Research Article
Print
Research Article
The mitochondrial genome and phylogenetic characteristics of the Thick-billed Green-Pigeon, Treron curvirostra: the first sequence for the genus
expand article infoNan Xu‡, Jiayu Ding‡, Ziting Que‡, Wei Xu‡, Wentao Ye‡, Hongyi Liu‡
‡ Nanjing Forestry University, Nanjing, China

Corresponding author: Hongyi Liu ( hongyi_liu@njfu.edu.cn )

Academic editor: George Sangster
© 2021 Nan Xu, Jiayu Ding, Ziting Que, Wei Xu, Wentao Ye, Hongyi Liu.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Xu N, Ding J, Que Z, Xu W, Ye W, Liu H (2021) The mitochondrial genome and phylogenetic characteristics of the Thick-billed Green-Pigeon, Treron curvirostra: the first sequence for the genus. ZooKeys 1041: 167-182. https://doi.org/10.3897/zookeys.1041.60150
ZooBank: urn:lsid:zoobank.org:pub:E1EEC61A-4A09-41E2-A6A6-2B66F0D0B868
Open Access

Abstract

Members of the genus Treron (Columbidae) are widely distributed in southern Asia and the Indo-Malayan Region but their relationships are poorly understood. Better knowledge of the systematic status of this genus may help studies of historical biogeography and taxonomy. The complete mitochondrial genome of T. curvirostra was characterized, a first for the genus. It is 17,414 base pairs in length, containing two rRNAs, 22 tRNAs, 13 protein coding genes (PCGs), and one D-loop with a primary structure that is similar to that found in most members of Columbidae. Most PCGs start with the common ATG codon but are terminated by different codons. The highest value of the Ka/Ks ratio within 13 PCGs was found in ATP8 with 0.1937, suggesting that PCGs of the mitochondrial genome tend to be conservative in Columbidae. Moreover, the phylogenetic relationships within Columbidae, which was based on sequences of 13 PCGs, showed that (T. curvirostra + Hemiphaga novaeseelandiae) were clustered in one clade, suggesting a potentially close relationship between Treron and Hemiphaga. However, the monophyly of the subfamilies of Columbidae recognized by the Interagency Taxonomic Information System could not be corroborated. Hence, the position of the genus Treron in the classification of Columbidae may have to be revised.

Keywords

Columbidae, genome sequencing, Ka/Ks ratio, mitochondrial DNA, phylogenetic tree

Introduction

Mitochondrial DNA sequences can be reliable markers for studying the origin and phylogenetic relationships of species owing to its fast evolution rate, simple structure, light molecular weight, and maternal inheritance (Nabholz et al. 2016; Martins et al. 2019). Mitochondrial genomes of birds have a closed loop structure with lengths of 15,500–23,000 base pairs (bp) (Sammler et al. 2011; Xu et al. 2019; Wang et al. 2020). They typically contain 13 protein coding genes (PCGs), 22 transfer RNA genes (tRNAs), two ribosomal RNA genes (rRNAs), and one D-loop (Bensch and Härlid 2000; Sun et al. 2020), while some species were found to have duplicate regions (Eberhard and Wright 2016).

The pigeons and doves (family Columbidae) are widely distributed on all continents except Antarctica, ranging from tropical to temperate regions (Gibbs et al. 2001). The number of subfamilies of Columbidae differs among taxonomic authorities. Dickinson and Remsen (2013) recognize three subfamilies (Columbinae, Peristerinae, and Raphinae), whereas the Interagency Taxonomic Information System (ITIS) recognizes five subfamilies (Columbinae, Didunculinae, Gourinae, Otidiphabinae, and Treroninae), as well as 49 genera and more than 300 extant species (Integrated Taxonomic Information System 2020).

All species of green-pigeons (Treron) are listed as second-class national protected animals under China’s Catalog of Wildlife of the Key State Protection. Most species in the genus are declining (Birdlife International 2018); however, only a few genetic resources are available for the genus Treron (e.g., Sorenson et al. 2003; Pereira et al. 2007; Hackett et al. 2008; Price et al. 2014; Claramunt and Cracraft 2015).

The Thick-billed Green-Pigeon Treron curvirostra (Gmelin, 1789) is mainly distributed in virgin, evergreen, broad-leaved, and secondary forests of the tropical and subtropical hilly zone in Southeast Asia and South Asia (Gibbs et al. 2001). Like most species of Columbidae, T. curvirostra feeds on seeds and fruits (Korzun et al. 2008). Members of this species have a medium-sized body and a colorful plumage (Korzun et al. 2008) distinguished by their grey head and green neck. The lower body is yellowish green, while the wing is nearly black, with a yellow feather margin and a distinct yellow wing spot. The central tail feathers are green, while the remaining feathers are gray with black secondary end spots (Korzun et al. 2008; Nair 2010). At present, only few studies have focused on T. curvirostra: Nair (2010) discussed the zoogeography.

To understand the systematic position of the genus Treron among Columbidae, we sequenced and characterized the first complete mitochondrial genome sequence of T. curvirostra. We compared the complete mitochondrial genome of T. curvirostra with that of 33 other pigeons and doves and determined its genetic structural characteristics. In addition, we used 13 protein-coding genes (PCGs) to reconstruct a phylogenetic tree, which we use to infer the taxonomic position of the species and illuminate the phylogenetic relationships among species of Columbidae.

Materials and methods

Sample collection and DNA extraction

This study was authorized by Nanjing Forestry University. The youngest tail feathers of a male Thick-billed Green-Pigeon T. curvirostra were collected from an individual rescued from a net that was used to prevent birds from stealing fruit at the Xieyang peak of Dali City, Yunnan Province, China. The bird was identified as T. curvirostra based on its morphological characters (Gibbs et al. 2001). After sample collection, the bird was released. The tail feather samples were transported to the Laboratory of Animal Molecular Evolution at the Nanjing Forestry University and stored at -80 °C. The tubules were cut and the pulp was removed for genomic DNA extraction using the FastPure Cell/Tissue Isolation Mini kit (Vazyme Biotechnology Co., Ltd., Nanjing, China) and stored at -20 °C for later use.

PCR amplification and sequencing

Primers were designed based on the mitochondrial gene sequences of Streptopelia decaocto, Hemiphaga novaeseelandiae, and Columba hodgsonii (GenBank accession numbers KY827036, EU725864, and MN919176,respectively) using DNASTAR software (DNASTAR, USA; Burland 2000). Primer sequences are listed in Table 1. The PCR reaction volume was 25 μL, which included 1 μL of template DNA, 12.5 μL of the 2×Rapid Taq Master Mix (Vazyme Biotech Co., Ltd, Nanjing, China), 1 μL per primer, and 9.5 μL double-distilled (dd)H2O. The PCR reaction procedure consisted of a pre-denaturation at 95 °C for 3 min, a denaturation at 95 °C for 15 s, an annealing at 50 °C to 60 °C for 15 s, which was adjusted according to the primers’ own conditions, an extension at 72 °C for 2 min, cycling 35 times, and a final extension at 72 °C for 5 min. The PCR products were detected by a 1% agarose gel electrophoresis, and then sent to Tsingke Biotech Co., Ltd. (Nanjing, China), where the original primers were used for the bidirectional sequencing.

Table 1.
Download as
CSV
XLSX

Primers used for amplification of the T. curvirostra mitogenome.

Fragment Region Primer pair Primer sequence (5' - 3')
DG 1 COI-COII DG 1F CACTCAGCCATCTTACCT
DG 1R ACAGATTTCTGAGCATTGGC
DG 2 COII-ND4 DG 2F CCAATCCGCATCATCGTC
DG 2R GGTTTCCTCATCGTGTGA
DG 3 ND4-ND5 DG 3F CAGCCTCCTAATTGCCAC
DG 3R GTAGGGCGGAGACTGGAG
DG 4 ND5-Cyt b DG 4F ACAGGGCCGAGCAGAAGC
DG 4R TAGGAAGTATCACTCTGG
DG 5 Cyt b-12S rRNA DG 5F GCAGGCCTCACCATTATCC
DG 5R GTTAATTACTGCTGAGTACC
DG 6 12S rRNA-16S rRNA DG 6F GCTGGCATCAGGCACGCC
DG 6R TGGGTCTGGTTACTGTTA
DG 7 16S rRNA-ND2 DG 7F CGGTTGGGGCGACCTTGGAG
DG 7R AGAGTGGGAGGAGTAGGGC
DG 8 ND2-COI DG 8F AGCAGCCACAATCATGGC
DG 8R ATAGATTTGGTCATCTCC

Sequence analysis

By comparing and identifying the DNA sequence of each mitochondrial gene in other pigeon families, the range and location of T. curvirostra’s mitochondrial genes were annotated. Hence, the complete mitochondrial genome sequence was used to predict the transcriptional direction of each gene component using the Improved de novo Metazoan Mitochondrial Genome Annotation (MITOS) platform (Bernt et al. 2013). The annotated mitochondrial genome sequence of T. curvirostra was submitted to GenBank (accession number MT535857). The mitochondrial ring structure was plotted, and 22 tRNA clover two-dimensional structures were predicted using programs, such as the comparative genomics (CG) View Server and the tRNAscan-Se (Stothard and Wishart 2005; Lowe and Chan 2016). Composition skew was calculated according to the following formulae: AT-skew = (A-T)/(A+T) and GC-skew = (G-C)/(G+C) (Perna and Kocher 1995). Moreover, the relative synonymous codon usage (RSCU) frequency and the ratio of the number of nonsynonymous substitutions per nonsynonymous site to the number of synonymous substitutions per synonymous site (Ka/Ks) of 13 PCGs of Columbidae were calculated using MEGA7 (Kumar et al. 2016), while the RSCU comparison graph was drawn by PhyloSuite (Zhang et al. 2020).

Phylogenetic analysis

We used a concatenated set of base sequences of the 13 PCGs from 34 pigeons and doves to investigate the phylogenetic position of T. curvirostra (Table 2). Yellow-throated Sandgrouse (Pterocles gutturalis Smith, 1836) was used as an outgroup. All operations were performed in the PhyloSuite software package (Zhang et al. 2020). The sequences were aligned in batches using MAFFT software (Katoh et al. 2002). ModelFinder was used to partition the codons and identify the best substitution model for the phylogenetic analyses (Kalyaanamoorthy et al. 2017). Phylogenetic trees were constructed with Bayesian inference (BI) and maximum-likelihood (ML) (Yang 1994; Huelsenbeck and Ronquist 2001). The best substitution model of BI was selected according to codon 1, 2 and 3, while the model of ML was determined by the automatic partitioning (Table 3). For the BI tree, Markov chains were run for one million generations and were sampled every 100 generations. The majority-rule consensus trees were estimated by combining the results from duplicated analyses, while discarding the first 25% of generations. Besides, we checked for nuclear copies of mitochondrial sequences (numts) and possible chimerism (Sangster et al. 2016; Sangster and Luksenburg 2020).

Table 2.
Download as
CSV
XLSX

Summary of the mitogenomes used in the analyses.

Family Subfamily Genus Species Accession
Columbidae Columbinae Geopelia Geopelia cuneata MN930521.1
Geopelia striata MG590276.1
Trugon Trugon terrestris MG590263.1
Caloenas Caloenas maculata KX902249.1
Caloenas nicobarica MG590264.1
Streptopelia Streptopelia tranquebarica MT535858
Streptopelia orientalis KY827037.1
Streptopelia decaocto KY827036.1
Streptopelia chinensis KP273832.1
Columba Columba hodgsonii MN919176.1
Columba janthina LC541479.1
Columba jouyi KX902247.1
Columba livia KP319029.1
Columba rupestris KX902246.1
Ectopistes Ectopistes migratorius KC489473.1
Patagioenas Patagioenas fasciata KX902240.1
Leptotila Leptotila verreauxi HM640214.1
Zenaida Zenaida macroura KX902235.1
Zenaida auriculata HM640211.1
Geotrygon Geotrygon violacea HM640213.1
Turtur Turtur tympanistria HM746793.1
Columbina Columbina picui MN356335.1
Chalcophaps Chalcophaps indica HM746789.1
Treroninae Alopecoenas Alopecoenas salamonis KX902250.1
Hemiphaga Hemiphaga novaeseelandiae EU725864.1
Gourinae Goura Goura cristata MG590273.1
Goura sclaterii MG590285.1
Goura scheepmakeri MG590282.1
Goura victoria MG590299.1
Pezophaps Pezophaps solitaria KX902238.1
Raphus Raphus cucullatus KX902236.1
Otidiphabinae Otidiphaps Otidiphaps nobilis MG590265.1
Didunculinae Didunculus Didunculus strigirostris MG590266.1
Pteroclidae Pterocles Pterocles gutturalis MN356147.1
Table 3.
Download as
CSV
XLSX

The best substitution models for Bayesian inference (BI) and maximum-likelihood (ML) analyses.

ND1 ND2 COI COII ATP6 ATP8 COIII ND3 ND4L ND4 ND5 Cyt b ND6
BI Codon 1 SYM + I + G4 GTR + F + I + G4 SYM + I + G4 SYM + I + G4 GTR + F + I + G4 GTR + F + G4 SYM + I + G4 SYM + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 SYM + I + G4 GTR + F + G4
Codon 2 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 HKY + F + I + G4
Codon 3 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + I + G4 GTR + F + G4
ML TVM + F + R4 TVM + F + R4 TIM2 + F + I + G4 TIM2 + F + I + G4 TVM + F + R4 TN + F + I + G4 TIM2 + F + I + G4 TIM2 + F + I + G4 TIM2 + F + I + G4 TVM + F + R4 TVM + F + R4 TIM2 + F + I + G4 TIM2 + F + I + G4

Results and discussion

Mitochondrial genome structure and organization

The mitochondrial genome of the Thick-billed Green-Pigeon was found to be 17,414 bp in length, which agrees with the length of most of the other sequenced species of pigeons and doves (Table 4, Table 5, Table 6) (Pereira et al. 2007; Zhang et al. 2015). In addition, the base composition of T. curvirostra was found to be A = 30.32%, G = 13.61%, T = 24.83%, and C = 31.24%), where the A+T content (55.15%) was higher than the G+C content (44.85%) and is similar to other birds in Columbidae (Table 5 and Table 6) (Huang et al. 2016; Jang et al. 2016) . Moreover, the genome had a closed circular ring structure, containing 22 tRNAs, 2 rRNAs, 13 PCGs, and one D-loop. The ND6 gene and the other 8 tRNAs (tRNA-Gln, tRNA-Ala, tRNA-Asn, tRNA-Cys, tRNA-Tyr, tRNA-Ser (UGA), tRNA-Pro, and tRNA-Glu) were transcribed from the light (L)-strand, while the other genes were transcribed from the heavy (H)-strand (Fig. 1, Table 4). In addition, two pairs of overlapping regions among the ATP6/COIII and ND4L/ND4 were found, with an overlapping region of ATP6/COIII being one bp and the overlapping region of ND4L/ND4 being seven bp. Furthermore, 18 intergenic spacers were observed between the mitochondrial regions with lengths between -7 and 17 bp. Among all these intergenic spacers, the shortest was -7 bp (found between ND4L and ND4), while the longest was 17 bp (found between ND1 and tRNA-Ile).

Table 4.
Download as
CSV
XLSX

Mitochondrial genetic composition of T. curvirostra.

Gene Strand Position Anticodon Size (bp) Start codon Intergenic length
tRNA-Phe H 1–68 GAA 68 0
12S rRNA H 69–1041 973 0
tRNA-Val H 1042–1114 UAC 73 0
16S rRNA H 1115–2703 1589 0
tRNA-Leu H 2704–2777 UAA 74 12
ND1 H 2790–3755 966 ATG AGA 17
tRNA-Ile H 3773–3844 GAU 72 5
tRNA-Gln L 3850–3920 UUG 71 0
tRNA-Met H 3921–3988 CAU 68 0
ND2 H 3989–5027 1039 ATG T 0
tRNA-Trp H 5028–5098 UCA 71 1
tRNA-Ala L 5100–5168 UGC 69 2
tRNA-Asn L 5171–5243 GUU 73 2
tRNA-Cys L 5246–5313 GCA 68 0
tRNA-Tyr L 5314–5384 GUA 71 1
COI H 5386–6936 1551 ATG AGG 0
tRNA-Ser L 6937–7001 UGA 65 2
tRNA-Asp H 7004–7072 GUC 69 1
COII H 7074–7757 684 ATG TAA 1
tRNA-Lys H 7759–7828 UUU 70 1
ATP8 H 7830–7997 168 ATG TAA 0
ATP6 H 7988–8671 684 ATG TAA -1
COIII H 8671–9454 784 ATG T 0
tRNA-Gly H 9455–9523 UCC 69 0
ND3 H 9524–9875 352 ATT TAA 1
tRNA-Arg H 9877–9945 UCG 69 1
ND4L H 9947–10243 297 ATG TAA -7
ND4 H 10237–11614 1378 ATG T 0
tRNA-His H 11615–11683 GUG 69 0
tRNA-Ser H 11684–11749 GCU 66 0
tRNA-Leu H 11750–11819 UAG 70 0
ND5 H 11820–13637 1818 ATG AGA 8
Cyt b H 13646–14788 1143 ATG TAA 0
tRNA-Thr H 14789–14856 UGU 68 6
tRNA-Pro L 14863–14932 UGG 70 4
ND6 L 14937–15458 522 ATG TAG 3
tRNA-Glu L 15462–15532 UUC 71 0
D-loop 15553–17414 1862 0
Figure 1. 

Circular map of the T. curvirostra mitochondrial genome.

The PCGs

The total length of the PCGs was 11,386 bp, which is consistent with the average length of PCGs found in Columbidae (Table 5). The base composition of PCGs was A = 29.46%, G = 12.23%, T = 24.56%, and C = 33.76%, while the A+T content (54.01%) was slightly higher than the G+C content (45.99%). The AT-skew of T. curvirostra was positive, while the GC-skew was negative (Table 5). Furthermore, the PCG regions of T. curvirostra contained genes coding for cytochrome b (Cyt b), two ATPases (ATP6 and ATP8), three cytochrome c oxidases (COI, COII, and COIII), and seven NADH dehydrogenases (ND1-6 and ND4L). With the exception of ND3 (which had ATT as its start codon), all the other PCGs had ATG as a start codon. Six PCGs had the complete stop codon of TAA, while four PCGs had the other complete stop codons of AGA (ND1 and ND5), AGG (COI), and TAG (ND6). ND2, ND4, and COIII had the incomplete stop codon of T (Table 4). The RSCU of T. curvirostra is illustrated in Fig. 2, where Leu1 had the highest concentration and Cys had the lowest. In addition, Met only had AUG, while the other seven regions had four codons. With T. curvirostra as a baseline, the Ka/Ks ratio (Hurst 2002) of the 13 PCGs in 17 species of doves were all less than 1, with the highest Ka/Ks ratio (0.1937) in ATP8 and the lowest ratio (0.0243) in COI (Fig. 3). Hence, it seems that evolution tended to be conservative and maintained the generated protein (Hanada et al. 2007).

Table 5.
Download as
CSV
XLSX

Composition and skewness in mitochondrial genome of T. curvirostra.

Region A% T% AT-skew G% C% GC-skew
whole mitogenome 30.32 24.83 0.100 13.61 31.24 -0.393
PCGs 29.46 24.56 0.091 12.23 33.76 -0.468
rRNAs 32.75 21.19 0.214 19.05 27.01 -0.173
tRNAs 32.33 25.16 0.125 16.95 25.55 -0.203
D-loop 30.45 31.31 -0.014 11.92 26.32 -0.376
Table 6.
Download as
CSV
XLSX

Nucleotide composition indices in different regions of mitogenomes of Columbidae.

Species GenBank no Whole mitogenome Protein coding genes Ribosomal RNA
Length (bp) AT (%) Length (bp) AT (%) Length (bp) AT (%)
Goura sclaterii MG590285.1 18242 54.13 11386 52.99 2571 53.21
Treron curvirostra MT535857 17414 55.16 11386 54.02 2562 53.94
Columba hodgsonii MN919176.1 17477 54.55 11385 53.82 2557 53.23
Trugon terrestris MG590263.1 17405 55.62 11395 54.94 2569 55.86
Didunculus strigirostris MG590266.1 17389 54.94 11390 54.32 2569 55
Geopelia striata MG590276.1 17354 54.83 11383 53.78 2565 54.07
Otidiphaps nobilis MG590265.1 17346 55.83 11382 55.2 2581 54.75
Hemiphaga novaeseelandiae EU725864.1 17264 54.89 11386 54.1 2575 54.52
Caloenas nicobarica MG590264.1 17178 55.13 11386 54.83 2567 53.64
Leptotila verreauxi HM640214.1 17176 54.1 11383 53.34 2556 53.4
Alopecoenas salamonis KX902250.1 17141 55.18 11381 54.78 2569 54.81
Streptopelia orientalis KY827037.1 17102 53.41 11386 52.86 2561 53.58
Raphus cucullatus KX902236.1 17092 56.08 11385 55.87 2566 54.6
Ectopistes migratorius KC489473.1 17026 54.52 11383 54.3 2596 52.97
Patagioenas fasciata KX902239.1 16970 54.51 11384 54.02 2550 53.8
Geotrygon violacea HM640213.1 16864 55.04 11383 54.27 2561 53.85
Zenaida auriculata HM640211.1 16781 53.29 11380 52.71 2567 52.83
Figure 2. 

Codon distribution and relative synonymous codon usage in T. curvirostra mitogenome.

Figure 3. 

The ratio of the number of nonsynonymous substitutions per nonsynonymous site to the number of synonymous substitutions per synonymous site of 13 PCGs among 17 species of pigeons and doves. T. curvirostra was set as a baseline.

Transfer RNAs, ribosomal RNAs, and the D-loop

The mitogenome of T. curvirostra contained 22 tRNAs with lengths ranging from 65 bp (tRNA-Ser (UGA)) to 74 bp (tRNA-Leu (UAA)), which is similar to that in the mitogenomes of other pigeons and doves (Zhang et al. 2015). Moreover, the total length of the tRNAs was 1,534 bp, with an A+T content of 57.50%, a G+C content of 42.50%, an AT-skew of 0.1247, and a GC-skew of -0.2025 (Table 5). Among all the secondary structures of the 22 tRNA genes from the T. curvirostra mitochondrial genome, with the exception of tRNA-Ser (GCU), all had a typical cloverleaf structure (Fig. 4).

Figure 4. 

Secondary structure of 22 tRNA genes from the T. curvirostra mitochondrial genome.

The total size of the two rRNAs was 2,562 bp, with an A+T content of 53.94%, an AT-skew of 0.2142, and a GC-skew of -0.1729 (Table 5). The 12S rRNA was 973 bp in length and was located between tRNA-Phe and tRNA-Val, while the 16S rRNA was 1,589 bp in length and was located between tRNA-Val and tRNA-Leu (UAA).

A D-loop was found between tRNA-Glu and tRNA-Phe, and was 1,862 bp in length, with a A+T content of 61.76%, an AT-skew of -0.0139, and a GC-skew of -0.3764 (Table 5). Duplication and rearrangement of the avian mitochondrial genomes is common, but T. curvirostra had only one D-loop, which is similar to that present in other known mitogenomes of Columbidae (Pacheco et al. 2011; Eberhard and Wright 2016; Bruxaux et al. 2018).

Phylogenetic analysis

Although the topology of ML tree and BI tree were similar to each other, they differed with respect to the phylogenetic position of T. curvirostra. Treron curvirostra clustered with Hemiphaga novaeseelandiae (Gmelin, 1789) in the BI tree, whereas it did not cluster with any species in the ML tree (Fig. 5). Therefore, we tested for the presence of the numts and chimerism. All these tests were negative, indicating the validity of T. curvirostra mitogenome. The phylogenetic trees also highlighted the stable relationships among the same genera within Columbidae, which was consistent with previous studies from analyses of mitochondrial and nuclear genes (Kan et al. 2010; Pacheco et al. 2011; Hung et al. 2013; Mlíkovský 2016; Soares et al. 2016; Kretschmer et al. 2020; Liu et al. 2020) (Fig. 5). However, the phylogenetic analysis did not support the arrangement of pigeons into five subfamilies (Columbinae, Didunculinae, Gourinae, Otidiphabinae, and Treroninae) as recognized by ITIS. Caloenas, Geopelia, and Trugon terrestris (which were placed in Columbinae by ITIS) clustered with species from other subfamilies in our phylogenies (Fig, 5). The most likely cause might be that the original classification system was based mainly on patterns of overall similarity in morphology which may not accurately reflect phylogenetic relationships. Similar contradictions between overall similarity and phylogeny have also been found in other groups of birds, including terns (Bridge et al. 2005), rails (Sangster et al. 2015), nightjars (Han et al. 2010), eagles (Lerner and Mindell 2005), laughing thrushes (Luo et al. 2008), and chats and flycatchers (Sangster et al. 2010). Our results indicate that the subfamily classification of Columbidae may not accurately reflect historical relationships and may need to be revised. However, the poor branch support of basal clades of Columbidae precludes such a revision at present. Clearly, future attempts to resolve the phylogeny of Columbidae with confidence should include a suitable set of nuclear markers.

Figure 5. 

Mitogenomic phylogeny of 34 Columbidae species and an outgroup (Pterocles gutturalis) based on 13 PCGs using the Bayesian inference (A) and maximum likelihood (B) methods. Different colors indicated different subfamilies.

Acknowledgements

The authors declare no competing interest exists. This study was supported by the National Natural Science Foundation of China (No. 31800453), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), and the Innovation and Entrepreneurship Training Program for College Students of China (202010298035Z).

References

  • Bernt M, Donath A, Jühling F, Externbrink F, Florentz C, Fritzsch G, Pütz J, Middendorf M, Stadler PF (2013) MITOS: improved de novo metazoan mitochondrial genome annotation. Molecular Phylogenetics and Evolution 69: 313–319. https://doi.org/10.1016/j.ympev.2012.08.023
  • Bridge ES, Jones AW, Baker AJ (2005) A phylogenetic framework for the terns (Sternini) inferred from mtDNA sequences: implications for taxonomy and plumage evolution. Molecular Phylogenetics and Evolution 35: 459–469. https://doi.org/10.1016/j.ympev.2004.12.010
  • Bruxaux J, Gabrielli M, Ashari H, Prŷs-Jones R, Joseph L, Milá B, Besnard G, Thébaud C (2018) Recovering the evolutionary history of crowned pigeons (Columbidae: Goura): Implications for the biogeography and conservation of New Guinean lowland birds. Molecular Phylogenetics and Evolution 120: 248–258. https://doi.org/10.1016/j.ympev.2017.11.022
  • Gibbs D, Barnes E, Cox J (2001) Pigeons and doves: a guide to the pigeons and doves of the world. Pica Press, Robertsbridge.
  • Hackett SJ, Kimball RT, Reddy S, Bowie RCK, Braun EL, Braun MJ, Chojnowski JL, Cox WA, Han K-L, Harshman J, Huddleston CJ, Marks BD, Miglia KJ, Moore WS, Sheldon FH, Steadman DW, Witt CC, Yuri T (2008) A phylogenomic study of birds reveals their evolutionary history. Science 320: 1763–1768. https://doi.org/10.1126/science.1157704
  • Han K-L, Robbins MB, Braun MJ (2010) A multi-gene estimate of phylogeny in the nightjars and nighthawks (Caprimulgidae). Molecular Phylogenetics and Evolution 55: 443–453. https://doi.org/10.1016/j.ympev.2010.01.023
  • Hanada K, Shiu SH, Li WH (2007) The nonsynonymous/synonymous substitution rate ratio versus the radical/conservative replacement rate ratio in the evolution of mammalian genes. Molecular Biology and Evolution 24: 2235–2241. https://doi.org/10.1093/molbev/msm152
  • Huang ZH, Tu FY, Liu XH (2016) Determination of the complete mitogenome of Spotted Dove, Spilopelia chinensis (Columbiformes: Columbidae). Mitochondrial DNA Part A 27: 4224–4225. https://doi.org/10.3109/19401736.2015.1022750
  • Hung CM, Lin RC, Chu JH, Yeh CF, Yao CJ, Li SH (2013) The de novo assembly of mitochondrial genomes of the extinct Passenger Pigeon (Ectopistes migratorius) with next generation sequencing. PLoS ONE 8: e56301. https://doi.org/10.1371/journal.pone.0056301
  • Integrated Taxonomic Information System [ITIS] (2020) Columbidae. Taxonomic Serial No.: 177061. http://www.itis.gov
  • Jang KH, Ryu SH, Kang SG, Hwang UW (2016) Complete mitochondrial genome of the Japanese Wood Pigeon, Columba janthina (Columbiformes, Columbidae). Mitochondrial DNA Part A 27: 2165–2166. https://doi.org/10.3109/19401736.2014.982608
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) Modelfinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/nmeth.4285
  • Kan XZ, Li XF, Zhang LQ, Chen L, Qian CJ, Zhang XW, Wang L (2010) Characterization of the complete mitochondrial genome of the Rock Pigeon, Columba livia (Columbiformes: Columbidae). Genetics and Molecular Research 9: 1234–1249. https://doi.org/10.4238/vol9-2gmr853
  • Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30: 3059–3066. https://doi.org/10.1093/nar/gkf436
  • Korzun LP, Erard C, Gasc JP, Dzerzhinsky FJ (2008) Bill and hyoid apparatus of pigeons (Columbidae) and sandgrouse (Pteroclididae): a common adaptation to vegetarian feeding? Comptes Rendus Biologies 331: 64–87. https://doi.org/10.1016/j.crvi.2007.10.003
  • Kretschmer R, Furo IO, Gomes AJB, Kiazim LG, Gunski RJ, Del Valle Garnero A, Pereira JC, Ferguson-Smith MA, Corrêa de Oliveira EH, Griffin DK, Freitas TRO, O’Connor RE (2020) A comprehensive cytogenetic analysis of several members of the family Columbidae (Aves, Columbiformes). Genes 11(6): e632. https://doi.org/10.3390/genes11060632
  • Kumar S, Stecher G, Tamura K (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33: 1870–1874. https://doi.org/10.1093/molbev/msw054
  • Lerner HRL, Mindell DP (2005) Phylogeny of eagles, Old World vultures, and other Accipitridae based on nuclear and mitochondrial DNA. Molecular Phylogenetics and Evolution 37: 327–346. https://doi.org/10.1016/j.ympev.2005.04.010
  • Liu HY, Sun CH, Zhu Y, Zhang QZ (2020) Complete mitogenomic and phylogenetic characteristics of the Speckled Wood-pigeon (Columba hodgsonii). Molecular Biology Reports 47: 3567–3576. https://doi.org/10.1007/s11033-020-05448-w
  • Lowe TM, Chan PP (2016) tRNAscan–SE on–line: search and contextual analysis of transfer RNA genes. Nucleic Acids Research 44: W54–W57. https://doi.org/10.1093/nar/gkw413
  • Luo X, Qu YH, Han LX, Li SH, Lei FM (2008) A phylogenetic analysis of laughing thrushes (Timaliidae: Garrulax) and allies based on mitochondrial and nuclear DNA sequences. Zoologica Scripta 38: 9–22. https://doi.org/10.1111/j.1463-6409.2008.00355.x
  • Martins G, Balbino E, Marques A, Almeida C (2019) Complete mitochondrial genomes of the Spondias tuberosa Arr. Cam and Spondias mombin L. reveal highly repetitive DNA sequences. Gene 720: 144026. https://doi.org/10.1016/j.gene.2019.144026
  • Nabholz B, Lanfear R, Fuchs J (2016) Body mass-corrected molecular rate for bird mitochondrial DNA. Molecular Ecology 25: 4438–4449. https://doi.org/10.1111/mec.13780
  • Pacheco MA, Battistuzzi FU, Lentino M, Aguilar RF, Kumar S, Escalante AA (2011) Evolution of modern birds revealed by mitogenomics: timing the radiation and origin of major orders. Molecular Biology and Evolution 28: 1927–1942. https://doi.org/10.1093/molbev/msr014
  • Pereira SL, Johnson KP, Clayton DH, Baker AJ (2007) Mitochondrial and nuclear DNA sequences support a Cretaceous origin of Columbiformes and a dispersal-driven radiation in the Paleogene. Systematic Biology 56: 656–672. https://doi.org/10.1080/10635150701549672
  • Perna NT, Kocher TD (1995) Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. Journal of Molecular Evolution 41: 353–358. https://doi.org/10.1007/BF01215182
  • Reddy S, Kimball RT, Pandey A, Hosner PA, Braun MJ, Hackett SJ, Han KL, Harshman J, Huddleston CJ, Kingston S, Marks BD, Miglia KJ, Moore WS, Sheldon FH, Witt CC, Yuri T, Braun EL (2017) Why do phylogenomic data sets yield conflicting trees? Data type influences the avian tree of life more than taxon sampling. Systematic Biology 66: 857–879. https://doi.org/10.1093/sysbio/syx041
  • Sammler S, Bleidorn C, Tiedemann R (2011) Full mitochondrial genome sequences of two endemic Philippine hornbill species (Aves: Bucerotidae) provide evidence for pervasive mitochondrial DNA recombination. BMC Genomics 12: e35. https://doi.org/10.1186/1471-2164-12-35
  • Sangster G, Alström P, Forsmark E, Olsson U (2010) Multi-locus phylogenetic analysis of Old World chats and flycatchers reveals extensive paraphyly at family, subfamily and genus level (Aves: Muscicapidae). Molecular Phylogenetics and Evolution 57: 380–392. https://doi.org/10.1016/j.ympev.2010.07.008
  • Sangster G, García-R JC, Trewick SA (2015) A new genus for the Lesser Moorhen Gallinula angulata Sundevall, 1850 (Aves, Rallidae). European Journal of Taxonomy 153: 1–8. https://doi.org/10.5852/ejt.2015.153
  • Sangster G, Roselaar CS, Irestedt M, Ericson PGP (2016) Sillem’s Mountain Finch Leucosticte sillemi is a valid species of rosefinch (Carpodacus, Fringillidae). Ibis 158: 184–189. https://doi.org/10.1111/ibi.12323
  • Soares AER, Novak BJ, Haile J, Heupink TH, Fjeldså J, Gilbert MTP, Poinar H, Church GM, Shapiro B (2016) Complete mitochondrial genomes of living and extinct pigeons revise the timing of the columbiform radiation. BMC Evolutionary Biology 16: e230. https://doi.org/10.1186/s12862-016-0800-3
  • Sorenson MD, Oneal E, García-Moreno J, Mindell DP (2003) More taxa, more characters: the Hoatzin problem is still unresolved. Molecular Biology and Evolution 20: 1484–1498. https://doi.org/10.1093/molbev/msg157
  • Sun CH, Liu HY, Lu CH (2020) Five new mitogenomes of Phylloscopus (Passeriformes, Phylloscopidae): Sequence, structure, and phylogenetic analyses. International Journal of Biological Macromolecules 146: 638–647. https://doi.org/10.1016/j.ijbiomac.2019.12.253
  • Wang E, Zhang D, Braun MS, Hotz-Wagenblatt A, Pärt T, Arlt D, Schmaljohann H, Bairlein F, Lei F, Wink M (2020) Can mitogenomes of the Northern Wheatear (Oenanthe oenanthe) reconstruct its phylogeography and reveal the origin of migrant birds? Scientific Reports 10: e9290. https://doi.org/10.1038/s41598-020-66287-0
  • Xu N, Zhang QZ, Chen R, Liu HY (2019) The complete mitogenome of Red-collared Lorikeet (Trichoglossus rubritorquis) and its phylogenetic analysis. Mitochondrial DNA Part B 4: 3116–3117. https://doi.org/10.1080/23802359.2019.1667917
  • Yang Z (1994) Maximum likelihood phylogenetic estimation from DNA sequences with variable rates over sites: approximate methods. Journal of Molecular Evolution 39: 306–314. https://doi.org/10.1007/BF00160154
  • Zhang D, Gao FL, Jakovlić I, Zou H, Zhang J, Li WX, Wang GT (2020) PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources 20: 348–355. https://doi.org/10.1111/1755-0998.13096
  • Zhang RH, Xu MJ, Wang CL, Xu T, Wei D, Liu BJ, Wang GH (2015) The complete mitochondrial genome of the Fancy Pigeon, Columba livia (Columbiformes: Columbidae). Mitochondrial DNA 26: 162–163. https://doi.org/10.3109/19401736.2014.1003851
login to comment