Research Article |
|
Corresponding author: Linlin Zhao ( zhaolinlinouc@163.com ) Academic editor: Carole Baldwin
© 2015 Linlin Zhao, Tianxiang Gao, Weihua Lu.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Zhao L, Gao T, Lu W (2015) Complete mitochondrial DNA sequence of the endangered fish (Bahaba taipingensis): Mitogenome characterization and phylogenetic implications. ZooKeys 546: 181-195. https://doi.org/10.3897/zookeys.546.5964
|
To understand the systematic status of Bahaba taipingensis within Sciaenidae, the complete mitochondrial genome (mitogenome) sequence of Chinese bahaba has recently been determined by long PCR and primer walking methods. The complete mitochondrial genome is 16500 bp in length and contains 37 mitochondrial genes (13 protein-coding genes, 2 ribosomal RNA genes and 22 transfer RNA genes) as well as a control region (CR) as other bony fishes. Within the control region, we identified the extended termination associated sequence domain (ETAS), the central conserved sequence block domain (CSB-D, SCB-E and CSB-F) and the conserved sequence block domain (CSB-1, CSB-2 and CSB-3). Phylogenetic analyses revealed that B. taipingensis is more closely related to Pseudosciaeniae than Argyrosominae and Sciaeninae. Additionally, B. taipingensis is the sister taxon of Miichthys miiuy, and those two are sister to Collichthys plus Larimichthys.
Bahaba taipingensis , Sciaenidae , mitochondrial genome, control region, phylogenetic analysis
The complete mitochondrial DNA (mtDNA) sequence of vertebrates is a circular molecule with a length of 16-19 kb that includes 37 genes containing 13 protein-coding genes, 2 ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (CR) (
The family Sciaenidae in the order Perciformes is widely distributed throughout the world with approximately 70 genera and 300 species (Nelson 2006). Fishes of this family are popularly known as croakers and drums because of the ability using muscles associated with gas bladder to produce sound. In China, the family comprises 13 genera with about 37 species, and can be divided into seven subfamilies: Johniinae, Megalonibinae, Bahabinae, Sciaeninae, Otolithinae, Argyrosominae, Pseudosciaeniae (
In this study, we sequenced the complete mtDNA sequence of B. taipingensis for the first time and analyzed its genomic structure. Additionally, we conducted phylogenetic analyses based on the mitochondrial sequence data with the purpose of investigating the phylogenetic position of B. taipingensis within the family Sciaenidae. The information reported in this article will facilitate further investigations of phylogenetic relationships of species in the Sciaenidae.
The sample of B. taipingensis was collected from Dongguan offshore water, Guangdong, China. A piece of muscle tissue excised from the individual was preserved in 95% ethanol for DNA extraction. Total genomic DNA from muscle tissue was extracted with a standard phenol/chloroform procedure followed by ethanol precipitation and kept at 4 °C for subsequent use.
The complete B. taipingensis mitogenome was amplified using a long-PCR technique (
| Segment | Primer code | Nucleotide sequence(5'-3') | Expected product length | Annealling temperature |
|---|---|---|---|---|
| A | H16396-F | TGAGATCACTAACACTCCTGTA | 3064bp | 57 °C |
| H2080-R | GTGACCATGAGTTTAACGG | |||
| B | H2004-F | CGCCTGTTTAACAAAAACAT | 4174bp | 58 °C |
| H6194-R | TAGACTTCTGGGTGGCCAAAGAATCA | |||
| C | H6108-F | CAATGCTTCTAACAGACCG | 3388bp | 57 °C |
| H9516-R | CAAGACCCGGTGATTGGAA | |||
| D | H9428-F | TTGGCTCTACATTCCTAGC | 3554bp | 57 °C |
| H12002-R | TAGGCTAGGAGGAAGAAGA | |||
| E | H11932-F | CTCTTGGTGCAAATCCAAG | 2471bp | 56 °C |
| H14423-R | AGTGCGTCGTTAGCGATTT | |||
| F | H14326-F | AGGACTCTAACCAGGACTA | 2181bp | 56 °C |
| H27-R | CATCTTAACATCTTCAGTGT |
All PCRs were performed in a Takara thermal cycler. Takara Ex-Taq and LA-Taq polymerase (Takara Biomedical) were used for normal and long-PCR reactions, respectively. Long-PCR reactions were carried out in 25 µl reaction mixture containing 15.25 µl of sterile distilled H2O, 2.5 µl of LA-Buffer, 4 µl of dNTP, 1 µl of each primer (5 µM), 0.25 µl of LA-Taq polymerase (1 unit/µl, Takara), and 1 µl of DNA template. The long-PCR reactions consisted of an initial denaturing step at 94 °C for 2 min, followed by 30 cycles of denaturing at 94 °C for 30 s, annealing at about 57 °C for 3 min and a final extension at 72 °C for 15 min. The normal PCR was performed following the standard procedure. Negative controls were included in all PCR amplifications to confirm the absence of contaminants. PCR products were cleaned by adding 0.45 µl of Shrimp Alkaline Phosphatase (Biotech Pharmacon), 0.9 µl of Exonuclease I (GE Healthcare) and 1.65 µl of sterile distilled H2O to 9 µL of PCR product and incubating at 37 °C for 30 min and 80 °C for 20 min. The purified product was then sequenced on ABI Prism 3730 (Applied Biosystems) from both strands with the same primers as those used for PCRs.
Sequence trace files were corrected and aligned with the DNAstar 5.0 software package (DNAstar, Inc.,Wisconsin, USA). The locations of 13 protein-coding genes and 2 rRNA genes were determined by their similarity to published mitogenomes of other Sciaenidae species as shown in Table
| Species | Length/bp | GenBank accession no. |
|---|---|---|
| Family Sciaenidae | ||
| Subfamly Pseudosciaeniae | ||
| Larimichthys crocea | 16466 | EU339149 |
| Larimichthys polyactis | 16470 | FJ618559 |
| Collichthys lucida | 16451 | JN857362 |
| Collichthys niveatus | 16450 | JN678726 |
| Miichthys miiuy | 16493 | HM447240 |
| subfamly Argyrosominae | ||
| Pennahia argentata (China) | 16485 | HQ890946 |
| Pennahia argentata (Japan) | 16486 | KC545800 |
| Nibea albiflora | 16499 | HQ890947 |
| Nibea coibor | 16509 | KM373207 |
| subfamly Sciaeninae | ||
| Dendrophysa russelii | 16626 | JQ728562 |
| family Haemulidae | ||
| Parapristipoma trilineatum | 16546 | NC009857 |
The structure of the control region and its conserves motifs were identified by making a comparison with homologous sequences of reported teleost (
To clarify the phylogenetic position of B. taipingensis within the family Sciaenidae, the complete mitogenome sequences of 9 fish species with 10 complete mitogenome sequences in Sciaenidae (Table
Two different methods, Bayesian inference (BI) and maximum likelihood (ML), were used to construct the phylogenetic tree. Three partitions (first and second codon positions of protein-coding genes, 2 rRNA genes) were set in the combined data set for partitioned Bayesian analyses using MrBayes 3.1.2 (
Maximum likelihood analysis (ML) was performed in PAUP 4.0 (
The complete mitogenome of B. taipingensis was sequenced to be 16500 bp which consisted of 13 typical vertebrate protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 putative control region (CR, Table
| Gene | Position | Size(bp) | Amino acid | Condon Initiation | Stop | Intergenic nucleotide | Stand | |
|---|---|---|---|---|---|---|---|---|
| From | To | Nucleotide | ||||||
| tRNAPhe | 1 | 68 | 68 | 0 | H | |||
| 12S rRNA | 69 | 1017 | 949 | 0 | H | |||
| tRNA Val | 1018 | 1090 | 73 | 0 | H | |||
| 16S rRNA | 1091 | 2792 | 1702 | 0 | H | |||
| tRNALeu(UUR) | 2793 | 2866 | 74 | 0 | H | |||
| ND1 | 2867 | 3841 | 975 | 324 | ATG | TAG | 4 | H |
| tRNA Ile | 3846 | 3915 | 70 | -1 | H | |||
| tRNA Gln | 3915 | 3985 | 71 | -1 | L | |||
| tRNAMet | 3985 | 4054 | 69 | 0 | H | |||
| ND2 | 4055 | 5099 | 1046 | 328 | ATG | TA | 0 | H |
| tRNA Trp | 5100 | 5170 | 71 | 1 | L | |||
| tRNA Ala | 5172 | 5240 | 69 | 2 | L | |||
| tRNA Asn | 5243 | 5315 | 73 | 37 | L | |||
| tRNA Cys | 5353 | 5418 | 66 | 0 | L | |||
| tRNA Tyr | 5419 | 5488 | 70 | 1 | L | |||
| COI | 5490 | 7046 | 1557 | 518 | ATG | AGA | -5 | H |
| tRNASer(UCN) | 7042 | 7112 | 71 | 3 | L | |||
| tRNA Asp | 7116 | 7184 | 69 | 8 | H | |||
| COII | 7193 | 7883 | 691 | 230 | ATG | T | 0 | H |
| tRNA Lys | 7884 | 7957 | 74 | 1 | H | |||
| ATPase8 | 7959 | 8126 | 168 | 55 | ATG | TAA | -10 | H |
| ATPase6 | 8117 | 8799 | 683 | 227 | ATG | TA | 0 | H |
| COIII | 8800 | 9584 | 785 | 261 | ATG | TA | 0 | H |
| tRNA Gly | 9585 | 9655 | 71 | 0 | H | |||
| ND3 | 9656 | 10005 | 349 | 118 | ATG | T | 0 | H |
| tRNA Arg | 10005 | 10073 | 69 | 0 | H | |||
| ND4L | 10074 | 10370 | 297 | 98 | ATG | TAA | -7 | H |
| ND4 | 10364 | 11744 | 1381 | 460 | ATG | T | 0 | H |
| tRNA His | 11745 | 11813 | 69 | 0 | H | |||
| tRNASer(AGY) | 11814 | 11880 | 67 | 5 | H | |||
| tRNALeu(CUN) | 11886 | 11958 | 73 | 0 | H | |||
| ND5 | 11959 | 13797 | 1839 | 612 | ATG | TAG | 4 | H |
| ND6 | 13794 | 14315 | 522 | 173 | ATG | TAA | 0 | L |
| tRNA Glu | 14316 | 14384 | 69 | 4 | L | |||
| Cytb | 14389 | 15529 | 1141 | 380 | ATG | T | 0 | H |
| tRNA Thr | 15530 | 15601 | 72 | 3 | H | |||
| tRNA Pro | 15605 | 15674 | 70 | 0 | L | |||
| Control Region | 15675 | 16500 | 826 | H | ||||
The overall base composition of the B. taipingensis mitogenome was estimated to be 28.2% for A, 31.1% for C, 16.2% for G, and 24.6% for T (Table
Base composition for protein-coding, tRNA, and rRNA genes of B. taipingensis mitogenome.
| Gene/regon | Base composition(%) | A+T | number | |||
|---|---|---|---|---|---|---|
| T | C | A | G | |||
| ND1 | 25.9 | 35.3 | 24.5 | 14.3 | 50.4 | 975 |
| ND2 | 24.6 | 38.1 | 25.6 | 11.7 | 50.2 | 1046 |
| ND3 | 26.4 | 38.1 | 20.9 | 14.6 | 47.3 | 349 |
| ND4 | 24.6 | 35 | 26.1 | 14.3 | 50.7 | 1381 |
| ND4L | 25.6 | 38.7 | 21.9 | 13.8 | 47.5 | 297 |
| ND5 | 26.2 | 33.4 | 28.3 | 12.1 | 54.5 | 1839 |
| ND6 | 12.3 | 35.4 | 38.3 | 14 | 50.6 | 522 |
| COI | 29.2 | 28.7 | 23 | 19.1 | 52.2 | 1557 |
| COII | 27.1 | 28.9 | 28.5 | 15.5 | 55.6 | 691 |
| COIII | 28.3 | 31.2 | 23.6 | 16.9 | 51.9 | 785 |
| ATP6 | 25.2 | 38.4 | 23.4 | 13 | 48.6 | 683 |
| ATP8 | 23.2 | 33.3 | 32.8 | 10.7 | 56 | 168 |
| Cytb | 26.8 | 35 | 24 | 14.2 | 50.8 | 1141 |
| Protein coding | ||||||
| 1st | 29.1 | 30.6 | 24 | 16.3 | 53.1 | 3630 |
| 2nd | 21.7 | 35.1 | 26.9 | 16.3 | 48.6 | 3630 |
| 3rd | 28.3 | 36.2 | 24.7 | 10.8 | 53 | 3630 |
| Total | 26.4 | 34 | 25.2 | 14.4 | 51.6 | 10890 |
| tRNA | 27.1 | 22.6 | 27.4 | 23.9 | 54.5 | 1553 |
| rRNA | 20.8 | 26.7 | 32.2 | 20.3 | 53 | 2651 |
| D-loop | 30.4 | 22.8 | 31.6 | 15.2 | 62 | 826 |
| Overall | 25.1 | 31.4 | 27.6 | 15.9 | 52.7 | 16500 |
The B. taipingensis genome contained 13 protein-coding genes encoded on the H-strand excluding ND6 gene that was oriented to L-strand. The 13 protein-coding genes were total 11,436 bp in size, accounting for 69.15% of the whole mitogenome. All protein-coding genes initiated with an ATG codon, just as in most vertebrates. Three open reading frames (ATP8, ND4L and ND6) of B. taipingensis ended with TAA, two open reading frames (ND1 and ND5) with TAG, and one open reading frames (COI) with AGA. The remainder used incomplete stop codons, either TA (ND2, ATP6 and COIII) or T (COII, ND3, ND4 and Cytb), probably completed by post-transcriptional polyadenylation (
Nucleotide composition and codon using frequencies were calculated from a concatenated sequence of all protein-coding genes on the H-strand, except for ND6 on the L-strand. The base composition of protein-coding genes revealed weak bias against G (14.4%), especially at third codon positions (10.8%, Table
Like other mitochondrial genomes (
As shown in Table
As in most vertebrates, the major non-coding region in B. taipingensis mitochondrial genome was located between tRNA-Pro and tRNA-Phe. It was determined to be 826 bp in length, longer than other reported Sciaenidae species, and it had an overall base composition that was rich in A and T (A+T=62.0%). By comparing with the recognition sites in some reported fishes (
The additional non-coding region, the putative origin of L-strand replication (OL), was located in a cluster of five tRNA genes (the WANCY region) between the tRNA-Asn and tRNA-Cys genes, almost identical with other Sciaenidae fishes. The putative OL could form a stable stem-loop secondary structure with 20 bp in the stem and 13 bp in the loop (Figure
The phylogenetic trees (the 50% majority-rule consensus tree is shown in Figure
This study was supported by Public Science and the Fundamental Research Funds for the Central Universities (201262022).