Research Article |
|
Corresponding author: Nidchaya Aketarawong ( nidchaya.akt@mahidol.ac.th ) Academic editor: Marc De Meyer
© 2015 Nidchaya Aketarawong, Siriwan Isasawin, Punchapat Sojikul, Sujinda Thanaphum.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Aketarawong N, Isasawin S, Sojikul P, Thanaphum S (2015) Gene flow and genetic structure of
|
The Carambola fruit fly, Bactrocera carambolae, is an invasive pest in Southeast Asia. It has been introduced into areas in South America such as Suriname and Brazil. Bactrocera carambolae belongs to the B. dorsalis species complex, and seems to be separated from B. dorsalis based on morphological and multilocus phylogenetic studies. Even though the Carambola fruit fly is an important quarantine species and has an impact on international trade, knowledge of the molecular ecology of B. carambolae, concerning species status and pest management aspects, is lacking. Seven populations sampled from the known geographical areas of B. carambolae including Southeast Asia (i.e., Indonesia, Malaysia, Thailand) and South America (i.e., Suriname), were genotyped using eight microsatellite DNA markers. Genetic variation, genetic structure, and genetic network among populations illustrated that the Suriname samples were genetically differentiated from Southeast Asian populations. The genetic network revealed that samples from West Sumatra (Pekanbaru, PK) and Java (Jakarta, JK) were presumably the source populations of B. carambolae in Suriname, which was congruent with human migration records between the two continents. Additionally, three populations of B. dorsalis were included to better understand the species boundary. The genetic structure between the two species was significantly separated and approximately 11% of total individuals were detected as admixed (0.100 ≤ Q ≤ 0.900). The genetic network showed connections between B. carambolae and B. dorsalis groups throughout Depok (DP), JK, and Nakhon Sri Thammarat (NT) populations. These data supported the hypothesis that the reproductive isolation between the two species may be leaky. Although the morphology and monophyly of nuclear and mitochondrial DNA sequences in previous studies showed discrete entities, the hypothesis of semipermeable boundaries may not be rejected. Alleles at microsatellite loci could be introgressed rather than other nuclear and mitochondrial DNA. Bactrocera carambolae may be an incipient rather than a distinct species of B. dorsalis. Regarding the pest management aspect, the genetic sexing Salaya5 strain (SY5) was included for comparison with wild populations. The SY5 strain was genetically assigned to the B. carambolae cluster. Likewise, the genetic network showed that the strain shared greatest genetic similarity to JK, suggesting that SY5 did not divert away from its original genetic makeup. Under laboratory conditions, at least 12 generations apart, selection did not strongly affect genetic compatibility between the strain and wild populations. This knowledge further confirms the potential utilization of the Salaya5 strain in regional programs of area-wide integrated pest management using SIT.
Carambola fruit fly, species complex, gene flow, incipient species, pest control, SIT, Salaya5 strain
Bactrocera carambolae Drew & Hancock, the Carambola fruit fly, is a key insect pest belonging to the B. dorsalis species complex (Diptera, Tephritidae). Its native distribution covers the western part of the Indo-Australian Archipelago (determined by Wallace’s and Huxley’s lines), including the Thai/Malay Peninsula and Western Indonesia (
Within the B. dorsalis species complex, B. carambolae is still valid, even though a few members (i.e., B. papayae Drew & Hancock, B. philippinensis Drew & Hancock, and B. invadens Drew, Tsuruta & White) of the complex were recently synonymized with B. dorsalis (
In order to manage fruit fly pests, a method such as the Sterile Insect Technique (SIT) is commonly used to prevent, suppress, eradicate, or contain these pests (
Microsatellite DNA markers are a useful tool for population genetic and molecular ecological studies as well as pest management. The sequences of microsatellites are short tandem repeats that are widely distributed throughout the entire eukaryotic genome. Microsatellite loci selected for population genetics are Mendelian inherited, neutral, and polymorphic. Such markers generally provide a more contemporary estimate of diversity/structure because they mutate quicker and present a co-dominant feature, unlike mitochondrial DNA or other nuclear DNA markers (
The aim of this research, therefore, is to study the population genetics of B. carambolae, using modified cross-species amplification of microsatellite DNA markers derived from B. dorsalis and the junior synonym, B. papayae, with regard to three aspects of species status and pest management. Intra-specific variation was analyzed among seven populations, consisting of native and trans-continentally introduced populations, for inference of colonization processes. Moreover, samples of B. dorsalis were included to examine the population genetic structure and as an attempt to better understand the species boundary between B. carambolae and B. dorsalis. Lastly, concerning pest management aspect, we validated the potential for use the genetic sexing Salaya5 strain in regional SIT programs. The Salaya5 were genotyped and genetically compared to other wild B. carambolae populations, in order to evaluate genetic compatibility between them.
Nine wild fruit fly populations were collected from four geographical areas: Indonesia (6), Malaysia (1), Thailand (1), and Suriname (1) (Table
Sampling collections of Bactrocera carambolae and B. dorsalis in this study. Seven populations of B. carambolae (blue dots) were collected from Southeast Asia and Suriname. Three populations of B. dorsalis (red dots) were sampled from East and Southeast Asia. Two other unidentified populations (purple dots) were included. Information for each population is described in Table
| Sample name | Type | Population characterization | |||||||
|---|---|---|---|---|---|---|---|---|---|
| Morphology1 | Location2 | Host plant 3 | Male pheromone4 | ITS15 | |||||
| Bcar | Bdor | Bcar | Bdor | Bcar | Bdor | ||||
| NS | Alive | x | North Sumatra, Indonesia (01°47'N; 099°02'E) | Averrhoa carambola | x | x | |||
| PK | Dead | x | Pekanbaru, Riau, Indonesia (00°32'N; 101°27'E) | n/a | x | ||||
| DP | Dead | x | Depok, West Java, Indonesia (06°23'S; 106°49'E) | Averrhoa carambola | x | ||||
| JK | Alive | x | Jakarta, Indonesia (06°14'S; 106°49'E) | Averrhoa carambola | x | x | |||
| BD | Dead | x | Bandung, West Java, Indonesia (06°54'S; 107°36'E) | n/a | x | ||||
| WK | Dead | x | West Kalimantan, Indonesia (00°02'S; 109°19'E) | n/a | x | ||||
| DK | Dead | x | Dengkil, Selangor, Malaysia (03°20'N; 101°30'E) | n/a | x | ||||
| NT | Alive | x | Nakhon Sri Thammarat, Thailand (08°19'N; 099°57'E) | n/a | x | x | |||
| PR | Dead | x | Paramaribo, Suriname (05°52'N; 055°10'W) | n/a | x | ||||
| RB | Alive | x | Ratchaburi, Thailand (13°52'N; 099°48'E) | Mangifera indica | x | x | |||
| CM | Dead | x | Chang Mai, Thailand (18°47'N; 098°59'E) | n/a | x | ||||
| KS | Dead | x | Kaohsiung, Taiwan (23°02'N; 120°35'E) | Mangifera indica | x | ||||
| SY5 | Alive | x | Thailand (Lab) (Introgression strain) | - | x | x | |||
Three other populations of B. dorsalis were included in this study as outgroup samples for the investigation of genetic relationship between two cryptic species. These populations were collected from the known distributions of B. dorsalis (http://www.cabi.org/isc/datasheet/17685) and characterized as B. dorsalis using the same methods described before (Table
To record the genetic relationship between the genetic sexing Salaya5 strain (
All samples were preserved in 95% ethanol and kept at -20 °C until use. The genomic DNA of each fly was extracted using the method of
Twelve microsatellite loci (Bd1, Bd9, Bd15, Bd19, Bd39, Bd42, and Bd85B derived from B. dorsalis s.s. (
| Locus | Repeat motif [GenBank Accession no.] | Original motif in B. dorsalis1 and B. papayae2 [Genbank Accession no.] | Primer (5’-3’) | Ta (°C) | n a | Size range in bp (na) | ||
| Bcar * | Bdor | SY5 | ||||||
| Bcar1 | CT(CA)4CGCA | CT(CA)4CG(CA)2 | F: TGCTTAACAGTAATTGCTCCTT | 62 | 11 | 96–112 | 96–108 | 100–108 |
| [KT355774] | [DQ482030]1 | R: AAGCAGTAAACAATAAAGTTCCAA | (9) | (7) | (4) | |||
| Bcar9 | (GT)2AA(GT)6GA | GA(GT)7GA | F: GCTGATATGTGTGCGTCTTATTTGTGA | 69 | 16 | 156–182 | 140–172 | 168–186 |
| [KT355775] | [DQ482033]1 | R: ATCTCGTATTGTGGTTGCTTAAATATG | (12) | (8) | (6) | |||
| Bcar15 | (CA)3CC(CG)2CAA (CA)6CGTG(TACA)3 |
(CA)8CGCAA (CA)4CGTG(TACA)3 |
F: TGCCTTGTGCTATTTAATCTTTATCAA | 63 | 12 | 183–199 | 155–195 | 191–195 |
| [KT355776] | [DQ482034]1 | R: AAATAAACAAAACAAAATGCAAATACA | (9) | (7) | (2) | |||
| Bcar19 | (CA)2CT(CA)6(TA)2CA | (CA)2CT(CA)6(TA)2(CATA)2 | F: TAGATGGAGATGGGTGCGTGTACATG | 71 | 13 | 149–171 | 155–175 | 167 |
| [KT355777] | [DQ482035]1 | R: GCGTGTTCACAAGGACTAATCGAA | (11) | (9) | (1) | |||
| Bcar39 | (GT)8 | (GT)8 | F: GGTCAAACAAATCACTCAGTAAC | 63 | 14 | 68–92 | 78–104 | 84–90 |
| [KT355778] | [DQ482037]1 | R: CCGTTATATCAGGCAAATCTATA | (8) | (11) | (4) | |||
| Bcar42 | CAAA(CA)2AA(CA)3(TA)4 | (CA)7(TA)7TG(TA)2GC(CA)3TA | F: GCACAGTGAGCGTTACAAG | 64 | 13 | 150–190 | 172–186 | 180–186 |
| [KT355779] | [DQ482038]1 | R: TGTTTTTACAGTTATACACTTCCCT | (10) | (8) | (4) | |||
| Bcar73 | (GT)9 | (GT)5 | F: AGCGAAAACCAACTACTACCG | 67 | 7 | 107–119 | 109–115 | 113–115 |
| [KT355780] | [AY847272]2 | R: CCACTACTTCATCTTGTTCCTGCAG | (7) | (4) | (2) | |||
| Bcar181 | (AC)5ATAC | (AC)8 | F: GTGCATGCCTTCGTGTAGCCTAACTCA | 67 | 5 | 101–109 | 103–109 | 103–105 |
| [KT355781] | [AY847280]2 | R: AATCTGCGAAGGATATCAACCATTCAC | (5) | (4) | (2) | |||
To improve null allele problems due to mutations on primer-binding sites and/or unsuitable PCR conditions, a new set of primers were designed and renamed for the 11 loci using OLIGO version 4.0-s (
Fifteen flies from Jakarta and North Sumatra, Indonesia were initially screened with the 11 sets of new primers using the PCR conditions mentioned above. Electrophoresis and allele scoring were determined as in
The descriptive parameters of population genetics were estimated using GENALEX v.6.5 (
Genetic differentiation (FST) among 13 populations was measured using MICROSATELLITE ANALYSER (MSA) (Dieringer and Schlötterrer 2003). In addition, genetically distinct groups (or clusters) were determined using the Bayesian approach implemented in STRUCTURE v.2.3.1 (
Principle Coordinate Analysis (PCoA) was used to display genetic divergence among fruit fly populations in multidimensional space. This analysis was based on allele frequency data and performed on genetic distance using GENALEX v.6.5 (
To test genetic homogeneity in different hierarchical population structures, Analysis of Molecular Variance (AMOVA) in ARLEQUIN v.3.1.1 was used (
The correlation analysis between genetic and geographic distance was performed using the subprogram ISOLDE in the GENEPOP package (
Analyses of the genetic networks were performed using EDENetworks (
Networks consist of nodes (or vertices), corresponding to populations, connected by links (or edges), representing their relationships or interactions. Connectivity degree (or Degree) is the number of edges connected to a node summarizing how strongly a population associated with the other populations in the system and whether or not it is a source population. Betweenness-centrality (BC) determines the relative importance of a node within the network as an intermediary in the flow of information. Each network was weighted demonstrating genetic similarity associated with each link.
The network can be analyzed at various meaningful thresholds (thr). thr is the maximum distance considered as generating a connection in the network. One meaningful distance is the one corresponding to the percolation threshold (Dp), edges with weights below the threshold were removed from the weighted network, and only the most important links were retained. Above the Dp level, there is a giant component containing almost all the nodes in the networks while below the Dp level, the network is fragmented into small disconnected components and the system therefore loses its ability to transport information across the whole system. Therefore, scanning at different thresholds was performed to analyze possible sub-structured systems to observe the sequential forms of clusters (
All eight microsatellite loci tested within 13 populations have different levels of polymorphism in terms of number of alleles (ranging from moderately polymorphic, at five (Bcar181) to highly polymorphic at 16 (Bcar9)) and allele size range, as presented in Table
Overall genetic variations detected in each population is summarized in Table
| Sample | n a | n e | n p | A p | n r | A r | H O | H E | F IS |
|---|---|---|---|---|---|---|---|---|---|
| NS | 3.375 | 1.980 | 0.000 | 0.000 | 0.625 | 0.032 | 0.202 | 0.410 | 0.532 |
| PK | 5.250 | 3.318 | 0.250 | 0.024 | 1.375 | 0.030 | 0.436 | 0.589 | 0.232 |
| DP | 5.000 | 3.257 | 0.125 | 0.059 | 0.625 | 0.030 | 0.381 | 0.648 | 0.386 |
| JK | 5.250 | 3.530 | 0.125 | 0.019 | 1.125 | 0.024 | 0.375 | 0.613 | 0.388 |
| DK | 4.625 | 2.937 | 0.000 | 0.000 | 0.875 | 0.024 | 0.347 | 0.528 | 0.258 |
| NT | 5.625 | 3.384 | 0.250 | 0.018 | 1.750 | 0.024 | 0.337 | 0.653 | 0.461 |
| PR | 2.000 | 1.324 | 0.000 | 0.000 | 0.375 | 0.015 | 0.152 | 0.185 | 0.095 |
| BD | 5.500 | 2.816 | 0.250 | 0.037 | 1.625 | 0.021 | 0.380 | 0.622 | 0.376 |
| WK | 5.750 | 3.257 | 0.375 | 0.092 | 1.875 | 0.026 | 0.406 | 0.660 | 0.393 |
| RB | 5.375 | 3.302 | 0.625 | 0.031 | 0.875 | 0.030 | 0.259 | 0.668 | 0.628 |
| CM | 4.250 | 2.466 | 0.250 | 0.074 | 0.750 | 0.037 | 0.387 | 0.572 | 0.315 |
| KS | 3.375 | 2.163 | 0.125 | 0.111 | 0.000 | 0.000 | 0.385 | 0.459 | 0.119 |
| SY5* | 3.286 | 1.952 | 0.125 | 0.016 | 1.000 | 0.032 | 0.317 | 0.433 | 0.274 |
Genetic differentiation among 13 populations was measured by the fixation index (FST), as shown in Table
| Population | NS | PK | DP | JK | DK | NT | PR | BD | WK | RB | CM | KS | SY5 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| NS | |||||||||||||
| PK | 0.296 | ||||||||||||
| DP | 0.274 | 0.162 | |||||||||||
| JK | 0.217 | 0.134 | 0.169 | ||||||||||
| DK | 0.288 | 0.344 | 0.287 | 0.300 | |||||||||
| NT | 0.329 | 0.248 | 0.188 | 0.241 | 0.206 | ||||||||
| PR | 0.596 | 0.444 | 0.495 | 0.448 | 0.631 | 0.564 | |||||||
| BD | 0.334 | 0.240 | 0.228 | 0.176 | 0.368 | 0.264 | 0.491 | ||||||
| WK | 0.345 | 0.216 | 0.163 | 0.197 | 0.336 | 0.273 | 0.486 | 0.194 | |||||
| RB | 0.404 | 0.260 | 0.181 | 0.234 | 0.339 | 0.204 | 0.582 | 0.202 | 0.162 | ||||
| CM | 0.395 | 0.321 | 0.254 | 0.290 | 0.401 | 0.249 | 0.636 | 0.259 | 0.200 | 0.210 | |||
| KS | 0.524 | 0.402 | 0.322 | 0.347 | 0.368 | 0.168 | 0.738 | 0.352 | 0.317 | 0.256 | 0.357 | ||
| SY5 | 0.468 | 0.389 | 0.372 | 0.278 | 0.381 | 0.343 | 0.507 | 0.348 | 0.321 | 0.354 | 0.409 | 0.414 |
STRUCTURE analysis demonstrated the proportion of co-ancestry (Q) distributed in hypothetical clusters (K) whereas PCoA illustrated the genetic divergence of fruit fly populations in multidimensional space, as shown in Figure
Three-dimensional plot of Principal Coordinate Analysis (PCoA) and STRUCTURE analysis. A the planes of the first three principal coordinates explain 43.65%, 20.13%, and 16.91% of total genetic variation, respectively, for seven B. carambolae populations using eight SSRs B the planes of the first three principal coordinates explain 33.05%, 23.17%, and 15.87%, respectively, for B. carambolae and B. dorsalis groups using eight SSRs C the planes of the first three principal coordinates explain 30.50%, 22.14%, and 18.53%, respectively, for the SY5 strain and wild populations using seven SSRs. Pie graphs, consisting of different colored sections, represent co-ancestor distribution of 185, 289, and 321 individuals in A two, B three, and C two hypothetical clusters, respectively.
When three additional populations of B. dorsalis (RB, CM and KS) and two unidentified populations (BD and WK) were included in the STRUCTURE analysis, the optimal number for K was three. Genetic clusters were separated into two groups: B. dorsalis belonged to cluster 1 while B. carambolae belonged to clusters 2 and 3 (Figure
The individual-admixture plot for K = 3 is presented in Figure
The individual admixture plot for K = 3. Each bar reveals a single individual. Each color of bars represents each genetic cluster. Samples of B. carambolae belong to clusters 2 and 3 (green and blue, respectively) while samples of B. dorsalis belong to cluster 1 (red). Potential hybrids have a proportion of genetic cluster (Q) between 0.100 to 0.900 (0.100 ≤ Q ≤ 0.900) as identified with asterisk (*).
Adding the SY5 strain to the genetic cluster analysis, two was the optimal number for K. At K = 2, genetic clusters formed two groups likely corresponding to B. carambolae and B. dorsalis groups. Six populations of B. carambolae (NS (Q = 0.981), PK (Q = 0.913), JK (Q = 0.948), DK (Q = 0.964), and PR (Q = 0.993) belonged to cluster 1 (Figure
Analysis of Molecular Variance (AMOVA) was used to study the hierarchical structure of populations for different scenarios (Table
| Scenario* | Among groups | Among populations within groups | Within populations | ||||||
| V a | Percentage | P | V b | Percentage | P | V c | Percentage | P | |
| 1 | 0.2533 | 11.8 | 0.1877 | 0.5952 | 27.72 | <0.0001 | 1.2990 | 60.49 | <0.0001 |
| 2 | 0.5817 | 23.21 | 0.1953 | 0.6256 | 24.96 | <0.0001 | 1.2990 | 51.83 | <0.0001 |
| 3 | 0.1833 | 7.98 | 0.0479 | 0.7805 | 33.98 | <0.0001 | 1.3335 | 58.04 | <0.0001 |
| 4 | 0.1450 | 6.26 | 0.0156 | 0.7282 | 31.46 | <0.0001 | 1.4416 | 62.28 | <0.0001 |
| 5 | 0.1377 | 6.15 | 0.2483 | 0.8262 | 36.88 | <0.0001 | 1.2767 | 56.98 | <0.0001 |
| 6 | 0.1744 | 7.69 | 0.0694 | 0.7810 | 34.47 | <0.0001 | 1.3105 | 57.84 | <0.0001 |
| 7 | 0.1607 | 6.98 | 0.0342 | 0.7288 | 31.67 | <0.0001 | 1.4121 | 61.35 | <0.0001 |
| 8 | 0.3298 | 13.96 | 0.0010 | 0.5910 | 25.02 | <0.0001 | 1.4416 | 61.02 | <0.0001 |
| 9 | 0.139 | 6.08 | 0.0039 | 0.7498 | 32.57 | <0.0001 | 1.4121 | 61.35 | <0.0001 |
Record of different host plants in Southeast Asia and Suriname for Bactrocera carambolae (edited from van Sauers-Muller 2005).
| Hosts found in Southeast Asia only | Hosts found in Suriname only |
|---|---|
| Annona montana Macf. | Anacardium occidentale L. |
| Annona muricata L | Spondias cytherea Sonn. |
| Thevetia peruviana (Pers.) K. Schum | Spondias mombin L. |
| Persea americana Mill. | Garcinia dulcis (Roxb.) Kurz |
| Artocarpus altilis (communis) (Park.) Fosberg | Malpighia punicifolia L. |
| Artocarpus heterophyllus Lam. | Eugenia cf. patrisii Vahl |
| Averrhoa bilimbi L. | Citrus sinensis (L.) Osbeck |
| Punica granatum L. | |
| Capsicum annuum L. | |
| Lycopersicon esculentum Mill. |
The correlation between genetic and geographic distance was analyzed using only wild samples consisting of B. carambolae and B. dorsalis populations. The correlation between genetic and geographical distance became non-significant [R2 = 0.394, P = 0.106, FST/(1-FST) = 0.146 Ln (geographical distance) - 0.572] when B. carambolae samples were analysed. This fact indicates that there is no limitation of gene flow among B. carambolae across the region. Among B. carambolae and B. dorsalis populations, analysis showed significant correlation between genetic and geographical distances [R2 = 0.449, P = 0.002, FST/(1-FST) = 0.180 Ln (geographical distance) + (0.868)], even though only the PR sample was excluded (R2 = 0.119, P = 0.021).
Simplified networks were constructed for three different scenarios: (1) among seven B. carambolae populations, (2) among 12 populations belonging to B. carambolae and B. dorsalis clusters, and (3) among 13 populations, including the SY5 strain (Figures
Simplified network of seven Bactrocera carambolae populations, and the sequential forms of cluster. The network was constructed using eight SSRs. Scanning was done for decreasing thresholds A is the fully connected network B is the percolation threshold (Dp = 0.52, with all links corresponding to distances superior to Dp excluded). JK plays an important role connecting between native and introduced populations C–D are the lower thresholds chosen (thr = 0.40 and 0.15, respectively) to reveal sub-structured network.
Simplified network of Bactrocera carambolae and B. dorsalis groups, and the sequential disconnection of the network. The network was constructed using eight SSRs. Scanning was done for decreasing thresholds A is the fully connected network B is the percolation threshold (Dp = 0.20, with all links corresponding to distances superior to Dp excluded). DP, JK, and NT are connecting between B. carambolae and B. dorsalis groups. Red dashed lines with number are corresponded to the threshold values, revealing serial disconnection of the network C is the lowest threshold (thr = 0.15).
Simplified network of the SY5 strain and wild populations, and the sequential disconnection of the network. The network was constructed using seven SSRs. Scanning was done for decreasing thresholds A is the fully connected network B is the percolation threshold (Dp = 0.23, with all links corresponding to distances superior to Dp excluded). DP, JK, and NT are connecting between B. carambolae and B. dorsalis groups C is the lowest threshold (thr = 0.15). Red dashed lines with number are corresponded to the threshold values, revealing serial disconnection of the network.
For the second scenario, five more populations belonging to the B. dorsalis cluster were included in the network analyses (Figure
For the third scenario, the SY5 strain was added into the network to evaluate the genetic similarity between the SY5 strain and wild populations (Figure
At the macro-geographical level, comparing among seven populations of B. carambolae from Southeast Asia and South America, the populations across the species’ native range possessed higher genetic variation than the introduced population, which is generally expected for invasive species. The first genetic connections between native and introduced populations were identified as Jakarta (JK) and Pekanbaru (PK), Indonesia. However, the genetic structure of the Suriname population (PR) (based on FST, STRUCTURE, PCoA, and genetic network analysis) was differentiated from the Carambola fruit fly in Southeast Asia. These results were congruent with multilocus phylogenetic analysis established by
Within Southeast Asia, B. carambolae demonstrates high genetic variation and homogeneous population structure. West Java, in particular JK, is also a potential source of B. carambolae populations in Southeast Asia. JK showed relatively higher genetic variation and greater values of Degree and betweenness-centrality than other populations in the genetic network. Moreover, this area is important for the cultivation of star fruit and is a center for transportation to other cities and countries. The homogeneous genetic pattern of B. carambolae in native areas is similar to B. dorsalis collected from neighboring countries, including Thailand, Laos, and Cambodia (
Pairwise FST between native and introduced populations was significantly higher than zero. Approximately 13.4% to 32.9% and 44.4% to 63.1% of genetic diversity were results of genetic difference among populations within native areas and among populations between native and introduced areas, respectively. From the comparison of the genetic diversity of other closely related species using eight similar microsatellite loci with different primer sets as the current study, lower levels of genetic diversity (approximately 2% to 18%) were estimated from B. dorsalis (
Departures from HWE were quite high and null alleles might be responsible for the departures. The average null allele frequency was moderate (0.12), varying from low (0.01) to high frequencies (0.25). The high departure from HWE was also observed in other study using a single set of microsatellite markers for different species such as the Ceratitis FAR complex (52.4%,
We found 44 alleles shared between B. carambolae and B. dorsalis while 14 and 27 alleles were detected in only B. carambolae and B. dorsalis, respectively. Coincidence of similar/different allele profiles between them at microsatellite loci may be due to several phenomena including retention of ancestral alleles in both sister species; substantial gene flow between the two species; size homoplasy (
Using the genetic cluster approach, assuming correlated allele frequencies in different clusters were likely to be similar due to migration or shared ancestral, species’ genetic structures were determined. We found admixed individuals (potential hybrids) in both clusters with relatively similar ratio (9.73% in B. carambolae cluster and 12.5% in B. dorsalis cluster). To avoid the shared descent, a stricter model using uncorrelated allele frequencies was tested. The results still presented species’ genetic cluster and admixed individuals (Suppl. material
The current study therefore provided additional evidence to support an incomplete reproductive isolation between B. carambolae and B. dorsalis (
SIT is a species-specific control method that can deliver environmental benefit. However, it may be restricted where at least two major target pests coexist and need to be controlled. Releasing sterile males of only one target may not ensure a reduction of all problems (
In order to identify the fruit fly samples, although microsatellite data showed significantly different population structure of the two species, eight of 185 individuals (4.32%) and one of 104 individuals (0.96%) belonging to the B. carambolae and B. dorsalis clusters were identified as opposite to their original assumed identity. At the individual level, microsatellite data in this study may not provide definitive data for studying systematic questions of incipient species. However, at the population level, microsatellite data can be used to distinguish species. This is similar to the case of the Ceratitis FAR complex in that genetic clustering can solve three species’ statuses whereas other data (i.e., morphology, phylogenetics based on DNA sequence analyses, and niche) cannot (
Pattern of connectivity and population structure, based on microsatellite DNA markers, showed that B. carambolae from an introduced population genetically differs from populations from the native range. Genetic drift during colonization process and local adaptation may be factors shaping its genetic diversity and population structure. However, only sampling from South America might not be sufficient to trace back the process of colonization within and between continents. West Sumatra (Pekanbaru-PK) and Java (Jakarta-JK) were identified as sources of the Suriname population, congruent with historical record of human migration between the two continents. A different pattern of population structure was observed in B. carambolae within native range, where free human movement and trading can promote genetic homogeneity. Between B. carambolae and B. dorsalis groups, potential hybrids provide evidence through individual-based admixture plots. This was additional supportive data suggesting that reproductive isolation between B. carambolae and B. dorsalis is somewhat leaky. Although morphological characterization and several nuclear and mitochondrial markers revealed distinct species, the hypothesis of semipermeable species boundaries between them cannot be rejected. Alleles at microsatellite loci could be introgressed rather than other nuclear and mitochondrial sequences. Regarding the final conclusion on pest management aspect, the genetic sexing Salaya5 strain for B. carambolae had not diverted away from its original genetic makeup (JK) and other neighbor populations. Under laboratory condition, at least 12 generations apart, selection did not strongly affect genetic compatibility between the strain and wild populations. Therefore, the Salaya5 strain could be possible to include in the pest control programs using male-only SIT in local and regional levels, although an actual mating test is still required between the strain and samples from introduced populations.
The authors gratefully acknowledge the anonymous reviewers for their critique of the manuscript and Mr. Robert Bachtell Eastland for his English editing service. We sincerely thank Subahar TSS, Tan KH, and Wee SL for supplying the biological materials used in this study. This research is partly supported by the International Atomic Energy Agency (IAEA), Vienna, Austria via research contract no.16029 as part of the Coordinate Research Project ‘Resolution of cryptic species complexes of tephritid pests to overcome constraints to SIT application and international trade’ to N. Aketarawong. Also, N. Aketarawong is partially supported by the Department of Biotechnology, Faculty of Science, Mahidol University, Bangkok, Thailand.
Component data at the five successive thresholds used to illustrate Figure
Data type: measurement
Explanation note: Component data are used to illustrate the structure of the subset of B. carambolae populations. The Highest Betweenness-centrality is highlighted in blue.
Component data at the four successive thresholds used to illustrate Figure
Data type: measurement
Explanation note: Component data are used to illustrate the structure of the subset of B. carambolae and B. dorsalis populations. The highest Betweenness-centrality is highlighted in blue.
Component data at the four successive thresholds used to illustrate Figure
Data type: measurement
Explanation note: Component data are used to illustrate the structure of the subset of the Salaya5 strain and wild populations. The highest Betweenness-centrality is highlighted in blue.
Comparisons among three different the individual admixture plots
Data type: measurement
Explanation note: Comparisons among the individual admixture plots of 289 individuals, for K = 3, considering correlated allele frequency, uncorrelated allele frequency, and missing data as recessive homozygotes for the null alleles, respectively.