Research Article |
Corresponding author: E Zhang ( zhange@ihb.ac.cn ) Academic editor: Sven Kullander
© 2021 Dong-Ming Guo, E Zhang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Guo D-M, Zhang E (2021) Re-description of the loach species Leptobotia citrauratea (Teleostei, Botiidae), with the description of L. brachycephala from southern Zhejiang Province, China. ZooKeys 1017: 89-109. https://doi.org/10.3897/zookeys.1017.57503
|
Leptobotia citrauratea (Nichols, 1925), a loach species, originally described from Dongting Lake, was recently rehabilitated, based on the examination of the holotype and non-topotypical specimens. Several field surveys conducted from 2016 to 2019 in Zhejiang, Jiangxi and Hunan Provinces, P.R. China, yielded many specimens of Leptobotia which were initially identified as L. citrauratea. Molecular and morphological analyses of these specimens demonstrated that two distinct species are involved. One was identified as L. citrauratea, represented by specimens from both the Poyang and Dongting Lake (type locality) systems in Jiangxi and Hunan Provinces, and the other species is described as L. brachycephala, represented by specimens from the Ou-Jiang and Qu-Jiang, two coastal rivers of Zhejiang Province, China. Leptobotia brachycephala resembles L. citrauratea and L. micra in having a row of orange dots or an orange stripe along the dorsal mid-line of the body, extending from the nape to the caudal-fin base – a unique character in Leptobotia. Leptobotia brachycephala differs from L. citrauratea and L. micra Bohlen & Šlechtová, 2017, in caudal-fin shape and pelvic-fin insertion and proportional measurements including caudal-fin length, head length, predorsal length and anal-fin length. Its species status was further corroborated by position in a molecular phylogenetic analysis, based on the mitochondrial cyt b gene and its minimum uncorrected p-distance (2.9%) from congeneric species.
Biodiversity, Cypriniformes, morphology, phylogeny, taxonomy
The loach genus Leptobotia was erected by Bleeker (1870) with the simultaneously-described Leptobotia elongata (Bleeker, 1870) as type species by monotypy. The genus is distinguished from other genera of the family Botiidae by the presence of a simple suborbital spine beneath the eye (
Several field surveys conducted by us from 2016 to 2019 in Zhejiang, Jiangxi and Hunan Provinces, yielded many specimens of Leptobotia with a row of orange dots or an orange stripe along the dorsal mid-line and orange or yellowish-brown lateral portion, by which they were initially identified as L. citrauratea. These specimens were recovered in two distinct lineages in a phylogenetic analysis, based on the mitochondrial cytochrome b (cyt b) gene sequences. Morphological analysis also indicated that two distinct species are involved. One of them was identified as L. citrauratea, represented by specimens sampled from the Poyang and Dongting Lake systems. The other species is an undescribed species represented by specimens from the Ou-Jiang and Qu-Jiang in Zhejiang Province. The present study aims to provide a re-description of L. citrauratea, based on fresh topotypical specimens and the formal description of the undescribed species.
Specimens were either initially fixed in 10% formalin and then transferred to 70% ethanol for morphological examination or preserved in 95% ethanol for DNA extraction. Seventy-three specimens from the three species (L. citrauratea, L. elongata and L. brachycephala) were used for morphometric analysis. Voucher specimens are kept in the ichthyological collection of the Museum of Aquatic Organisms at the Institute of Hydrobiology (
Twenty-five measurements (Tables
Morphometric measurements for three species of Leptobotia: L. citrauratea, L. elongata and L. brachycephala.
L. citrauratea | L. elongata | L. brachycephala sp. nov. | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
Dongting Lake (n = 17) | Poyang Lake (n = 12) | Chang-Jiang (n = 22) | Holotype | Paratypes (n = 21) | ||||||
Range Mean±SD | Range Mean±SD | Range Mean±SD | Range | Mean±SD | ||||||
SL (mm) | 47.0–65.3 | 52.9±4.2 | 33.3–42.7 | 37.5±2.6 | 97.8–272.0 | 180.2±52.1 | 63.9 | 43.7–66.8 | 56.1±5.7 | |
Morphometric data | ||||||||||
% of SL | ||||||||||
Body depth | 14.8–18.8 | 16.7±1.4 | 15.7–19.2 | 17.2±1.0 | 17.3–23.7 | 20.0±1.7 | 12.9 | 11.1–15.8 | 12.8±1.1 | |
Body width at dorsal origin | 8.7–12.5 | 10.5±1.1 | 9.7–12.4 | 11.4±0.8 | 8.3–14.9 | 11.4±1.5 | 7.6 | 6.3–9.7 | 8.3±0.9 | |
Head length | 22.5–25.6 | 24.2±0.8 | 23.8–26.8 | 25.4±0.8 | 24.4–31.4 | 27.8±1.8 | 19.9 | 18.4–22.8 | 20.6±1.1 | |
Dorsal-fin length | 14.9–18.0 | 16.9±0.9 | 13.7–16.8 | 14.9±1.0 | 16.3–22.0 | 18.7±1.6 | 10.6 | 9.0–11.6 | 10.3±0.7 | |
Pectoral-fin length | 14.8–21.1 | 17.0±2.0 | 13.8–17.5 | 15.6±1.0 | 14.4–18.2 | 16.8±0.9 | 12.8 | 9.6–14.2 | 11.9±1.1 | |
Pelvic-fin length | 12.7–16.9 | 13.7±1.1 | 12.1–14.3 | 13.3±0.6 | 13.3–16.3 | 14.9±0.7 | 10.2 | 9.1–12.6 | 10.6±0.9 | |
Anal-fin length | 14.7–17.7 | 16.3±0.8 | 13.0–15.9 | 14.2±0.9 | 15.8–20.2 | 18.0±1.2 | 9.3 | 8.1–11.4 | 10.0±0.8 | |
Upper caudal-lobe length | 23.6–26.9 | 25.5±0.9 | 23.6–26.7 | 25.1±1.0 | 23.1–30.0 | 25.9±2.1 | 18.4 | 15.2–20.8 | 17.9±1.5 | |
Median caudal-ray length | 11.5–13.7 | 12.4±0.6 | 13.2–15.0 | 14.2±0.5 | 9.6–13.1 | 10.7±1.0 | 13.0 | 11.5–15.0 | 13.0±0.9 | |
Caudal-peduncle length | 12.1–15.8 | 13.9±0.9 | 12.5–14.2 | 13.3±0.5 | 13.8–17.1 | 15.5±0.9 | 17.3 | 14.6–20.0 | 17.7±1.6 | |
Caudal-peduncle depth | 10.4–12.9 | 11.6±0.7 | 11.3–13.5 | 12.3±0.7 | 10.9–13.8 | 12.1±0.7 | 11.5 | 10.3–14.4 | 11.7±1.1 | |
Caudal-peduncle width | 2.1–3.9 | 2.9±0.7 | 3.2–4.2 | 3.7±0.3 | 2.6–4.8 | 3.6±0.6 | 2.8 | 1.7–4.3 | 3.1±0.8 | |
Predorsal length | 51.4–56.3 | 54.0±1.2 | 52.8–55.3 | 53.9±0.7 | 54.5–58.8 | 56.5±1.2 | 51.7 | 49.9–54.7 | 52.7±1.6 | |
Prepectoral length | 21.7–26.8 | 23.7±1.1 | 23.4–25.5 | 24.5±0.6 | 25.1–31.6 | 28.3±1.8 | 19.7 | 18.9–23.4 | 20.5±1.1 | |
Prepelvic length | 53.2–59.0 | 56.5±1.7 | 52.3–56.0 | 54.4±1.2 | 56.0–61.5 | 57.8±1.6 | 49.2 | 47.9–53.1 | 50.9±1.5 | |
Preanal length | 76.7–81.4 | 79.0±1.3 | 75.0–81.3 | 78.1±1.6 | 75.9–79.8 | 77.4±1.1 | 74.6 | 70.2–76.9 | 73.8±1.6 | |
Vent to anal distance | 6.8–10.3 | 8.9±0.9 | 6.7–8.3 | 7.5±0.6 | 6.1–10.1 | 8.4±1.1 | 10.4 | 7.4–10.7 | 9.3±0.9 | |
Pelvic to anal distance | 19.9–25.7 | 22.9±1.8 | 20.2–23.6 | 21.4±1.1 | 16.5–23.0 | 19.3±1.5 | 24.4 | 20.3–24.6 | 22.0±1.3 | |
% of HL | ||||||||||
Head depth at nape | 56.4–63.1 | 59.3±1.6 | 55.0–62.8 | 58.8±2.0 | 53.6–64.2 | 57.4±2.8 | 51.8 | 49.0–56.8 | 52.8±2.6 | |
Head depth at eye | 42.3–48.4 | 45.8±2.1 | 43.6–49.7 | 47.0±1.8 | 40.5–48.5 | 43.7±2.1 | 38.6 | 37.7–45.8 | 41.8±2.7 | |
Snout length | 35.4–43.9 | 39.6±2.3 | 35.1–42.5 | 38.4±2.0 | 35.7–42.6 | 38.4±2.1 | 36.2 | 35.6–41.8 | 38.2±2.3 | |
Postorbital head length | 48.5–54.8 | 51.6–2.0 | 50.8–55.2 | 52.5±1.6 | 54.5–61.9 | 57.8±1.9 | 55.2 | 52.4–60.0 | 56.2–2.6 | |
Eye diameter | 9.2–12.1 | 10.3±1.0 | 9.3–10.8 | 10.0±0.5 | 4.2–8.4 | 6.0±1.1 | 11.4 | 9.1–12.2 | 10.4±0.9 | |
Interorbital width | 14.5–22.8 | 17.3±2.4 | 16.1–19.6 | 17.7±1.1 | 12.3–17.7 | 14.8±1.5 | 17.2 | 11.7–17.8 | 15.1±2.1 |
Major diagnostic characters amongst three species with a continuous or discontinuous orange line along the dorsal mid-line of the back. Data utilised for L. micra are from Bohlen and Šlechtov (2017).
Character | L. brachycephala sp.nov. (n = 22) | L. citrauratea (n = 29) | L. micra (n = 5) |
---|---|---|---|
Colour on the back of body | A continuous or discontinuous orange line along dorsal mid-line | A row of rounded orange spots along the dorsal mid-line | A row of rounded orange spots along the dorsal mid-line |
Dorsal-fin origin | Slightly posterior to pelvic–fin insertion | Slightly anterior to or superior to pelvic–fin insertion | Slightly posterior to or superior to pelvic–fin insertion |
Caudal-fin shape | Emarginate with rounded lobes; median rays 1.2–1.5 times as long as upper lobe. | Strongly forked, with broadly pointed lobes; median rays 1.7–2.3 times as long as upper lobe. | Moderately forked, with broadly pointed lobes; median rays 1.3–1.4 times as long as upper lobe. |
Predorsal length | 49.9–54.7 | 51.4–56.3 | 58.1–59.0 |
Body depth (% SL) | 11.1–15.8 | 14.8–19.2 | 15.3–18.3 |
Head length (% SL) | 18.4–22.8 | 22.5–26.8 | 23.6–25.9 |
Upper caudal-lobe length (% SL) | 15.2–20.8 | 23.6–26.9 | 18.7–23.9 |
Caudal-peduncle length (% SL) | 14.6–20.0 | 12.1–15.8 | 11.8–13.5 |
Dorsal-fin length (% SL) | 9.0–11.6 | 13.7–18.0 | 11.0–14.6 |
Anal-fin length (% SL) | 8.1–11.4 | 13.0–17.7 | 15.3–16.8 |
Species included in this analysis with specimen voucher, sampling location and basin, haplotype and GenBank accession number; the haplotype with * means downloaded from GenBank.
Species | Specimen voucher | Sampling location | Basin | Haplotype | GenBank no. | Source |
---|---|---|---|---|---|---|
L. brachycephala | 201909034355 | Wenzhou, Zhejiang Prov. | Ou-Jiang | H1 | MT747394 | This study |
L. brachycephala | 201909034354 | Wenzhou, Zhejiang Prov. | Ou-Jiang | H1 | MT747394 | This study |
L. brachycephala | 201909034353 | Wenzhou, Zhejiang Prov. | Ou-Jiang | H1 | MT747394 | This study |
L. brachycephala | 201909034352 | Wenzhou, Zhejiang Prov. | Ou-Jiang | H1 | MT747394 | This study |
L. brachycephala | IHB2017056869 | Quzhou, Zhejiang Prov. | Qu-Jiang | H1 | MT747394 | This study |
L. brachycephala | IHB2017056870 | Quzhou, Zhejiang Prov. | Qu-Jiang | H1 | MT747394 | This study |
L. brachycephala | IHB2017056871 | Quzhou, Zhejiang Prov. | Qu-Jiang | H1 | MT747394 | This study |
L. brachycephala | IHB20181010544 | Qingtian, Zhejiang Prov. | Ou-Jiang | H1 | MT747394 | This study |
L. brachycephala | 201909034349 | Wenzhou, Zhejiang Prov. | Ou-Jiang | H2 | MT747395 | This study |
L. brachycephala | IHB20181010537 | Qingtian, Zhejiang Prov. | Ou-Jiang | H3 | MT747396 | This study |
L. tientainensis | IHB2017056861 | Jingdezhen, Jiangxi Prov. | Rao-He | H1 | MT747348 | This study |
L. tientainensis | IHB2017056836 | Jingdezhen, Jiangxi Prov. | Rao-He | H1 | MT747348 | This study |
L. tientainensis | IHB2017056835 | Jingdezhen, Jiangxi Prov. | Rao-He | H1 | MT747348 | This study |
L. tientainensis | IHB2017056834 | Jingdezhen, Jiangxi Prov. | Rao-He | H1 | MT747348 | This study |
L. tientainensis | IHB2017056833 | Jingdezhen, Jiangxi Prov. | Rao-He | H1 | MT747348 | This study |
L. tientainensis | 201909034356 | Linhai, Zhejiang Prov. | Ling-Jiang | H1 | MT747348 | This study |
L. tchangi | IHB2018099882 | Shaoxing, Zhejiang Prov. | Cao'e-Jiang | H1 | MT747349 | This study |
L. tchangi | IHB2018099861 | Shaoxing, Zhejiang Prov. | Cao'e-Jiang | H1 | MT747349 | This study |
L. tchangi | 201909034361 | Shaoxing, Zhejiang Prov. | Cao'e-Jiang | H1 | MT747349 | This study |
L. tchangi | IHB2018099848 | Quzhou, Zhejiang Prov. | Qu-Jiang | H2 | MT747350 | This study |
L. tchangi | IHB201904029046 | Hangzhou, Zhejiang Prov. | Qiantang-Jiang | H2 | MT747350 | This study |
L. tchangi | IHB201904029045 | Hangzhou, Zhejiang Prov. | Qiantang-Jiang | H2 | MT747350 | This study |
L. tchangi | 201904028852 | Hangzhou, Zhejiang Prov. | Qiantang-Jiang | H2 | MT747350 | This study |
L. tchangi | IHB2018099847 | Quzhou, Zhejiang Prov. | Qu-Jiang | H3 | MT747351 | This study |
L. tchangi | IHB2018099846 | Quzhou, Zhejiang Prov. | Qu-Jiang | H4 | MT747352 | This study |
L. tchangi | IHB2018099845 | Quzhou, Zhejiang Prov. | Qu-Jiang | H4 | MT747352 | This study |
L. tchangi | IHB2018099844 | Quzhou, Zhejiang Prov. | Qu-Jiang | H5 | MT747353 | This study |
L. tchangi | IHB201904029047 | Hangzhou, Zhejiang Prov. | Qiantang-Jiang | H6 | MT747354 | This study |
L. tchangi | IHB201904029044 | Hangzhou, Zhejiang Prov. | Qiantang-Jiang | H6 | MT747354 | This study |
L. taeniops | IHB2017056865 | Nanchang, Jiangxi Prov. | Gan-Jiang | H1 | MT747355 | This study |
L. taeniops | IHB2017056864 | Nanchang, Jiangxi Prov. | Gan-Jiang | H2 | MT747356 | This study |
L. taeniops | 201711015714 | Yiyang, Hunan Prov. | Zi-Shui | H2 | MT747356 | This study |
L. taeniops | 201711015711 | Yiyang, Hunan Prov. | Zi-Shui | H2 | MT747356 | This study |
L. taeniops | 201711015710 | Yiyang, Hunan Prov. | Zi-Shui | H2 | MT747356 | This study |
L. taeniops | 2017101867 | Yuanjiang, Hunan Prov. | Zi-Shui | H2 | MT747356 | This study |
L. taeniops | 2017101866 | Yuanjiang, Hunan Prov. | Zi-Shui | H2 | MT747356 | This study |
L. taeniops | 201711010290 | Yiyang, Hunan Prov. | Zi-Shui | H2 | MT747356 | This study |
L. taeniops | 201711010026 | Yiyang, Hunan Prov. | Zi-Shui | H2 | MT747356 | This study |
L. taeniops | IHB2017056863 | Nanchang, Jiangxi Prov. | Gan-Jiang | H3 | MT747357 | This study |
L. taeniops | 201711015671 | Yiyang, Hunan Prov. | Zi-Shui | H3 | MT747357 | This study |
L. taeniops | 201801016175 | Yiyang, Hunan Prov. | Zi-Shui | H4 | MT747358 | This study |
L. taeniops | 2017101865 | Yuanjiang, Hunan Prov. | Zi-Shui | H5 | MT747359 | This study |
L. rubrilabris | 201904028870 | Neijiang, Sichuan Prov. | Upper Chang-Jiang | H1 | MT747360 | This study |
L. rubrilabris | 201904028867 | Neijiang, Sichuan Prov. | Upper Chang-Jiang | H2 | MT747361 | This study |
L. rubrilabris | 201904028858 | Neijiang, Sichuan Prov. | Upper Chang-Jiang | H2 | MT747361 | This study |
L. rubrilabris | 201904028866 | Neijiang, Sichuan Prov. | Upper Chang-Jiang | H3 | MT747362 | This study |
L. rubrilabris | 201904028865 | Neijiang, Sichuan Prov. | Upper Chang-Jiang | H4 | MT747363 | This study |
L. rubrilabris | 201904028863 | Neijiang, Sichuan Prov. | Upper Chang-Jiang | H5 | MT747364 | This study |
L. punctata | 201909037450 | Baise, Guangxi Prov. | Zhu-Jiang | H1 | MT747365 | This study |
L. punctata | 018099887 | Liuzhou, Guangxi Prov. | Zhu-Jiang | H1 | MT747365 | This study |
L. punctata | 201909037448 | Baise, Guangxi Prov. | Zhu-Jiang | H2 | MT747366 | This study |
L. punctata | 201909037447 | Baise, Guangxi Prov. | Zhu-Jiang | H2 | MT747366 | This study |
L. punctata | 201909037446 | Baise, Guangxi Prov. | Zhu-Jiang | H3 | MT747367 | This study |
L. punctata | 201909037445 | Baise, Guangxi Prov. | Zhu-Jiang | H4 | MT747368 | This study |
L. punctata | 018099886 | Liuzhou, Guangxi Prov. | Zhu-Jiang | H4 | MT747368 | This study |
L. punctata | 018099885 | Liuzhou, Guangxi Prov. | Zhu-Jiang | H5 | MT747369 | This study |
L. pellegrini | IHB2018099886 | Liuzhou, Guangxi Prov. | Zhu-Jiang | H1 | MT747370 | This study |
L. pellegrini | IHB2018099885 | Liuzhou, Guangxi Prov. | Zhu-Jiang | H2 | MT747371 | This study |
L. pellegrini | IHB2018099884 | Liuzhou, Guangxi Prov. | Zhu-Jiang | H2 | MT747371 | This study |
L. pellegrini | IHB2018099840 | Liuzhou, Guangxi Prov. | Zhu-Jiang | H2 | MT747371 | This study |
L. pellegrini | IHB2018099839 | Liuzhou, Guangxi Prov. | Zhu-Jiang | H2 | MT747371 | This study |
L. pellegrini | 201909034360 | Liuzhou, Guangxi Prov. | Zhu-Jiang | H2 | MT747371 | This study |
L. pellegrini | 201909034359 | Liuzhou, Guangxi Prov. | Zhu-Jiang | H2 | MT747371 | This study |
L. pellegrini | 201909034358 | Liuzhou, Guangxi Prov. | Zhu-Jiang | H2 | MT747371 | This study |
L. microphthalma | 201904028856 | Neijiang, Sichuan Prov. | Upper Chang-Jiang | H1 | MT747372 | This study |
L. microphthalma | 201904028850 | Neijiang, Sichuan Prov. | Upper Chang-Jiang | H1 | MT747372 | This study |
L. microphthalma | 201904028855 | Neijiang, Sichuan Prov. | Upper Chang-Jiang | H2 | MT747373 | This study |
L. microphthalma | IHB2016105308 | Leshan, Sichuan Prov. | Min-Jiang | H2 | MT747373 | This study |
L. microphthalma | IHB2016105306 | Leshan, Sichuan Prov. | Min-Jiang | H2 | MT747373 | This study |
L. microphthalma | IHB2016105311 | Leshan, Sichuan Prov. | Min-Jiang | H3 | MT747374 | This study |
L. microphthalma | IHB2016105307 | Leshan, Sichuan Prov. | Min-Jiang | H3 | MT747374 | This study |
L. microphthalma | IHB2016105310 | Leshan, Sichuan Prov. | Min-Jiang | H4 | MT747375 | This study |
L. microphthalma | IHB2016105309 | Leshan, Sichuan Prov | Min-Jiang | H5 | MT747376 | This study |
L. hengyangensis | 2017042831 | Hengyang, Hunan Prov | Xiang-Jiang | H1 | MT747377 | This study |
L. hengyangensis | 2017042828 | Hengyang, Hunan Prov | Xiang-Jiang | H2 | MT747378 | This study |
L. guilinensis | 2015040820 | Guilin, Guangxi Prov | Zhu-Jiang | H1 | MT747379 | This study |
L. guilinensis | 2015040812 | Guilin, Guangxi Prov | Zhu-Jiang | H1 | MT747379 | This study |
L. guilinensis | 2015040811 | Guilin, Guangxi Prov | Zhu-Jiang | H1 | MT747379 | This study |
L. guilinensis | 2015040810 | Guilin, Guangxi Prov | Zhu-Jiang | H1 | MT747379 | This study |
L. guilinensis | 2015040805 | Guilin, Guangxi Prov | Zhu-Jiang | H1 | MT747379 | This study |
L. guilinensis | 2015040818 | Guilin, Guangxi Prov | Zhu-Jiang | H2 | MT747380 | This study |
L. guilinensis | 2015040815 | Guilin, Guangxi Prov | Zhu-Jiang | H2 | MT747380 | This study |
L. guilinensis | 2015040813 | Guilin, Guangxi Prov | Zhu-Jiang | H3 | MT747381 | This study |
L. guilinensis | 2015040808 | Guilin, Guangxi Prov | Zhu-Jiang | H4 | MT747382 | This study |
L. elongata | IHB2018059216 | Leshan, Sichuan Prov | Min-Jiang | H1 | MT747383 | This study |
L. elongata | IHB2018059215 | Leshan, Sichuan Prov | Min-Jiang | H2 | MT747384 | This study |
L. elongata | SCULE007 | Unknown | H2* | NC018764 | GenBank | |
L. elongata | Unknown | Luzhou, Sichuan Prov | Upper Chang-Jiang | H2* | AY625715 | GenBank |
L. elongata | IHB2018059214 | Leshan, Sichuan Prov | Min-Jiang | H3 | MT747385 | This study |
L. elongata | 201904028849 | Leshan, Sichuan Prov | Min-Jiang | H4 | MT747386 | This study |
L. elongata | IAPG A214 | Unknown | H5* | AY887779 | GenBank | |
L. elongata | Unknown | Unknown | H6* | KY307845 | GenBank | |
L. citrauratea | IHB2017056860 | Nanchang, Jiangxi Prov | Gan-Jiang | H1 | MT747387 | This study |
L. citrauratea | IHB2017056859 | Nanchang, Jiangxi Prov | Gan-Jiang | H2 | MT747388 | This study |
L. citrauratea | IHB2017056858 | Nanchang, Jiangxi Prov | Gan-Jiang | H3 | MT747389 | This study |
L. citrauratea | 201711016295 | Nanxian, Hunan Prov | Donngting Lake | H3 | MT747389 | This study |
L. citrauratea | 201711015674 | Nanxian, Hunan Prov | Donngting Lake | H3 | MT747389 | This study |
L. citrauratea | IHB2017056857 | Nanchang, Jiangxi Prov | Gan-Jiang | H4 | MT747390 | This study |
L. citrauratea | 201711016297 | Nanxian, Hunan Prov | Donngting Lake | H5 | MT747391 | This study |
L. citrauratea | 201711016296 | Nanxian, Hunan Prov | Donngting Lake | H6 | MT747392 | This study |
L. citrauratea | 201711015675 | Nanxian, Hunan Prov | Donngting Lake | H6 | MT747392 | This study |
L. citrauratea | 201711015716 | Nanxian, Hunan Prov | Donngting Lake | H7 | MT747393 | This study |
L. posterodorsalis | Unknown | Xiaoxi, Hunan Prov | Yuan-Jiang | H1* | MH922928 | GenBank |
P. fasciata | Unknown | Unknown | H1* | AY625710 | GenBank | |
P. lijiangensis | Unknown | Chenxi, Hunan Prov | Yuan-Jiang | H1* | AY625713 | GenBank |
Genomic DNA was extracted from fin clips stored in ethanol using the TIANamp Genomic DNA Kit (Tiangen Biotech, Beijing) with the recommended protocol. The cyt b gene was amplified by primers L14724 (GACTTGAAAAACCACCGTTG) and H15915 (CTCCGATCTCCGGATTACAAGAC) adopted from
A total of 98 cyt b sequences were generated from 12 species of Leptobotia. These sequences were used for phylogenetic analysis together with five sequences from two congeneric species (L. posterodorsalis Lan & Chen, 1992 and L. elongata) and two sequences serving as outgroup (Parabotia fasciata Dabry de Thiersant, 1872 and P. lijiangensis Chen, 1980) downloaded from GenBank (Table
The sequences were aligned utilising MAFFT version 7 (
PhyloSuite (
Botia citrauratea Nichols, 1925: 5 [Tungting [now Dongting] Lake, Hunan Province
Leptobotia elongata: Chen, 1980: 14 (no localities). Kottelat, 2004:15 (no localities); 2012:16 (no locality)
Leptobotia citrauratea: Nalbant, 2002: 316 (no localities). Bohlen & Šlechtová, 2017: 90 (Nanchang City, Jiangxi Province)
Leptobotia citrauratea: AMNH 8402, holotype, 50 mm SL; China: Hunan Province: Dungting Lake (photograph examined); collected by Clifford H. Pope, 29 December 1921;
Lateral (upper) and dorsal (lower) view of L. citrauratea for freshly-caught specimens a
Leptobotia citrauratea shares with L. micra and L. brachycephala the unique presence of a row of orange spots or an orange stripe along the dorsal mid-line of the body, extending from the nape to the caudal-fin base. It differs from L. micra and L. brachycephala by having a deeply forked (vs. emarginate) caudal fin (length of median rays 1.7–2.3 times in length of upper lobe vs. 1.3–1.4 in L. micra and 1.2–1.5 in L. brachycephala), pelvic fin inserted slightly posterior or inferior (vs. slightly anterior in L. brachycephala) to the dorsal-fin origin, a longer head (22.5–26.8% SL vs. 18.4–22.8% SL in L. brachycephala) and a shorter predorsal distance (51.4–56.3% SL vs. 58.1–59% SL in L. micra) (Table
Morphometric data for specimens examined in Tables
Head short, compressed laterally, length greater than maximum body depth. Snout slightly concave in lateral view, slightly shorter than postorbital head. Eye small, dorsolateral, in upper half of head; diameter less than interorbital space. Mouth inferior, with opening laterally extended to vertical through anterior margin of nostril. Button-like fleshy protrusion in gular region absent. Two rostral barbels at tip of snout. Maxillary barbel in corner of mouth, reaching beyond vertical through posterior margin of nostrils, not or just approaching to level of anterior margin of eye. Simple suborbital spine ventral to anterior margin of eye, reaching posterior margin of eye.
Fin rays flexible. Dorsal fin with 4 unbranched and 8 branched rays; distal margin slightly concave; origin slightly anterior to or superior to pelvic-fin insertion and closer to caudal-fin base than to snout tip. Pectoral fin with 1 unbranched and 10–11 branched rays, tip of depressed fin extending about midway between pectoral-fin and pelvic-fin insertion. Pelvic fin with 1 unbranched and 7 branched rays, reaching about half of distance between pelvic-fin insertion and anal-fin origin and just reaching anus. Anus closer to anal-fin insertion than pelvic-fin insertion. Anal fin with 3 unbranched and 5 branched rays, tip of depressed fin not extending to caudal-fin base; distal margin slightly concave. Caudal fin strongly forked, median fin rays 1.7–2.3 times as long as lobes; upper and lower lobes broadly pointed and almost equal in length and shape.
In freshly-collected specimens, ground colour of head and body yellowish-brown or orange; lateral head and flank faintly peppered with dark grey flecks. Dorsal side of head and body dark with some rounded light orange spots usually fused to form an orange stripe extending along mid-line of dorsum from nape to caudal-fin base. Anterior to orange spots or light stripe, an orangish stripe present between eye and nape. Faint dark grey stripe extending from snout tip to anterior margin of eye. Grey bar, similar in width to eye diameter, present on caudal-fin base. In some specimens, caudal fin hyaline, in others with dark grey stripes. Single row of faint dark grey stripes present in dorsal fin.
In specimens preserved in formalin, ground colour slightly faded, not presenting vivid yellowish-brown or orange, but becoming whitish-grey and peppered with dark flecks. Dorsum and head darkened. Orange spots along mid-line of dorsum white. Dorsal, pectoral, pelvic and anal fins greyish-yellow at base with white distal margins. Caudal fin dusky.
Leptobotia citrauratea is known from Dongting Lake in Hunan Province and the Gan-Jiang, discharging into Poyang Lake, in Jiangxi Province, southern China (Fig.
Leptobotia brachycephala, together with L. citrauratea and L. micra, is distinguished from all other congeneric species by the presence (vs. absence) of a row of orange dots or an orange stripe extending along the dorsal mid-line of the body from the nape to the caudal-fin base (Fig.
Lateral (upper) and dorsal (lower) view of body for L. brachycephala: a
Morphometric data given in Tables
Head short, compressed laterally, longer than maximum body depth. Snout slightly obtuse in lateral view, slightly shorter than postorbital head. Eye small, dorsolateral, in upper half of head; diameter less than interorbital width. Mouth inferior, with opening laterally extended to vertical through anterior margin of nostril. Button-like structures in gular region absent; no median incisions in lower lip. Two rostral barbels at tip of snout. Maxillary barbel in corner of mouth, not reaching to level of anterior margin of eye. Simple suborbital spine ventral to anterior margin of eye, not or just reaching posterior margin of eye.
Fin rays flexible. Dorsal fin with 4 unbranched and 8 branched rays; distal margin slightly concave; origin slightly posterior to pelvic-fin insertion and closer to caudal-fin base than to tip of snout. Pectoral fin with 1 unbranched and 10–11 branched rays, not extending to midway from pectoral-fin to pelvic-fin insertion. Pelvic fin with 1 unbranched and 7 branched rays, not extending to halfway to anal-fin origin or not reaching anus; vent closer to anal-fin origin than to pelvic-fin insertion. Anal fin with 3 unbranched and 5 branched rays, not reaching caudal-fin base; distal margin slightly concave; origin closer to pelvic-fin insertion than to caudal-fin base. Caudal fin emarginate or shallowly forked, length of median fin rays 1.3–1.5 times in length of upper lobe; caudal-fin lobes rounded; upper and lower ones almost equal in length and shape.
In freshly-caught specimens, ground colour of head and body brownish-yellow; darker in upper half of head, but lighter in lower half of head and ventral side of body. A continuous or discontinuous orange stripe along mid-line of dorsum from nape to caudal-fin base, becoming more conspicuous towards caudal-fin base. Anterior to orange stripe, a short orange stripe present between eye and anterior margin of nape. A dark grey stripe on basal portion of dorsal fin and one stripe on dorsal fin. A dark grey band at caudal-fin base. Some irregular black stripes on caudal fin with hyaline distal edge. Distinct stripes absent from other fins. Specimens stored in formalin with ground colour of head and body pale brown. Discontinuous or continuous white line along dorsal mid-line of body also faded.
Leptobotia brachycephala is known only from the Ou-Jiang and Qu-Jiang, two coastal rivers of southern Zhejiang Province, China (Fig.
The specific epithet is a Latin version of the Greek words βραχύς (short) and κεφαλά (head), with reference to the short head; to be treated as a noun in apposition.
A total of 50 unique haplotypes were detected amongst the 103 cyt b sequences of species of Leptobotia (Table
Genetic distances of the cyt b gene computed by MEGA 7 amongst 13 analysed species of Leptobotia.
Species | Intraspecific | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 L. tientainensis | n/c | ||||||||||||
2 L. tchangi | 0.003 | 0.078 | |||||||||||
3 L. taeniops | 0.003 | 0.081 | 0.058 | ||||||||||
4 L. rubrilabris | 0.002 | 0.077 | 0.057 | 0.055 | |||||||||
5 L. punctata | 0.004 | 0.106 | 0.104 | 0.111 | 0.096 | ||||||||
6 L. pellegrini | 0.002 | 0.077 | 0.064 | 0.073 | 0.061 | 0.107 | |||||||
7 L. microphthalma | 0.004 | 0.067 | 0.069 | 0.067 | 0.061 | 0.092 | 0.077 | ||||||
8 L. hengyangensis | 0.008 | 0.069 | 0.041 | 0.057 | 0.047 | 0.098 | 0.059 | 0.059 | |||||
9 L. guilinensis | 0.002 | 0.018 | 0.086 | 0.086 | 0.080 | 0.110 | 0.080 | 0.069 | 0.079 | ||||
10 L. elongata | 0.002 | 0.073 | 0.071 | 0.073 | 0.066 | 0.096 | 0.067 | 0.053 | 0.067 | 0.073 | |||
11 L. citrauratea | 0.004 | 0.079 | 0.075 | 0.069 | 0.062 | 0.105 | 0.076 | 0.061 | 0.069 | 0.080 | 0.071 | ||
12 L. posterodorsalis | n/c | 0.066 | 0.069 | 0.074 | 0.068 | 0.104 | 0.069 | 0.070 | 0.066 | 0.069 | 0.068 | 0.065 | |
13 L. brachycephala | 0.001 | 0.076 | 0.072 | 0.071 | 0.064 | 0.106 | 0.065 | 0.064 | 0.066 | 0.078 | 0.067 | 0.029 | 0.060 |
In the Bayesian 50% majority consensus tree, samples of L. brachycephala formed a well-supported (100% pp) lineage and so did those of both L. citrauratea and L. elongata. L. citrauratea was distantly allied to L. elongata, but robustly supported by 100% pp to be sister to L. brachycephala (Fig.
In the Principal Component Analysis of specimens of L. citrauratea from Dongting Lake and the Gan-Jiang and L. brachycephala from the Ou-Jiang and Qu-Jiang, the first three components explained 91.60% of the total variance, of which 64.58%, 19.61% and 7.41% were explained, respectively by PC 1, PC 2 and PC 3 (Table
Loadings of morphological traits on the first three principal components. Variables in bold indicate higher loading values.
Variable | PC1 | PC2 | PC3 |
---|---|---|---|
Standard length | 0.224 | -0.150 | -0.079 |
Body depth | 0.164 | 0.155 | 0.060 |
Body width at dorsal origin | 0.163 | 0.123 | 0.287 |
Head length | 0.169 | 0.050 | -0.002 |
Head depth at nape | 0.165 | 0.173 | 0.108 |
Head depth at eye | 0.148 | 0.150 | 0.112 |
Caudal-peduncle length | 0.288 | -0.445 | -0.100 |
Caudal-peduncle depth | 0.206 | -0.138 | -0.026 |
Caudal-peduncle width | 0.169 | -0.237 | 0.862 |
Dorsal-fin length | 0.197 | 0.375 | -0.025 |
Pectoral-fin length | 0.187 | 0.241 | -0.118 |
Pelvic-fin length | 0.176 | 0.144 | -0.124 |
Anal-fin length | 0.199 | 0.381 | 0.014 |
Upper caudal-lobe length | 0.162 | 0.259 | -0.031 |
Predorsal length | 0.218 | -0.122 | -0.082 |
Prepectoral length | 0.181 | 0.029 | -0.025 |
Prepelvic length | 0.228 | -0.039 | -0.030 |
Preanal length | 0.220 | -0.075 | -0.052 |
Vent to anal-fin origin | 0.325 | -0.242 | -0.216 |
Pelvic-fin insertion to anal-fin origin | 0.256 | -0.130 | -0.059 |
Snout length | 0.186 | 0.076 | 0.072 |
Postorbital head length | 0.170 | -0.035 | -0.087 |
Eye diameter | 0.180 | 0.035 | -0.023 |
Interorbital width | 0.156 | 0.209 | 0.099 |
Median caudal-ray length | 0.147 | -0.168 | -0.119 |
Cumulative variance (%) | 64.6 | 19.6 | 7.4 |
a a copy of Bleeker’ (1870) illustration of L. elongata b lateral view of body for L. elongata in
Ventral view of the mouth of two species a L. rubrilabris,
The specific status of L. brachycephala was confirmed by its morphological and genetic distinction with closely-related congeneric species (Tables
The seventeen species currently included in Leptobotia can be subdivided into six groups, based on their body colourations. The first one is only composed of one species L. taeniops that has a unique body colouration of some irregular purplish-brown stripes in the shape of a worm on the flank, hence resulting in a marbled or vermiculated pattern (Fig.
Leptobotia elongata:
Leptobotia taeniops:
Leptobotia rubrilabris:
Leptobotia tientainensis:
Leptobotia guilinensis:
Leptobotia tchangi:
Leptobotia pellegrini:
Leptobotia hengyangensis:
Leptobotia microphthalma:
Data for L. bellacauda and L. micra were taken from
Our sincere thanks go to Chang-Ting An, Xiao Chen, Wei-Han Shao, Zi-Tong Wang and Hao-Jun Chen for their kind assistance with collecting samples. In addition, we express our deepest gratitude to Liang Cao and Shu-Qing Deng for their help with laboratory analyses. This study was funded by two special funds of Biodiversity Survey, Monitoring and Assessment (2017HB2096001006 and 2019HB2096001006).