Research Article
Print
Research Article
Redescription of Emplectonema viride – a ubiquitous intertidal hoplonemertean found along the West Coast of North America
expand article infoCecili B. Mendes§, Paul Delaney|, James M. Turbeville|, Terra Hiebert, Svetlana Maslakova
‡ University of Oregon, Charleston, United States of America
§ Universidade de São Paulo, São Paulo, Brazil
| Virginia Commonwealth University, Richmond, United States of America
¶ University of Oregon, Eugene, United States of America
Open Access

Abstract

Emplectonema viride Stimpson, 1857, a barnacle predator, is one of the most common and conspicuous intertidal nemerteans found along the West Coast of North America from Alaska to California, but it is currently referred to by the wrong name. Briefly described without designation of type material or illustrations, the species was synonymized with the Atlantic look-alike, Emplectonema gracile (Johnston, 1837) by Coe. Here we present morphological and molecular evidence that E. viride is distinct from E. gracile. The two species exhibit differences in color of live specimens and egg size and are clearly differentiated with species delimitation analyses based on sequences of the partial regions of the 16S rRNA and cytochrome c oxidase subunit I genes. In order to improve nomenclatural stability, we re-describe E. viride based on specimens from the southern coast of Oregon and discuss which species should be the type species of the genus. Emplectonema viride was one of the two species originally included in the genus Emplectonema Stimpson, 1857, but subsequent synonymization of E. viride with E. gracile resulted in acceptance of the Atlantic species, E. gracile, as the type species of the genus. We resurrect E. viride Stimpson, 1857 and following Corrêa’s designation, this should be the type species of the genus Emplectonema.

Keywords

Cryptic species, marine diversity, Nemertea, species delimitation

Introduction

The genus Emplectonema was established by Stimpson (1857) for two species: a European species Borlasia camillea Quatrefages, 1846 and the newly described Emplectonema viride Stimpson, 1857 from the Pacific coast of North America (San Francisco Bay, CA). Stimpson did not specify the type species.

The original description of E. viride is but a few lines in Latin: “Corpus depressum, lineare v. proteum, supra viride, subtis album. Caput subdiscretum, marginibus albis; foveis elongatis bipartitis; fronte emarginata. Ocellorum acervi quattuor; posteriores distincti, rotundati, ocellis confertis; anteriores marginales juxta foveas, ocellis sparsis. Long. 11; lat. 0.05 poll. Hab. In portu ‘San Francisco;’ littoralis inter lapillos” (Stimpson 1857: 163). It lacks illustrations, apparently owing to loss of Stimpson’s plates and material during the great Chicago Fire (Griffin 1898). Griffin (1898), in a posthumously published paper, re-described E. viride based on the material collected during his expeditions to the coast of Alaska and Puget Sound. He characterized the species both internally and externally, provided a drawing of the stylet apparatus, and noted that the specimens from Alaska showed a darker color dorsally. He also noted that E. viride differs from its Atlantic counterpart Emplectonema gracile (Johnston, 1837), by darker body color and “narrower head with sharply defined color patterns” (Griffin 1898). Coe, in his 1901 monograph describing nemerteans from the Harriman Alaska Expedition, synonymized E. viride with E. gracile. He did not cite Griffin’s work (1989) and was apparently unaware of it. Griffin succumbed to pneumonia at the age of 26, shortly before receiving his Doctoral degree from Columbia University.

Emplectonema gracile was first described as Nemertes gracile by Johnston (1837) from the Berwick Bay in the North Sea, and it was later included in the genus Emplectonema by Coe (1901), as a senior synonym of E. viride. Corrêa (1955), in her revision of the genus Emplectonema, specified E. gracile as the type species of the genus, citing priority. Since then, Emplectonema gracile (Johnston, 1837) has been treated as the type species of the genus (Gibson 1995), and all green Emplectonema specimens with a curved central stylet and a slender elongated basis are called by that name, regardless of geographic location.

The species currently recognized as E. gracile is listed as having a wide geographic distribution in the Northern Hemisphere, including Japan (Hokkaido), Russia (Kamchatka Peninsula), the Aleutian Islands, the Atlantic and Pacific coast of North America, northern coasts of Europe, Mediterranean, the Romanian coast of the Black Sea, and Madeira (Gibson 1995; Turbeville 2011; Maslakova, Delaney and Turbeville unpublished observations). This species is commonly found in great numbers, often with individuals intertwined, among barnacles and mussels in natural and anthropogenic environments, where it feeds upon acorn barnacles.

Here we present molecular and morphological evidence that E. viride is a separate species from E. gracile. We compare the two cryptic species and re-describe E. viride, the type species of the genus Emplectonema, as designated by Corrêa (1955).

Materials and methods

Sampling

Clusters of acorn barnacles, typically Balanus glandula Darwin, 1854, were collected from intertidal zones at two locations in southern Oregon (Oregon Scientific Take Permits #22780 and 23609) in 2019 and 2020 by C. Mendes and S. Maslakova (Table 1, Suppl. material 1). Some of the worms were removed from the barnacles in the field, but others were entangled, so barnacles were taken to the laboratory, placed in trays, and covered with seawater until the worms crawled out. Worms were removed and kept in 150 ml glass dishes in a sea table with running seawater at ambient sea temperature (12–15 °C). Seven specimens were obtained from pilings near the Charleston Marina in November 2019, and one specimen from the Oregon Institute of Marine Biology (OIMB) Boathouse dock site was collected in October 2019 (Table 1, Suppl. material 1). Additional 10 specimens were collected from the same location in April 2019 (Table 1, Suppl. material 1). Specimens collected by J. Turbeville, in November 2019, from South Carolina were obtained by removing them from mats of the scorched mussel, Brachidontes exustus (Linnaeus, 1758), in the field or allowing them to crawl from detached mussel clumps in plastic bags, pyrex dishes, or buckets containing seawater. An additional six specimens from the same site at Pawleys Island, SC, were collected in 2013 and 2014. Specimens collected in November 2019 were shipped alive to the OIMB and kept in isolation to prevent accidental introduction. As some worms had mature gametes, the non-flow-through water from these individuals was changed regularly and treated with 10% hypochlorite before discarding.

Live worms were photographed with external flash using a Canon Eos 5D Mark III. For close ups, worms were anesthetized with a mixture of 1:1 MgCl2 and seawater. Anterior end and proboscis were removed, gently compressed between a glass slide and a cover slip, and photographed using a Spot 5.2 camera mounted on an Olympus BX51 equipped with DIC optics. Eggs, sperm, and larval stages were photographed similarly. The anterior region of each morphological voucher was fixed in 10% formalin, post-fixed in Bouin’s solution, and stored in 70% ethanol. The posterior region was preserved in 95% ethanol and kept at -20 °C until DNA extraction.

DNA extraction, PCR amplification, and sequence analysis

Genomic DNA was extracted with DNEasy Blood and Tissue kit (Qiagen) following the manufacturer’s protocol. Partial regions of cytochrome c oxidase subunit I (COI) and 16S ribosomal DNA (16S rRNA) were amplified using the primer pairs in Table 2. Polymerase chain reactions (PCR) were carried out using GoTaq Green Master Mix (Promega) as follows: initial denaturation at 95 °C for 2 min; 35 cycles of denaturation at 95 °C for 15 or 40 sec; annealing at 45 °C (COI) or 50 °C (16S) for 40 sec, extension at 72 °C for 1 min; and final extension at 72 °C for 2 min. PCR products were purified either with Wizard SV Gel and PCR Clean-Up System (Promega) or enzymatically with the USB ExoSAP (Thermo Fisher). Purified products were sequenced in both directions using PCR primers at Sequetech DNA Inc. (Mountain View, CA) or Genewiz (South Plainfield, NJ). Sequences were trimmed to remove primer regions and low-quality ends, complementary strands proofread against each other using GeneStudioPro (GeneStudio, Inc.), and COI sequences were checked for stop codons. Resulting sequences are deposited in GenBank (Table 1, Suppl. material 1).

Consensus sequences were aligned in the online version of Mafft software v. 7 (Katoh et al. 2019). Additional GenBank sequences of Emplectonema gracile from European locations and Emplectonema viride (listed as Emplectonema sp. 1) from Oregon were included in the final alignments (Table 1, Suppl. material 1). Alignments were used as input for phylogenetic inference in RAxML v. 8.2.12 (Stamatakis 2014), as available in Cipres (Miller et al. 2012), under GTRGAMMA model with 1,000 bootstraps, and Emplectonema buergeri as the outgroup (GenBank accession HQ848600 and JF277616). Resulting trees (phylograms) from each dataset were used as input for PTP (Poisson tree process; Zhang et al. 2013) with default parameters. The alignments were also used as input in Automatic Barcoding Gap Discovery (ABGD) online software (Puillandre et al. 2012) with default values for all parameters. FASTA files were converted to Nexus format with PGDSpider v. 2.1.1 (Lischer and Excoffier 2012) and used as input for haplotype network constructions in PopArt v. 1.7 (Leigh and Bryant 2015) using the TCS (Templeton et al. 1992) algorithm. Datasets used in Popart were trimmed to the length of the shortest sequence to avoid biases.

Results

Species delimitation analysis

Independent phylogenetic analyses from each gene region apportioned the specimens into two main clades with high support, corresponding to sampling location. Specimens from the Pacific Ocean (Emplectonema viride) form one clade, and specimens from the Atlantic Ocean and North Sea (Emplectonema gracile) form another (Fig. 1). Results from the PTP analysis using the maximum likelihood search indicate that these two clades represent a single species each (Fig. 1, Suppl. material 2). The result from the Bayesian solution presents each specimen of E. viride as a different species (results not shown). These trees, however, do not show any signs of geographic influence, with specimens from the North Sea distributed among the specimens from the Atlantic coast of North America. ABGD analysis of the COI sequences found a barcoding gap at K2P distance of 0.01–0.16, while analysis of the 16S rRNA sequences found a gap at K2P distance of 0.015–0.10. Both datasets delimit the same two groups found by the phylogenetic analysis.

Figure 1. 

Resulting trees from the Maximum Likelihood analysis with RAxML. A: COI phylogeny (lnL = -1520.573862). B: 16S rRNA phylogeny (lnL = -909.477668). Support values above 50 presented in each branch. Branch in purple comprises specimens of Emplectonema gracile. Branch in blue comprises specimens of Emplectonema viride.

The haplotype networks show a low diversity with many mutational steps (85 for COI and 33 for 16S rRNA) between specimens from the Pacific and Atlantic Oceans (Fig. 2). Specimens of E. viride comprise only two haplotypes, in both networks, with one dominant haplotype. The specimens of E. gracile comprise nine haplotypes, with only one shared between the Atlantic and the North Sea, and no dominant haplotype for COI sequences. 16S rRNA sequences of E. gracile comprise three haplotypes, with one dominant haplotype shared between locations.

Figure 2. 

Haplotype networks of Emplectonema gracile (North Sea and NW Atlantic) and Emplectonema viride (NE Pacific) A generated from sequences of COI gene region B generated from sequences of 16S rRNA gene region.

Taxonomy

Class HOPLONEMERTEA Hubrecht, 1879

Order Monostilifera Brinkmann, 1917

Suborder Eumonostilifera Chernyshev, 2003

Family Emplectonematidae Bürger, 1904

Emplectonema Stimpson, 1857

Type species

Emplectonema viride Stimpson, 1857: 163; Griffin 1898: 207.

Emplectonema gracile Coe 1901: 23, fig. 3; Coe 1904: 23, fig. 3; Coe 1905: 207–208, pl. 1, figs 14, 14a, 15, 15a, tex fig. 32; Coe 1940: 252, 278–280, pl. 30, fig. 40; Corrêa 1964: 517–518, 534–536; Kozloff 1999: 98, 100; Roe et al. 2007: 229, 232 pl. 89I.

Material examined

Seven adults from Charleston Marina, OR (43°20.63'N, 124°19.38'W); 27 Nov. 2019; collected from wooden pilings among acorn barnacles, Balanus glandula (Table 1, Suppl. material 1). One specimen from OIMB Boathouse dock, OR (43°20.96'N, 124°19.80'W); 10 Oct. 2019; collected from concrete pilings among acorn barnacles, Balanus glandula (Table 1, Suppl. material 1). Eggs measured from two specimens collected from the jetty at the north end of Bastendorff Beach, OR (43°21.13'N, 124°20.66'W) on 29 Jan. 2020; and sperm from one male collected at Charleston Marina on 31 Jan. 2020. Voucher material is deposited at the Smithsonian Institution’s National Museum of Natural History, Washington, DC: USNM 1638666–USNM 1638673. Each specimen consists of a morphological voucher (anterior end fixed in formaldehyde, post-fixed in Bouin’s solution and stored in 70% ethanol) and a tissue sample for DNA extraction (pieces of posterior or midbody in 95% ethanol).

Comparative material

Three females and four non-sexed adults of E. gracile from Pawleys Island, SC (33°24.63'N, 79°7.88'W); 29 Nov. 2019; among scorched mussels, Brachidontes exustus on granite rocks; GenBank and NMNH accession numbers in Table 1.

Table 1.

Sampling locations, specimen ID, and accession numbers. Morphological vouchers listed in bold. † Sequences previously available in GenBank.

Species Abbreviation Sampling location NMNH # GenBank accession COI GenBank accession 16S rRNA
Emplectonema viride CH_OR_1_E_viride OIMB Boathouse dock, OR MT649099 MT647808
CH_OR_2_E_viride MT649110 MT647809
CH_OR_3_E_viride MT649101 MT647812
CH_OR_4_E_viride MT649102 MT647811
CH_OR_5_E_viride MT649109 MT647814
CH_OR_6_E_viride MT649100 MT647815
CH_OR_7_E_viride MT649103 MT647816
CH_OR_8_E_viride MT649104 MT647807
CH_OR_9_E_viride MT649105 MT647818
CH_OR_10_E_viride MT649106 MT647817
CH_OR_11_E_viride OIMB Boathouse dock, OR USNM 1638666 MT649107 MT647813
CH_OR_12_E_viride Charleston Marina, OR USNM 1638667 MT649114 MT647820
CH_OR_13_E_viride USNM 1638668 MT649115 MT647810
CH_OR_14_E_viride USNM 1638669 MT649108 MT647821
CH_OR_15_E_viride USNM 1638670 MT649111 MT647824
CH_OR_16_E_viride USNM 1638671 MT649116 MT647823
CH_OR_17_E_viride USNM 1638672 MT649112 MT647819
CH_OR_18_E_viride USNM 1638673 MT649113 MT647822
E4H2 Charleston, OR KU197596 KU197260
E5B5 KU197597 KU197261
E5B6 KU197598 KU197262
E5B7 KU197599 KU197263
Emplectonema gracile PI_SC_1_E_gracile Pawleys Island, SC MT649119 MT647832
PI_SC_2_E_gracile MT649121 MT647827
PI_SC_3_E_gracile MT649127 MT647825
PI_SC_4_E_gracile MT649117 MT647830
PI_SC_5_E_gracile MT649124 MT647829
PI_SC_6_E_gracile MT649125 MT647834
PI_SC_7_E_gracile Pawleys Island, SC USNM 1638674 MT649126 MT647828
PI_SC_8_E_gracile USNM 1638675 MT649122 MT647835
PI_SC_9_E_gracile USNM 1638676 MT649123 MT647826
PI_SC_10_E_gracile USNM 1638677 MT649118 MT647831
PI_SC_11_E_gracile USNM 1638678 MT649120 MT647833
PI_SC_12_E_gracile USNM 1638679
PI_SC_13_E_gracile USNM 1638680
PI_SC_14_E_gracile USNM 1638681
Salcombe, UK AJ436903 AJ436793
DNA10615 Crosby, UK HQ848620 JF277621
NemBar0378 Sweden KU839979
NemBar0400 KU839991
NemBar0401 KU839992
NemBar0402 KU839993
NemBar0403 KU839994
NemBar0404 KU839995
K21 Spain KU697656
Table 2.

Primer pairs utilized in this study.

Gene Forward primer Reverse primer Reference
COI HCO1490 – GGTCAACAAATCATAAAGATATTGG LCO2198 – AAACTTCAGGGTGACCAAAAAATCA Folmer et al. 1994
16S rRNA 16SARL – CGCCTGTTTATCAAAAACAT 16SBRH – CCGGTCTGAACTCAGATCACGT Palumbi et al. 1991
16S rRNA 16SKr – AATAGATAGAAACCAACCTGGC Jon Norenburg unpublished

Description

Based on specimens from Oregon, body long and thread-like, 35–103 mm long, 0.6–1.0 mm wide. However, Griffin (1898) found specimens nearly 1 m long. Dark green dorsally, cream-colored or pale yellow ventrally (Fig. 3A). Head round, slightly wider than adjacent body when moving freely, with whitish-yellow or cream-colored margins matching the color of the ventral side (Fig. 3B). A pair of small cerebral organ furrows (anterior cephalic furrows), each shaped as a small arch, is located ventrally, anterior to cerebral ganglia (Fig. 3C). Head furrow (posterior cephalic furrow) is shaped as a dorsal posteriorly directed “V” located behind the cerebral ganglia, and only just barely noticeable in some individuals, and not detectable in many individuals. Rhynchostomopore is a small antero-ventral opening. Numerous small ocelli arranged in two groups on each side of head. Each anterior group has 8–10 eyes arranged in a narrow row along the anterior margin of the head. Each posterior group has 10–12 eyes in a dispersed cluster in front of the brain (Fig. 3B). Cerebral ganglia are pinkish and show through the body wall, especially in lighter-colored individuals. Cerebral organs are not easily distinguishable in life, but with slight compression. Posterior tip of body tapered.

Figure 3. 

Photomicrographs of Emplectonema viride (A–D) and Emplectonema gracile (E–H). Abbreviations: cerebral ganglia, cg; rhynchostomopore, rh; cerebral organ opening, co. Scale bars: 10 mm (A, E); 0.5 mm (B, F); 100 μm (D, H).

Rhynchocoel is short, approximately 1/3 of body length. Central stylet slightly curved, 170–326 μm long (n = 7), smooth. Basis is slender, 480–815 μm long (n = 7), its distal end abruptly widening into a truncated bulb (Fig. 3C). Basis length/width ratio 11.5–16.0. Basis/stylet length ratio 2.0–2.8. Two accessory stylet pouches, each with 9–13 accessory stylets (Fig. 3C). Proboscis bulb elongated. Lateral intestinal diverticula beginning at posterior of rhynchocoel, present until posterior tip of the body. Separate sexes. Gonads serially arranged between intestinal diverticula. Testes of mature males are visible through the body wall as whitish sacs. Ovaries of mature females are visible through the body wall, and the oocytes are orange to light pink, with distinct germinal vesicles. Spermatozoa with elongated head 16–20 μm. Oocytes are 110–140 μm in diameter and surrounded by a tight chorion and a jelly coat (Fig. 4).

Figure 4. 

Photomicrography of egg (A) and sperm (B) of Emplectonema viride. Scale bars: 25 μm.

Reproduction and larval development

Reproductive individuals of E. viride were collected in Charleston, OR, in September 2009, October 2019, January 2020, and June 2020. When ripe, males and females free-spawn gametes into the water, with no known reliable spawning cue. Swimming larvae hatch from the egg chorion after ~30 h and begin feeding on small planktonic crustaceans after developing a functional proboscis and stylet (~4 d). Planktonic period lasts several months (Mendes unpublished observations). Wild-caught larvae of E. viride were found in the plankton samples taken with 50–153 μm net at the Charleston Marina, OR, in October 2013, March 2019, February 2020, and June 2020. Emplectonema viride larvae are easily recognized by their distinctive green color (Fig. 5).

Figure 5. 

Larva of Emplectonema viride collected from plankton in Charleston, OR, on 17 Oct 2013. Same individual is shown in two focal planes to highlight apical tuft (upper left, A) and posterior cirrus (lower right, A) and green epidermal pigment (B). Note paired subepidermal eyes, which are anterior to cerebral organs. Scale bar: 100 μm.

Distribution

Northeastern Pacific Ocean from Alaska to California. Type locality is San Francisco Bay, California, USA.

Morphological comparison with Emplectonema gracile

As has been pointed out by Griffin (1898), specimens of E. viride have a darker dorsal surface, with a distinctly lighter colored ventral side and head margins, compared to those of E. gracile (Fig. 3). We confirm this finding and can also add that E. viride has smaller eggs: 110–140 μm (n = 9), compared to 181–198 μm eggs of E. gracile (n = 8). The characteristics of stylet apparatus do not overtly differ in the two species (Fig. 3C, F).

Discussion

Differentiating cryptic species

The simple morphology of nemertean worms makes it notoriously difficult to identify species, and the use of DNA sequence data as well as gamete morphology can help differentiate between morphologically cryptic nemertean species (e.g., Strand and Sundberg 2005; Sundberg et al. 2009a, b, 2016; Chen et al. 2010; Hao et al. 2015; Hiebert and Maslakova 2015; Kajihara et al. 2018; Cherneva et al. 2019). Using mitochondrial sequence data alone can present difficulties in separating phylogenetic and biogeographical signals (Toews and Brelsford 2012 and references therein). However, analyses herein show that both mitochondrial markers exhibit signs of prolonged genetic isolation between the two species. Furthermore, all explicit, non-phylogenetic delimitation analyses in this study (ABGD and the haplotype network) show similar and well-supported results. Importantly, these tests have different strategies of species delimitation. ABGD is based on the pairwise differences between sequences. It uses an algorithm that calculates the divergence between sequences and automatically infers the barcoding gap between groups of sequences (Puillandre et al. 2012). PTP is a tree-based method that uses the number of substitution events as given by branch lengths of an input phylogram to infer intra- and interspecific relationships between sequences (Zhang et al. 2013). The TCS method used to construct haplotype networks has an integrated view of phylogeny and population structure, taking recombination into account. The algorithm collapses sequences into haplotypes, then uses the haplotype frequencies and pairwise comparison to calculate probabilities of relationship between sequences. The haplotypes are only linked when there is over 95% probability of parsimony for their connection (Templeton et al. 1992; Clement et al. 2001). These methods have been used in many delimitation studies with great success (e.g., Jörger et al. 2012; Scarpa et al. 2016; Mills et al. 2017; Pozzi et al. 2020). Therefore, congruent results using these different methods provide strong evidence for separation between E. viride and E. gracile. The morphological similarities between the two species are likely due to shared recent ancestry, but also possibly due to their similar ecology. Both species live among and prey upon barnacles. This similarity in their ecology is likely a strong factor maintaining the morphological traits even after prolonged isolation between populations (Fišer et al. 2018).

The combination of molecular and morphological data presented here confirms the existence of two cryptic species of North American Emplectonema, one from the Pacific and another from the Atlantic coast. Our results support the validity of E. viride described from the Pacific coast (Stimpson 1857; Griffin 1898) and suggest that Coe’s (1901) synonymization of E. viride with E. gracile is unjustified.

Genus type fixation

The genus Emplectonema was established by Stimpson (1857) for Emplectonema viride and Borlasia camillea Quatrefages, 1846 (subsequently treated as a synonym of Amphiporus neesii Örsted, 1844 by McIntosh (1873–1874), Bürger (1895), and others. However, Stimpson (1857) did not designate a type species. According to the Article 67.2 of the ICZN, only the species originally included are eligible to be fixed as the type species of the genus (ICZN 1999). This makes E. gracile ineligible for designation as the type species of the genus. So, which species should become the type of Emplectonema?

DNA-based phylogenies (18S rRNA, COI) suggest that Emplectonema neesii (Örsted, 1844) is not closely related to E. gracile (Strand and Sundberg 2005; Sundberg et al. 2009b). Results of Sundberg et al. (2009b) also show a close relationship between E. neesii and E. buergeri based on COI data, a relationship also supported by morphological similarities. A more recent multi-locus phylogeny of the phylum (Andrade et al. 2011) shows that E. gracile is not closely related to E. buergeri, rendering the genus Emplectonema polyphyletic. Clearly, the two species originally included and eligible to be fixed as the type species of the genus Emplectonema should not belong to the same genus. We follow Correa’s designation of E. gracile as the type species of the genus. Article 69.2.2 of the Code says “If an author designates as type species a nominal species that was not originally included (or accepts another’s such designation) and if, but only if, at the same time he or she places that nominal species in synonymy with one and only one of the originally included species (as defined in Article 67.2), that act constitutes fixation of the latter species as type species of the nominal genus or subgenus” (ICZN 1999). As Corrêa (1955) followed Coe’s (1901) taxonomic view that the taxonomic species, E. gracile includes the nominal species Nemertes gracilis and E. viride, but not Borlasia camillea, the type species has been validly fixed subsequently by Corrêa (1955) as Emplectonema viride (Kajihara personal communication). Therefore, E. viride and not A. neesii should be the type species of Emplectonema. Amphiporus neesii is not an Emplectonema and is treated here as a species incertae sedis.

Acknowledgements

This study was partially funded by São Paulo Research Foundation (FAPESP) grant 2019/10375-8 to CM. TCH was partly supported by the NSF grant OCE-1030453 to Dr Craig Young and SM while carrying out work related to this manuscript. The authors are also thankful to Dr Hiroshi Kajihara, Dr Irina Cherneva, and Dr Jon Norenburg for the helpful comments during the revision of this manuscript.

References

  • Andrade SC, Strand M, Schwartz M, Chen H, Kajihara H, von Döhren J, Sung S, Junoy J, Thiel M, Norenburg JL, Turbeville JM, Giribet G, Sundberg P (2011) Disentangling ribbon worm relationships: multi‐locus analysis supports traditional classification of the phylum Nemertea. Cladistics 28(2): 141–159. https://doi.org/10.1111/j.1096-0031.2011.00376.x
  • Chen H, Strand M, Norenburg JL, Sun S, Kajihara H, Chernyshev AV, Maslakova SA, Sundberg P (2010) Statistical parsimony networks and species assemblages in cephalotrichid nemerteans (Nemertea). PLoS ONE 5(9): e12885. https://doi.org/10.1371/journal.pone.0012885
  • Cherneva IA, Chernyshev AV, Ekimova IA, Polyakova NE, Schepetov DM, Turanov SV, Malakhov VV, Neretina T, Chaban EM, Malakhov VV (2019) Species identity and genetic structure of nemerteans of the “Lineus ruberviridis” complex (Muller, 1774) from Arctic waters. Polar Biology 42(3): 497–506. https://doi.org/10.1007/s00300-018-2438-7
  • Coe WR (1904) The nemerteans. Harriman Alaska Expedition XI. Doubleday, Page & Company, New York, 220 pp.
  • Coe WR (1905) Nemerteans of the West and Northwest Coasts of America. Vol. 47. Bulletin of the Museum of Comparative Zoology at Harvard College, Boston, 319 pp.
  • Coe WR (1940) Revision of the nemertean fauna of the Pacific coasts of North, Central and northern South America. Allan Hancock Pacific Expeditions 2: 247–323.
  • Corrêa DD (1964) Nemerteans from California and Oregon. Proceedings of the California Academy of Sciences 31: 515–558.
  • Darwin C (1854) A monography on the sub-class Cirripedia, with figures of all the species. The Ray Society, London, 684 pp.
  • Fišer C, Robinson CT, Malard F (2018) Cryptic species as a window into the paradigm shift of the species concept. Molecular Ecology 27(3): 613–635. https://doi.org/10.1111/mec.14486
  • Folmer O, Hoeh WR, Black MB, Vrijenhoek RC (1994) Conserved primers for PCR amplification of mitochondrial DNA from different invertebrate phyla. Molecular Marine Biology and Biotechnology 3(5): 294–299.
  • Gibson R (1995) Nemertean genera and species of the world: an annotated checklist of original names and description citations, synonyms, current taxonomic status, habitats and recorded zoogeographic distribution. Journal of Natural History 29(2): 271–561. https://doi.org/10.1080/00222939500770161
  • Hao Y, Kajihara H, Chernyshev AV, Okazaki RK, Sun SC (2015) DNA taxonomy of Paranemertes (Nemertea: Hoplonemertea) with spirally fluted stylets. Zoological Science 32(6): 571–578. https://doi.org/10.2108/zs140275
  • Hiebert TC, Maslakova S (2015) Integrative taxonomy of the Micrura alaskensis Coe, 1901 species complex (Nemertea: Heteronemertea), with descriptions of a new genus Maculaura gen. nov. and four new species from the NE Pacific. Zoological Science 32(6): 615–637. https://doi.org/10.2108/zs150011
  • ICZN (1999) International Code of Zoological Nomenclature. Fourth Edition. The International Trust for Zoological Nomenclature, The Natural History Museum, London, 306 pp.
  • Johnston G (1837) Miscellanea zoologica. II. A description of some planarian worms. Magazine of Zoology and Botany 1: 529–538.
  • Jörger KM, Norenburg JL, Wilson NG, Schrödl M (2012) Barcoding against a paradox? Combined molecular species delineations reveal multiple cryptic lineages in elusive meiofaunal sea slugs. BMC Evolutionary Biology 12(1): e245. https://doi.org/10.1186/1471-2148-12-245
  • Kajihara H, Tamura K, Tomioka S (2018) Histology-free descriptions for seven species of interstitial ribbon worms in the genus Ototyphlonemertes (Nemertea: Monostilifera) from Vietnam. Species Diversity 23(1): 13–37. https://doi.org/10.12782/specdiv.23.13
  • Katoh K, Rozewicki J, Yamada KD (2019) MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20(4): 1160–1166. https://doi.org/10.1093/bib/bbx108
  • Kozloff EN (1999) Marine invertebrates of the Pacific Northwest. University of Washington Press, Seattle and London, 539 pp.
  • Linnaeus C (1758) Systema Naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Editio decima, reformata [10th revised edition], tomus 1. Laurentius Salvius, Holmiae, 824 pp. https://doi.org/10.5962/bhl.title.542
  • Miller MA, Pfeiffer W, Schwartz T (2012) The CIPRES science gateway: enabling high-impact science for phylogenetics researchers with limited resources. In: Proceedings of the 1st Conference of the Extreme Science and Engineering Discovery Environment: Bridging from the Extreme to the Campus and Beyond, New York (USA), July 2012, 39: 1–8. https://doi.org/10.1145/2335755.2335836
  • Mills S, Alcántara-Rodríguez JA, Ciros-Pérez J, Gómez A, Hagiwara A, Galindo KH, Welch DBM, Papakostas S, Riss S, Segers H, Serra M, Shiel R, Smolak R, Snell TW, Stelzer C, Tang CQ, Wallace RL, Fontaneto D, Walsh EJ (2017) Fifteen species in one: deciphering the Brachionus plicatilis species complex (Rotifera, Monogononta) through DNA taxonomy. Hydrobiologia 796(1): 39–58. https://doi.org/10.1007/s10750-016-2725-7
  • Ørsted AS (1844) Entwurf einer systematischen Eintheilung u. speciellen Beschreibung der Plattwürmer auf mikroscopische Mutersuchungen gegründet. Reitzel, Copenhagen, 118 pp.
  • Palumbi SR, Martin A, Romano S, McMillan WO, Stice L, Grabowski G (1991) The Simple Fool’s Guide to PCR, Version 2.0. University of Hawaii, Honolulu, 45 pp.
  • Pozzi L, Penna A, Bearder SK, Karlsson J, Perkin A, Disotell TR (2020) Cryptic diversity and species boundaries within the Paragalago zanzibaricus species complex. Molecular Phylogenetics and Evolution 150: 106887. https://doi.org/10.1016/j.ympev.2020.106887
  • Quatrefages AD (1846) Étude sur les types inférieurs de l’embranchement des Annelés. Annales des Sciences Naturelles (Série 3, Zoologie) 6: 173–303.
  • Roe P, Norenburg JL, Maslakova SA (2007) Nemertea. In: The Light and Smith manual: Intertidal invertebrates from Central California to Oregon. Edited by J.T. Carlton. University of California Press. Berkley, Los Angeles, London, 221–233.
  • Scarpa F, Cossu P, Lai T, Sanna D, Curini-Galletti M, Casu M (2016) Meiofaunal cryptic species challenge species delimitation: the case of the Monocelis lineata (Platyhelminthes: Proseriata) species complex. Contributions to Zoology 85(2): 123–145. https://doi.org/10.1163/18759866-08502001
  • Stimpson W (1857) Prodromus descriptionis animalium evertebratorum quae in expeditione ad oceanum pacificum septemtrionalem a republica federata missa. Pars II. Turbellarieorum nemertineorum. Proceedings of the Academy of Natural Sciences of Philadelphia 1857: 159–165. https://doi.org/10.5962/bhl.title.51447
  • Strand M, Sundberg P (2005) Delimiting species in the hoplonemertean genus Tetrastemma (phylum Nemertea): morphology is not concordant with phylogeny as evidenced from mtDNA sequences. Biological Journal of the Linnean Society 86(2): 201–212. https://doi.org/10.1111/j.1095-8312.2005.00535.x
  • Sundberg P, Vodoti ET, Zhou H, Strand M (2009a) Polymorphism hides cryptic species in Oerstedia dorsalis (Nemertea, Hoplonemertea). Biological Journal of the Linnean Society 98(3): 556–567. https://doi.org/10.1111/j.1095-8312.2009.01310.x
  • Sundberg P, Chernyshev AV, Kajihara H, Kånneby T, Strand M (2009b) Character-matrix based descriptions of two new nemertean (Nemertea) species. Zoological Journal of the Linnean Society 157(2): 264–294. https://doi.org/10.1111/j.1096-3642.2008.00514.x
  • Sundberg P, Andrade SCS, Bartolomaeus T, Beckers P, von Döhren J, Krämer D, Gibson R, Giribet G, Herrera-Bachiller A, Junoy J, Kajihara H, Kvist S, Kanneby T, Sun S, Thiel M, Turbeville JM, Strand M (2016) The future of nemertean taxonomy (phylum Nemertea) – a proposal. Zoologica Scripta 45(6): 579–582. https://doi.org/10.1111/zsc.12182
  • Templeton AR, Crandall KA, Sing CF (1992) A cladistic analysis of phenotypic associations with haplotypes inferred from restriction endonuclease mapping and DNA sequence data. III. Cladogram estimation. Genetics 132(2): 619–633. https://doi.org/10.1093/genetics/132.2.619
  • Turbeville JM (2011) The first record of Emplectonema gracile (Nemertea: Hoplonemertea) on the Atlantic coast of North America. Marine Biodiversity Records 4: E89. https://doi.org/10.1017/S1755267211000947

Supplementary materials

Supplementary material 1 

Table S1

Cecili B. Mendes, Paul Delaney, James M. Turbeville, Terra Hiebert, Svetlana Maslakova

Data type: occurrence

Explanation note: Linked data table of specimens and sequences analyzed in this study. Abbreviations. COI: Cytochrome oxidase I gene fragment; 16S rRNA: 16S ribosomal RNA; †: Sequences previously available in GenBank. Specimens morphologically analyzed marked in bold.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (26.36 kb)
Supplementary material 2 

Figure S2

Cecili B. Mendes, Paul Delaney, James M. Turbeville, Terra Hiebert, Svetlana Maslakova

Data type: phylogenetic

Explanation note: Species delimitation results from PTP for COI (A) and 16S rRNA (B) gene regions. Values on branches are posterior probabilities of those taxa form one species under the PTP model and a flat prior. Red branches indicate taxa that should be considered as part of the same lineage.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (2.42 MB)
login to comment