Research Article |
Corresponding author: Jernej Bravničar ( jernej.bravnicar@bf.uni-lj.si ) Academic editor: Nina Bogutskaya
© 2020 Jernej Bravničar, Anja Palandačić, Simona Sušnik Bajec, Aleš Snoj.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Bravničar J, Palandačić A, Bajec SS, Snoj A (2020) Neotype designation for Thymallus aeliani Valenciennes, 1848 from a museum topotype specimen and its affiliation with Adriatic grayling on the basis of mitochondrial DNA. ZooKeys 999: 165-178. https://doi.org/10.3897/zookeys.999.56636
|
In 1848, the grayling Thymallus aeliani (Valenciennes) was described from Lake Maggiore, Italy, in the north Adriatic basin. Genetic analyses of the mitochondrial control region showed a unique evolutionary history of grayling inhabiting the rivers of northern Adriatic basin, from the upper reaches of the Po River and its left tributaries in the west to the Soča River in the east, which resulted in the designation of this phylogenetic lineage as Adriatic grayling. Consequently, the name T. aeliani was connected to the Adriatic lineage, re-establishing the validity of this taxon. However, the mitochondrial haplotypes belonging to Adriatic grayling were never compared with the type specimens of T. aeliani, as their whereabouts were unknown. In this study, a neotype for T. aeliani was designated using topotypical specimens stored at the Natural History Museum in Vienna. The neotype (NMW 68027:2 labelled as “Lago Maggiore, Bellotti, 1880”) was designated pursuant to the conditions stipulated in Article 75.3 of the International Code of Zoological Nomenclature. Furthermore, the mitochondrial control region of the neotype was compared to haplotypes of the Adriatic lineage and showed high genetic similarity, which therefore connects the species name T. aeliani to the Adriatic grayling. This crucial step in fixing nomenclatural status of this species is very important for its protection and management.
Adriatic basin, control region, morphology, museum DNA, neotypification, taxonomy
The distribution of variation and disruption of the gene flow are multidimensional and continuous in nature; thus, specialists agree that delineating species can only be arbitrary (Galtier 2018). However, several research fields, such as ecology and macroevolution, and the general public need species as a simplified representation of natural variation. Ideally, biodiversity protection legislation would principally aim to protect management units (MU) or evolutionary significant units (ESU). Nevertheless, the European legislation focuses on endangered species, thereby making the species the basic unit of biodiversity protection. Specimens used to formally describe a species, called type specimens, are indispensable for determining the species affiliation of all subsequently analysed individuals. The absence of a type specimen can potentially be a significant source of nomenclatural instability. Accurate taxonomy is important for the identification of species and the evaluation of their conservation status, and without accurate identification, it is impossible to list those taxa whose existence is at risk and to set appropriate measures for their protection and management (
An example of an endangered entity without a name-bearing type is Adriatic grayling, which represents endemic populations in the Adriatic basin, from the upper reaches of the Po River and its left tributaries in the west to the Soča (Isonzo) River in the east (
In 1848, Thymallus aeliani (Valenciennes) was described on the basis of external morphology of grayling from Lake Maggiore (Po River drainage, Adriatic Basin) (
At present, the whereabouts of the type specimens of T. aeliani are unknown, though they should presumably be deposited at National History Museum in Paris (see Discussion for more details). As such, it is not possible to objectively associate the species name referring to the type specimens from Lake Maggiore with the Adriatic grayling in its modern concept. Thus, neotypification of the Adriatic mt lineage provides the only solution if the name T. aeliani is to be tied indisputably to the Adriatic grayling. Owing to genetic mixing between native and introduced graylings mentioned above, extant populations are not proper candidates for the T. aeliani neotype selection, while no grayling translocations were recorded or discerned in the 19th century (
The aim of this study was to designate a neotype for T. aeliani on the basis of 1) morphological comparison of the museum topotype specimens with the original description by Valenciennes (
To clarify the identity of T. aeliani, four white-eyed, museum topotype specimens registered under catalogue numbers
Measurements and counts (44 and 9, respectively) were taken of the topotype specimens of grayling deposited in the
To link the species name T. aeliani to the Adriatic mt lineage of grayling (Adriatic grayling), we extracted DNA from the museum topotype specimens. Extra care was considered to avoid cross-contamination between specimens. Tissue for DNA extraction was taken from the right lateral fin, using sterilised and UV-irradiated utensils. Laboratory work was performed in a DNA clean room. For DNA extraction, QIAamp DNA Blood Mini Kit (Qiagen) was used, following the manufacturer’s protocol. All extractions included extraction controls to ensure there was no contamination of the buffers. DNA concentrations were quantified using a Qubit4 fluorometer (ThermoFisher Scientific, USA) and integrity checked on 1% agarose gel electrophoresis.
The complete mt CR was amplified using seven primer pairs (Table
All reactions were amplified using AmpliTaq Gold DNA polymerase (Applied Biosystems, USA) in 25 µl reactions according to manufacturer protocol with the use of an enhancer 360 GC, supplied by the manufacturer. Amplification was performed on a Veriti Thermal Cycler (Applied Biosystems, USA) using a simple two-step protocol with 10 min initial denaturation at 95 °C, 5 cycles of 30 sec denaturation at 95 °C, 30 sec annealing stage at 55 °C, and 30 sec elongation stage at 72 °C, followed by 40 cycles at 52 °C annealing temperature and final elongation stage of 7 min. Amplicons were checked for size on 1% agarose gel electrophoresis, purified with a Qiagen PCR purification kit and sequenced in both directions by LGC genomics (Berlin, Germany) using PCR primers. Sequences were checked visually and merged into a single sequence using BIOEDIT software (
The phylogenetic tree was constructed using Bayesian inference (BI) in BEAST 2.5.2 (
Measurements and counts are presented in Table
DNA concentrations of isolates ranged from 25.8–29.4 ng/µl. Amplification and sequencing were successful in all four samples for each of the seven fragments. Length of overlapping fragments resulted in 1088 bp combined alignment of complete mt CR for each sample. No discrepancy in sequence between overlapping parts of fragments in any of the sample was observed, thus excluding possible contamination. A single haplotype was identified in all four specimens, and this sequence was deposited in the NCBI GenBank as Thymallus aeliani under accession number MT762347.
Alignment included CR sequences of grayling and the outgroup from GenBank and resulted in a total length of 1093 bp. Comparison of the sequence of topotype specimens to those in the NCBI database revealed that all four specimens carry the haplotype previously observed in grayling from the Adige and Adda Rivers and designated as Ad7 (GenBank acc. no. JN796420;
A phylogenetic Bayesian inference tree (Fig.
Our findings regarding the fate of the syntypes for T. aeliani leading up to the neotypification for the Adriatic grayling are summarised below. The designation of the neotype, its morphological description and genetic identity of the neotype and the Adriatic mt lineage of grayling are discussed.
The main obstacle for the clear and indisputable clarification of the taxonomic position of T. aeliani was the inability to compare the Adriatic grayling with type specimens of the species. The syntypes of T. aeliani (in
Accordingly, a female specimen
The morphology of the neotype fits the original description by Valenciennes (
Catalogue number | Designated name | Year of collection | Locality | Preservative |
---|---|---|---|---|
|
T. vexillifer | 1880 | Lake Maggiore | Ethanol |
|
T. vexillifer | 1880 | Lake Maggiore | Ethanol |
|
T. aeliani | 1881 | Lake Maggiore | Ethanol |
|
T. aeliani | 1881 | Lake Maggiore | Ethanol |
Primers designed and used to sequence the complete mt CR of museum specimens. F: forward strand, R: reverse strand.
Fragment | Publication name | 5–3´ | F/R | Length (bp) |
---|---|---|---|---|
A | LRBT-25 | AGAGCGCCGGTGTTGTAATC | F | 267 |
Thy_mus_A_rev | TGTGCTGATGTATGAGGGGT | R | ||
B | Thy_mus_B_for | CCTCTGACGCGCCTATGTTA | F | 335 |
Thy_mus_B_rev | TCGTTGGTCGGTTCTTACTACA | R | ||
C | Thy_mus_C_for | ACCCCTCATACATCAGCACA | F | 338 |
Thy_mus_C_rev | AGGTTAACCGCATCAACCAGA | R | ||
D | Thy_mus_D_for | AAGAACCGACCAACGATTTA | F | 301 |
Thy_mus_D_rev | TTCAAAGTTTAGTTCGACCTTATTAGT | R | ||
E | Thy_mus_E_for | CATGCATCTGGTTGATGCGG | F | 340 |
Thy_mus_E_rev | CGCGTAGAAGCCGGGGGA | R | ||
F | Thy_mus_F_for | AGAACTAATAAGGTCGAACTAAACT | F | 231 |
Thy_mus_F_rev | AGCGCTAATCGAGACTTCCTG | R | ||
G | Thy_mus_G_for | GAnTCCCCCGGCTTCTAC | F | 306 |
LRBT-1195 | GCTAGCGGGACTTTCTAGGGTC | R |
Measurements and counts of four historical
|
68027:1 | 68027:2 | 68090:1 | 68090:2 | Mean; SD |
---|---|---|---|---|---|
MEASURMENTS | |||||
Lsm, mm (fork length) | 282.6 | 267.7 | 289.9 | 282.3 | 280.6; 9.3 |
% Lsm | |||||
body length to base of caudal fin | 93.6 | 93.3 | 94.9 | 94.7 | 94.1; 0.8 |
trunk length | 75.9 | 75.9 | 78.7 | 77.6 | 77; 1.4 |
preanal distance | 68.6 | 69.5 | 70.5 | 70.6 | 69.8; 0.9 |
predorsal distance | 33.1 | 36 | 33.1 | 34.2 | 34.1; 1.4 |
prepelvic distance | 45.5 | 43.7 | 46.6 | 46.5 | 45.6; 1.4 |
distance between pectoral and pelvic fins | 27.4 | 26.5 | 30 | 30.1 | 28.5; 1.8 |
distance between pelvic and anal fins | 23.8 | 26.5 | 25.8 | 25.3 | 25.4; 1.1 |
length of pectoral fin | 14 | 14.7 | 13.4 | 14.3 | 14.1; 0.6 |
length of pelvic fin | 16 | 16 | 14 | 14.6 | 15.2; 1 |
length of base of dorsal fin | 23 | 19.3 | 19.9 | 19.3 | 20.4; 1.8 |
depth of anterior part of dorsal fin | 13 | 13.2 | 12.5 | 12.1 | 12.7; 0.5 |
depth of posterior part of dorsal fin | 13.7 | 10.3 | 9.6 | 10.4 | 11; 1.8 |
length of base of anal fin | 10.1 | 8.6 | 9.3 | 8.9 | 9.2; 0.7 |
depth of anal fin | 12.2 | 12.3 | 11.8 | 12 | 12.1; 0.2 |
distance between anal fin and base of caudal fin | 16.8 | 17.3 | 17 | 17.4 | 17.1; 0.3 |
distance between adipose fin and base of caudal fin | 16.1 | 17.1 | 17.9 | 17.3 | 17.1; 0.8 |
length of caudal peduncle (as projection) | 16.2 | 17.6 | 16.8 | 17.5 | 17; 0.7 |
body depth | 20.6 | 22.2 | 24.3 | 21.2 | 22.1; 1.6 |
depth of caudal peduncle (minimum body depth) | 7.1 | 7.6 | 7.3 | 7.8 | 7.5; 0.3 |
length of upper lobe of caudal fin | 15.6 | n/a | 16 | 13 | 14.9; 1.6 |
length of lower lobe of caudal fin | n/a | 18.1 | n/a | 15.7 | 16.9; 1.7 |
length of middle rays of caudal fin | 5.7 | 6.8 | 5.7 | 6.4 | 6.2; 0.5 |
HL (head length) | 18.8 | 18.9 | 18.7 | 19.3 | 18.9; 0.3 |
% HL | |||||
snout length | 5.8 | 5.4 | 5.8 | 5.9 | 5.7; 0.2 |
postorbital distance | 5.8 | 5.4 | 5.8 | 5.9 | 5.7; 0.2 |
long diameter of eye | 9.3 | 9.2 | 9.5 | 10.3 | 9.6; 0.5 |
length of maxillary | 4.7 | 4.8 | 4.3 | 4.4 | 4.6; 0.2 |
depth of maxillary | 6.7 | 6.2 | 6.2 | 6.8 | 6.5; 0.3 |
length of lower jaw | 6.7 | 6.2 | 6.2 | 6.8 | 6.5; 0.3 |
interorbital width | 1.9 | 2 | 2 | 2.3 | 2.1; 0.2 |
head depth at nape | 8.1 | 8 | 8.2 | 8.9 | 8.3; 0.4 |
head depth through eye | 5.3 | 5.3 | 5.6 | 5.8 | 5.5; 0.2 |
% HL | |||||
snout length | 30.9 | 28.7 | 30.8 | 30.4 | 30.2; 1 |
postorbital distance | 49.3 | 48.9 | 50.6 | 53.3 | 50.5; 2 |
long diameter of eye | 25 | 25.5 | 22.8 | 22.9 | 24.1; 1.4 |
length of maxillary | 35.4 | 33.1 | 33.3 | 35.2 | 34.3; 1.2 |
depth of maxillary | 10.2 | 10.5 | 10.9 | 11.9 | 10.9; 0.7 |
length of lower jaw | 43.1 | 42.2 | 43.8 | 45.8 | 43.7; 1.5 |
interorbital width | 28.4 | 28.3 | 29.7 | 29.9 | 29.1; 0.8 |
head depth at nape | 69.5 | 68.7 | 73.1 | 74.2 | 71.4; 2.7 |
head depth through eye | 51 | 50.3 | 49.5 | 50.4 | 50.3; 0.6 |
depth of posterior part of dorsal fin (% dorsal-fin base length) | 59.8 | 53.4 | 48.2 | 53.9 | 53.8; 4.7 |
depth of maxillary (% length of maxillary) | 28.7 | 31.7 | 32.6 | 33.9 | 31.7; 2.2 |
COUNTS | |||||
total lateral-line scales | 83 | 83 | 78 | 79 | 80.7; 2.6 |
total dorsal-fin rays | 23.5 | 22.5 | 21.5 | 22.5 | 22.5; 0.8 |
branched pectoral-fin rays | 13 | 14 | 13 | 13 | 13.3; 0.5 |
branched pelvic-fin rays | 10 | 10 | 10 | 10 | 10; 0 |
total anal-fin rays | 14.5 | 15.5 | 14.5 | 14.5 | 14.8; 0.5 |
gill rakers | 22 | 23 | n/a | 21 | 22; 1 |
branchiostegal rays | 8 | 8 | 8 | 8 | 8; 0 |
total vertebrae | 59 | 58 | 59 | 57 | 58.3; 1 |
pyloric caeca | 18 | 23 | n/a | n/a | 20.5; 3.5 |
Characters distinguishing Thymallus aeliani and Thymallus thymallus (historic literature data compared to the neotype characteristics).
Character |
|
|
|
Neotype of T. aeliani |
|||
---|---|---|---|---|---|---|---|
Name in publication | T. aeliani | T. vexillifer (=T. thymallus) | T. thymallus, Soča River | T. thymallus, Danube tributaries | T. thymallus, Italy | T. thymallus, Danube | |
Dorsal fin size | Short and shallow | Long and deep | |||||
Depth of posterior part of dorsal fin (% dorsal-fin base length) | mean 43.0 | means 50.7–56.3 | 53.4 | ||||
Depth of posterior part of dorsal fin (% fork length) | 5–14 [mean 9.4] | 5–18 [means 11.0–12.2] | 10.3 | ||||
Head depth at nape (% head length) | 62–82 [mean 71.7] | 60–94 [means 73.1–76.4] | 68.7 | ||||
Number of branchiostegal rays | 8 | 10 | 8 | ||||
Number of gill rakers | 20–25 [mode 21; mean 21.4] | (20, 21)22–29 [modes 24 and 25; means 24.7–25.3] | 23 | ||||
Number of simple rays in dorsal fin | 7–10 [mean 8.1] | 6–9 [means 7.0–7.3] | 8 | ||||
Total number of dorsal-fin rays | 21–25 [mean 22.8] | 20–24 [means 21.1–22.4] | 22 [if two last rays counted as one ray] | ||||
Total number of vertebrae | 57–61 [mode 59; mean 59.0] | 55–62 [mode 59; means 59.0–59.4] | 58 | ||||
Number of pyloric caeca | 18–38 [mean 26.6] | 12–33 [means 18.0–20.3 | 23 | ||||
Total number of lateral-line scales | 84 | 87 | 78–92, most commonly 87–89 [mode 88; mean 86.8] | 81–99, most commonly 88–92 [modes 88, 90 and 92; means 88.3–89.5] | 83 | ||
Colour of caudal fin | Dark blue-grey | Reddish yellow to hot orange or red | |||||
Black spot on each side of throat (under-part of mouth) | Absent | Present | Absent | ||||
Large magenta or claret blotch of irregular shape above and behind pelvic fin on both sides of body | Absent | Present |
The neotype and three other specimens from the
As seen in the phylogenetic tree (Fig.
The neotype designation for T. aeliani satisfies the provisions of Article 75.3 of the Code (ICZN) by: 1) clarifying the taxonomic identity of the Adriatic Grayling in its widely accepted modern concept (Article 75.3.1); 2) nominating its control region haplotype (GenBank acc. no. MT762347) as a diagnostic character (Article 75.3.2); 3) providing data and description sufficient to ensure recognition of the specimen designated (Article 75.3.3); 4) giving reasons and references for believing that original type material is lost (Article 75.3.4); 5) selection of the neotype is consistent with the original description of the species and collected not long after the original description and, as such, represent the native grayling that occurred in Lake Maggiore in the 19th century (Article 75.3.5); 6) choosing a neotype from the originally cited type locality, Lake Maggiore (Po catchment, Italy) (Article 75.3.6); and 7) recording that the neotype is the property of a recognized scientific institution, NHM in Vienna (Article 75.3.7).
The authors would like to thank section editor and two anonymous reviewers for helpful comments on the previous version of the manuscript. The authors acknowledge the financial support of the Slovenian Research Agency (research core funding no. P4–0220 and project J4–8218).