Homoptera mima Harvey, by subsequent designation by Nye 1975.

Heteranassa Smith, 1899: 105; Smith et al. 1903: 5; Barnes et al. 1917: 86; McDunnough 1938: 121; Kimball 1965: 130; Nye 1975: 239; Franclemont and Todd 1983; Poole 1989; Poole and Gentili 1996; Mustelin 2006: 7; Lafontaine and Schmidt 2010: 37; Zahiri et al. 2012: 118.

Heteranassa mima is now the only valid species in the genus. The genus and species can be distinguished from similar genera by the absence of spine–like setae on the mesothoracic tibia (Fig. 2) (Smith 1899). The male genitalia (Figs 3, 4) serve to distinguish Heteranassa from other genera of Erebinae in the southwestern United States by the presence of a setose, membranous costal region of valves (Fig. 3) (Franclemont 1986), and a “D” shaped, sclerotized saccular process connecting to the saccular region of the valves (Fig. 3). The female genitalia (Fig. 5) does not differ dramatically from other Omopterini. Male antennae fasciculate (Fig. 6), female antennae filiform. The proboscis (Fig. 7) is well-developed.

Figure 2. 

Middle leg of Heteranassa mima, showing middle tibia with spines absent.

Figure 3. 

Valves, Heteranassa mima, ventral view.

Figure 4. 

Aedeagus with vesica everted, showing diverticula.

Figure 5. 

Female genitalia of Heteranassa mima.

Figure 6. 

Fasciculate antenna of male Heteranassa mima.

Figure 7. 

SEM of Heteranassa mima proboscis, showing sensilla styloconica.

Specimens of Eubolina impartialis Harvey, Matigramma species, Acritogramma metaleuca (Hampson), Toxonprucha species and Coxina species are frequently misidentified as Heteranassa. Of these, A. metaleuca is the most similar to Heteranassa (Franclemont 1986). Acritogramma metaleuca can be most easily distinguished by the presence of spine-like setae on the mesothoracic tibia, and there are also subtle differences in wing pattern (Franclemont 1986). Acritogramma metaleuca has no brown lines or shading on the forewing, and the discal spot is distinctly lunulate. Eubolina impartialis is similar to both Heteranassa and A. metaleuca but has a brownish ground color on the hindwings, instead of grayish white, and spine-like setae on the mesothoracic tibia. From southern Texas into Mexico, Heteranassa may be confused with co–occurring Coxina species. This genus shows affinities to Heteranassa in forewing pattern and genitalia, but a lighter hindwing ground color serves to separate Heteranassa. Additionally, similarities in wing pattern and genital morphology suggest a relationship to the Caribbean and South American genus Elousa Walker. The ranges of Heteranassa and Elousa may overlap in southern Mexico. Elousa can be separated from Heteranassa by its smaller size, and the light gray to white mottling of the forewings. Toxonprucha species are generally smaller than Heteranassa, and they possess hindwings with a darker ground color and more distinct patterning than those of Heteranassa. A key to Heteranassa and similar species is provided below.

Harvey (1876) described Homoptera mima from a single female from Texas, listing Belfrage as the source of the specimen. He referred the species to the genus Homoptera Guenée, but did not mention any characters used to determine generic placement. Grote (1882), in a checklist, moved H. mima to the genus Eubolina Harvey, 1875, again without any mention of characters used. Smith (1899) described H. fraterna and H. minor and placed these species in the genus Campometra Guenée, 1852. Campometra fraterna was described from a series of six lightly–marked specimens collected in Death Valley, California., and a single specimen from Catalina Springs, Arizona. Campometra minor was described from a series of five small female specimens collected in Arizona. Smith described these two species as new based on differences in size, coloration, and patterning. Smith (1899) proposed the genus Heteranassa to circumscribe H. mima, H. fraterna, and H. minor based on the absence of spine–like setae on the mesothoracic tibia in these three species. Smith (1899) wrote, “I prefer leaving them with Campometra temporarily, until all of the allied genera can be carefully studied, but suggest the term Heternassa in case generic separation seems desirable.” These three species were formally referred to Heteranassa by Smith et al. (1903). Todd (1982) reviewed Smith’s type series and designated lectotypes for H. minor and H. fraterna. The pupa of Heteranassa was first described by Comstock (1955), and Crumb (1956) gave a description of the larva of Heteranassa.

In his study of southern California Noctuoidea, Mustelin (2006) determined H. minor to be a synonym of H. fraterna. He found no differences in genital morphology between the types of H. fraterna and H. minor (Mustelin 2006). Mustelin (2006) did not examine the type specimen of H. mima, located in the Natural History Museum, London.

Adult male (Fig. 8): Head: front smooth scaled, vertex scales erect, elongate; labial palpi elongate, erect, three segments; area of frons behind labial palpi unscaled with domed center; antennae (Fig. 6) fasciculate, smooth scaled, conspicuous sensory setae on ventral surface; eyes smooth; proboscis well developed, coiled between labial palpi (Fig. 7). Thorax: smooth scaled dorsum; ventrally lighter; thick tuft of hairs arising below base of forewing. Legs: smooth scaled; prothoracic tibia with spatulate epiphysis, flattened hairs on ventral surface; mesothoracic tibia with thick tuft of scales, expanded distally, pair of spurs at distal end, spine-like setae absent; metathoracic tibia with pair of spurs mesially and at distal end; tarsi with three rows of spine-like setae. Forewing: 9.7–14.9 mm; antemedial line pointed apically on anal vein; medial line black, pointed mesially on radial, cubital, and anal veins; postmedial line black, outlining apical half of discal area; subterminal line brown, jagged, bordering lighter colored terminal area; terminal line scalloped outwardly at termini of veins, apical margin traced in lighter coloration; fringe scalloped apically at termini of veins; reniform spot markings range from white spot (Fig. 9), to thin white vertical dash (Fig. 10), to a barely visible dash (Figs 8, 11), or black (Fig. 12). Hind wing: ground color gray-white, darker shading distally; terminal line black, scalloped apically at termini of veins; fringe light gray, with dark shading between termini of M₃ and CuA₂ and between termini of 2A and 3A. Abdomen: segments 1 through 4 tufted dorsally. Genitalia (Figs 3, 4): Tegumen slightly excurved dorsally, lateral processes at distal end of each arm, process dorsally at distal end; uncus sparsely setose, curved, pointed; tuba analis membranous; scaphium sclerotized, tuba analis opening apically; juxta lightly sclerotized, excurved ventrally; transtilla membranous; vinculum U-shaped, mesial margin heavily sclerotized towards articulation with tegumen, widened in middle; valves conjoined basally, sclerotized basally, membranous distally; sacculus sclerotized; saccular process extended dorsally connected to membranous costal region; sclerotized part of valve with finger–like extension half distance from base; base of costa with a looped sclerite, connected to saccular process; aedeagus curved, narrowed apically, rounded anteriorly, dorsally sclerotized, ventrally membranous, dorsal surfaces undulating apically, apex pointed; ductus seminalis on ventral side; vesica membranous, without setae or cornuti, not elongated,four diverticula: one subbasal, two medial, and one apical. Adult Female: (Figs 7–10, 12) forewing length 11.0–16.7 mm. Exterior similar to male, except antennae filiform, mesothoracic tibiae not expanded distally. Genitalia: (Fig. 5) papilla analis membranous, rounded apically, setae stout, variable length; posterior apophysis extending just beyond anterior margin of 8^th abdominal segment, apically curved inwards; anterior apophysis ca. 0.5 × length of posterior apophysis, paddle-shaped apex; anal tube: interior lining of anal tube with many rows of minute spines directed anteriorly on dorsal wall, ventral wall densely covered with shark-tooth-like tubercles; intersegmental membrane with many shark-tooth-like tubercles; 8th abdominal segment ringed with stout setae caudally; ostium bursae lightly sclerotized; antrum circular, membranous; ductus bursae reduced, membranous; corpus bursae elongate, membranous.

Figure 8. 

Male Heteranassa mima, showing complete FW maculation. Cuatrocienagas, Coahuila, Mexico, June.

Figure 9. 

FW with dark ground color, white reniform spot, AM, medial, and PM lines very faint. Female Heteranassa mima, Inyo Co. CA, February.

Figure 10. 

Thin, white dash in reniform, AM, medial lines visible, PM line extremely faint. Female Heteranassa mima, Maricopa Co. Arizona, March.

Figure 11. 

Thin, white reniform dash barely visible, PM line faint, AM, medial lines barely visible. Female Heteranassa mima, San Bernadino Co., California, April.

Figure 12. 

Tan FW ground color, AM, medial, PM lines absent. Female Heteranassa mima, Inyo Co., CA, February.

Eggs. Dark bluish gray, ~1/2 mm diameter; captured females laid eggs singly or in groups of less than five in crevices of host plant bark, or singly on sides of enclosing container.

Larvae. Variable in color; eggs developed into adults within five weeks; observations are consistent with Comstock (1955) and Crumb (1956). Larvae pupated before high-quality photographs could be taken.

This is the only species in the genus and can be diagnosed with the generic combination (see above).

Heteranassa mima (Harvey, 1875). Holotype, (Fig. 13) ♀ in the Natural History Museum, London(BMNH) labeled: “Homoptera mima, type, Harvey, Holotype, 15/9, 73.” The specimen and associated labels were examined through high-resolution photographs provided by the BMNH. Type locality: Texas [USA]

Figure 13. 

Holotype of Heteranassa mima, Texas.

Heteranassa fraterna (Smith, 1899). Lectotype (Fig. 14) ♀ in USNM, designated by Todd (1982), labeled: “Death Valley, April ‘91 K., 677, 115 [circled], ♀ genitalia on slide, Sept. 21, 1938, J.F.G.C. #2035, Type No. 4313 U.S.N.M., Lectotype, Campometra fraterna, Smith, Genitalia slide U.S.N.M. 40478, Campometra fraterna, ♀ Cotype, Smith” Type locality: Death Valley [California, USA]

Figure 14. 

Lectotype of Heteranassa fraterna, Death Valley, California.

Heteranassa minor (Smith, 1899). Lectotype, (Fig. 15) ♀ in USNM labeled: “Campometra minor, ♀ type, Smith, Lectotype, Campometra minor, Smith, ♀ genitalia on slide, Sept. 21, 1938, J.F.G.C. #2035, Genitalia slide, U.S.N.M. 40477, Type No. 4314 U.S.N.M., U.S.N.M. Acc. no. 35005, Ariz., Collection G.D. Hulst.” Type locality: Arizona [USA]

Figure 15. 

Lectotype of Heteranassa minor, Arizona.

Adult male (Fig. 8): Head: scaling dark gray to gray-brown to tan; alternating uneven banding of white to light brown scales, and dark-brown scales, labial palpus concolorous with head and body, antenna scaling: each segment alternating light gray and dark brown. Thorax: dorsum dark gray to gray brown to tan; venter lighter grayish brown. Legs: dorsally concolorous with thorax, ventrally light gray with darker scales, tarsi alternating white and dark brown; tarsal segments alternating dark–brown to white scaling. Forewing: length as for genus description, basal line black; band of darker color runs vertically, adjacent to antemedial line, terminating where antemedia line points apically; area between medial and postmedial lines shaded darker, excluding reniform area; crenulations on margin of forewing with gray-white punctations. Hind wing: shaded gray brown from medial area distally; postmedial line complete, or faintly visible distally; subterminal line darker gray brown, outlined with light coloration distally. Abdomen: dorsum dark gray to gray brown to tan, laterally gray; venter gray, dusted with darker scales. Genitalia (Figs 3, 4) (24 dissections): Lateral processes at distal end of tegumen arms wavy; process at dorsal end fin shaped, very weakly sclerotized; ventral membrane on distal end weakly sclerotized; juxta with numerous short, pointed tubercles mesially, narrowed caudally; transtilla attached to costal parts of valve processes; vinculum with flared, fin-like processes directed anteriorly; sclerotized saccular process looping, connecting to costal region, “D” shaped; base of costa thumblike, connected to transtilla; aedeagus with dorsal surface undulating apically; vesical with five diverticula. Adult Female (Figs 9–15): forewing length as in genus description. Similar to male, except antennae filiform. Genitalia (Fig. 5) (12 dissections): Postvaginal plate narrowed anteriorly, densely covered in shark-tooth-like tubercles, caudal 7/8^th outlined in stout setae; sterigma with sclerotized ridges laterally.

Specimens tend to be larger in the eastern part of the range in Texas, and smaller specimens are more common in Arizona and California. Forewing coloration ranges from dark gray with some brown dusting to tan. Maculation ranges from well–defined antemedial, postmedial, and subcostal lines to lightly marked specimens with only the subcostal line well defined. Lightly marked specimens are found most commonly in the Mojave Desert. Ground color of hind wings is lighter towards the western range of the species. Specimens from the eastern part of the range show distinctly marked discal spots and shading on the margins on ventral surface of the wings, and the undersides are more heavily dusted with darker scales. The size of the white patch in the reniform area varies from a narrow dash to a large spot, while forewing ground color ranged from dark gray to gray brown among moths reared from the same female collected in Southeast Arizona.

Barcode variation in Heteranassa is very conservative. Examination of more than 160 full-sequence (658 base-pair) barcodes from California, Arizona, New Mexico, Texas, and northern Mexico showed a maximum divergence of less than 0.8%. One haplotype^* dominated the sample, representing more than half of the specimens; the other barcodes included 36 haplotypes that had no more than two base-pair differences from each other. One haplotype, restricted to central and southern Texas, departed from this pattern in being 0.8% different from those from farther west. This is most probably the haplotype that should be associated with the name Heteranassa mima, it being described from this part of Texas. However, this “eastern” haplotype is found with “western” haplotypes in central Texas and there is no indication in genital structural characters, or wing color or pattern, that Heteranassa includes more than a single species. The barcodes of Heteranassa are so divergent that they give no indication of a close relationship to any other erebid genus, other than belonging in the subfamily Erebinae, tribe Omopterini. Heteranassa specimens from Texas and Mexico are frequently confused with some species associated with the genus Coxina Guenée, which can have a similar superficial pattern, but the barcodes are more than 10% different and the two genera do not appear to be closely related. (D. Lafontaine pers. comm.).

^*CNCNoctuoidea13382 [Baboquivari Mts., Pima Co., Arizona, USA]

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGTTTATTAATTCGTGCTGAATTAGGAAACCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTCCCCTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTCTGATTATTACCCCCATCTTTAACTCTTTTAATCTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAACATTGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTCTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACTATTATCAATATACGATTAAATAGATTAATATTTGACCAAATACCTTTATTTGTTTGAGCTGTTGGTATTACTGCTTTTTTACTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTCTTAACAGATCGAAATTTAAATACTTCCTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTACCAACATCTATTT

Warm, arid habitats from California to Texas, northward to Oklahoma, and south as far as Oaxaca, Mexico (Fig. 16). A single specimen from Cartwright, Manitoba is in the LACM.

Figure 16. 

The distribution of Heteranassa in North America, ranging from Texas and Oklahoma west to California, USA, south to Jalisco Mexico. A single stray is recorded from Manitoba, Canada.

The variation in Heteranassa wing pattern and coloration is continuous, with many specimens appearing intermediate to the phenotypes described by Smith (1899) and Harvey (1876). Genitalic morphology does not, however, correlate with wing pattern differences. These observations suggest that Heteranassa contains a single, highly variable species, H. mima. Studies of another erebine genus, Catocala, have shown that pressure from avian predators may drive high levels of polymorphism in forewing pattern and coloration (Ricklefs and O’Rourke 1975, Bond and Kamil 2002, Webster et al. 2009), and Heteranassa may be subject to similar evolutionary processes.

A series of Heteranassa from Death Valley, California collected in February, 2005, is the most variable in forewing pattern and coloration among the thousands of specimens observed to date. Heteranassa comprised roughly 90% of the moth specimens collected during this period, demonstrating that the genus is an abundant and likely ecologically important insect herbivore in North American desert biomes.

During the course of this research, we became aware of potential taxonomic affinities with the neotropical genera Elousa Walker (1857) and Coxina Guenée (1852). These genera have not been studied in a systematic framework since the turn of the 20th Century. A preliminary examination of male genitalia and wing pattern show significant overlap of characteristics between the genera. These three genera lack spines on the mesothoracic tibiae, and possess symmetrical male genitalia with membranous costal regions of the valves. These processes are larger in Heteranassa and Elousa albicans (Walker, 1857) than they are in Elousa schausi (Giacomelli, 1911) and the other Coxina species we have dissected. We have examined 10 species in these genera from the Caribbean and South America. Specimens belonging to this group that we collected in the Nicaraguan highlands appear more similar to E. schausi specimens from Argentina and Coxina specimens from Mexico, south Texas, and Florida, than they do to Caribbean Elousa or North American Heteranassa. Future research could test the monophyly of Coxina and Elousa with respect to Heteranassa, and how these genera speciated in North and South America and the Caribbean.