Bayesian analysis of eight-gene concatenated matrix. Figure S2. Maximum likelihood trees for concatenated matrix of all nuclear genes. Figure S3. Maximum likelihood trees for concatenated matrix of all nuclear protein-coding genes. Figure S4. Maximum likelihood trees for concatenated matrix of all mitochondrial genes. Figure S5. Maximum likelihood trees for 28S. Figure S6. Maximum likelihood trees for 16S-ND1. Figure S7. Maximum likelihood trees for the COI BC. Figure S8. Maximum likelihood trees for the COI PJ. Figure S9. Maximum likelihood trees for the CAD2. Figure S10. Maximum likelihood trees for the PEPCK. Figure S11. Maximum likelihood trees for the Topo. Figure S12. Maximum likelihood trees for the wg. Figure S13. Maximum likelihood tree for concatenated matrix showing only those taxa for which PEPCK was sequenced, with branches colored according to the squared-change parsimony reconstruction of the length of the PEPCK intron.