Research Article |
Corresponding author: Clarissa Garbi Molinari ( clarissamolinari@gmail.com ) Academic editor: Bert W. Hoeksema
© 2020 Clarissa Garbi Molinari, Maximiliano Manuel Maronna, André Carrara Morandini.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Molinari CG, Maronna MM, Morandini AC (2020) New record of Nausithoe werneri (Scyphozoa, Coronatae, Nausithoidae) from the Brazilian coast and a new synonymy for Nausithoe maculata. ZooKeys 984: 1-21. https://doi.org/10.3897/zookeys.984.56380
|
The order Coronatae (Scyphozoa) includes six families, of which Nausithoidae Haeckel, 1880 is the most diverse with 26 species. Along the Brazilian coast, three species of the genus Nausithoe Kölliker, 1853 have been recorded: Nausithoe atlantica Broch, 1914, Nausithoe punctata Kölliker, 1853, and Nausithoe aurea Silveira & Morandini, 1997. Living polyps (n = 9) of an unidentified nausithoid were collected in September 2002 off Arraial do Cabo (Rio de Janeiro, southeastern Brazil) at a depth of 227 m, and have been kept in culture since then. We compared these specimens with three species cultured in our laboratory: Nausithoe aurea (from Ilhabela, São Paulo, Brazil), Nausithoe maculata Jarms, 1990 (from Cuba and Puerto Rico), and Nausithoe werneri Jarms, 1990 (from the Atlantic Ocean off Morocco and from the Mediterranean Sea). The criteria used for comparison were: main aspects of the morphology, life cycle, and DNA sequences (18S, 28S, and COI). The results indicate that the unidentified polyps belong to N. werneri. Furthermore, N. aurea is considered a junior synonym of N. maculata.
Coronamedusae, jellyfish, life cycle, periderm, polyp, scyphomedusae, systematics
The class Scyphozoa Goette, 1887 (true jellyfishes) comprises two main clades: Coronamedusae Calder, 2009 and Discomedusae Haeckel, 1880 (
The high morphological similarity among polyps in this order and the difficulty in relating the polyp to the medusa (as they are usually not collected together) have led to two classification systems. Polyps were historically identified only as “Coronatae polyps” or were classified as belonging to the genus Stephanoscyphus Allman, 1874 (later changed to Stephanoscyphistoma Jarms, 1990, to accommodate these specimens). Studying the life cycle has been essential for advancing the systematics and understand the evolution of the group (
Recent studies have advanced our taxonomic understanding of the group, using morphological characters of the periderm tube to differentiate species relying only on the polyp stage (
The order Coronatae is composed of six families (13 genera and 59 species), of which Nausithoidae Haeckel, 1880, is the most speciose, with three genera and 26 species (
The purpose of this study was to identify coronate polyps from the Brazilian continental slope off Arraial do Cabo (southeastern Brazil, western South Atlantic) and to compare them with the other known species from the Atlantic Ocean and the Brazilian coast, and thus, to improve our knowledge of coronate biodiversity and distribution.
Deep-sea specimens from Brazil were collected during a cruise of the Navio Oceanográfico Prof. Wladimir Besnard off the coast of Arraial do Cabo (Rio de Janeiro state, southeastern Brazil, 23°45.80'S, 41°44.40'W) on 15 September 2002, at a depth of 227 m. Calcareous substrates were collected using a box-corer, and the polyps were found on these. The collected polyps were provisionally named Nausithoe sp. and numbered as follows: AC01, AC02, AC08, AC10, AC17, AC18, and AC20 (Table
Nausithoe sp. from Brazil. A tissue balls originated from polyp AC02 ephyrae B emerged polyps from same tissue balls in A after 22 weeks, showing the polyp opening; note that the basal parts are fused C external view of part of polyp AC18, showing by transparency the internal whorls of cusps (wc) D oral disc of polyp AC01, showing the tentacle crown (tc) and the mouth opening (m) with the gastric longitudinal septa (gs) E polyp AC02 releasing ephyrae.
The study was conducted at the Laboratório de Cultivo e Estudos de Cnidaria, in the Zoology Department of the Biosciences Institute, University of São Paulo (IB–USP). For comparison, we used living polyps of several species: nine Nausithoe sp., nine Nausithoe werneri Jarms, 1990, 14 Nausithoe maculata Jarms, 1990, and three Nausithoe aurea (Table
Data from studied species of Nausithose (Nausithoe sp., N. werneri, N. maculata, and N. maculata (= N. aurea).
Locality | # of polyps | Depth (m) | Culture temperature (°C) | Sampling date | Culture codes | # of ephyrae cultivated | # of mature medusae | |
---|---|---|---|---|---|---|---|---|
Nausithoe sp. | off Arraial do Cabo, Brazil | 9 | 227 | 15 | 15.09.2002 | AC01, AC02, AC08, AC10, AC17, AC18, and AC20 | 850 | 25 |
Nausithoe werneri | Atlantic off Morocco | 4 | 800–3,000 | 15 | Original culture clones (1980) | ACM156 | 69 | 4 |
Nausithoe werneri | Mediterranean | 5 | 200 | 15 | 2008 | ACM157 | 70 | 9 |
Nausithoe maculata (= N. aurea) | Ilhabela, Brazil | 3 | 3–9 | 20–22 | 02.2018 | ACM120 | 85 | 0 |
Nausithoe maculata | Girón, Cuba | 8 | 5–10 | 20–22 | 02.2004 | ACM026, ACM027 | 50 | 8 |
Nausithoe maculata | Puerto Rico | 6 | 5–10 | 20–22 | Original culture clones (1971) | ACM025 | 160 | 33 |
Voucher specimens of Nausithoe sp. were deposited in the Museu de Zoologia da Universidade de São Paulo as: MZUSP8502 (one medusa), MZUSP8503 (two polyps), MZUSP8504 (50+ ephyrae).
All polyps were fed with 1–2-day-old nauplii of Artemia sp. once a week. Strobilation usually produced hundreds of ephyrae (Fig.
Measurements of the polyps according to
Polyp ID | Ltot (mm) | Da (mm) | Ddb (mm) | Db (mm) | D2 mm | D5 mm | Da/Ltot | Nwt | Nw |
---|---|---|---|---|---|---|---|---|---|
AC01 (2002) | 6.60 | 0.70 | – | – | 0.35 | 0.45 | 0.1061 | 7 | 8 / 16 |
AC01 (2018) | 13.46 | 1.29 | – | – | – | – | 0.0958 | ||
AC02 (2002) | 11.15 | 0.90 | – | 0.15 | 0.30 | 0.50 | 0.0807 | 8 | 8 / 16 |
AC02 (2018) | 17.74 | 1.09 | – | – | – | – | 0.0614 | ||
AC02 (tissue ball 2018) | 15.71 | 1.17 | – | 0.14 | 0.09 | 0.44 | 0.0746 | 6 | 8 / 16 |
AC08 (2002) | 9.10 | – | – | 0.30 | 0.50 | 0.0769 | 9 | 8 / 16 | |
AC08 (2018) | 16.44 | 1.00 | – | – | – | – | 0.0608 | ||
AC10 (2002) | 14.25 | 1.15 | – | 0.15 | 0.20 | 0.40 | 0.0807 | 12 | 8 / 16 |
AC10 (2018) | 15.33 | 1.15 | – | – | – | – | 0.0753 | ||
AC10 (tissue ball 2018) | 11.79 | 0.92 | 0.66 | 0.15 | 0.09 | 0.46 | 0.0782 | 6 | 8 / 16 |
AC17 (2002) | 5.05 | 0.55 | – | 0.40 | 0.45 | 0.55 | 0.1089 | 9 | 8 / 16 |
AC17 (2018) | 20.20 | 1.65 | – | – | – | – | 0.0818 | ||
AC18 (2002) | 10.50 | 0.95 | – | 0.15 | 0.35 | 0.5 | 0.0905 | 5 | 8 / 16 |
AC18 (2018) | 12.27 | 1.02 | – | – | – | – | 0.0830 | ||
AC20 (2002) | 5.15 | 0.35 | – | 0.20 | 0.30 | 0.35 | 0.0680 | 10 | 8 / 16 |
AC20 (2018) | 20.13 | 1.47 | – | – | – | – | 0.0733 | ||
Mean ± SD (2002) | 8.83 ± 3.17 | 0.77 ± 0.27 | – | 0.21 ± 0.10 | 0.32 ± 0.07 | 0.46 ± 0.06 | 0.09 ± 0.01 | 8 ± 3 | 8 / 16 |
Mean ± SD (2018) | 15.90 ± 2.91 | 1.20 ± 0.22 | 0.66 ± 0 | 0.15 ± 0 | 0.09 ± 0 | 0.45 ± 0 | 0.08 ± 0.01 | ||
N. werneri 1 | 11.35 | 1.29 | 0.53 | 0.11 | 0.12 | 0.15 | 0.1139 | 6 | 8 |
N. werneri 2 | 15.27 | 0.95 | – | 0.23 | 0.11 | 0.17 | 0.0620 | 6 | 8 |
N. werneri 3 | 31.43 | 0.93 | 0.24 | 0.07 | 0.07 | 0.07 | 0.0297 | 7 | 8 |
N. werneri 4 | 19.37 | 1.28 | 0.40 | 0.08 | 0.08 | 0.11 | 0.0660 | 13 | 8 |
N. werneri 5 | 13.70 | 1.02 | 0.29 | 0.09 | 0.09 | 0.13 | 0.0744 | 8 | 8 |
N. werneri 6 | 5.24 | 0.55 | – | 0.10 | 0.10 | 0.11 | 0.1048 | 8 | 8 |
N. werneri 7 | 13.49 | 0.68 | 0.35 | 0.08 | 0.09 | 0.13 | 0.0502 | 14 | 8 |
N. werneri 8 | 6.47 | 0.65 | 0.34 | 0.08 | 0.12 | 0.15 | 0.1003 | 8 | 8 |
N. werneri 9 | 2.56 | 0.33 | 0.30 | 0.10 | – | 0.13 | 0.1293 | 7 | 8 |
Mean ± SD | 13.21 ± 8.17 | 0.85 ± 0.31 | 0.35 ± 0.09 | 0.10 ± 0.05 | 0.10 ± 0.02 | 0.13 ± 0.03 | 0.08 ± 0.03 | 8.56 ± 2.75 | 8 |
N. maculata 1 | 13.58 | 0.88 | 0.42 | 0.15 | 0.12 | 0.14 | 0.0646 | 3 | 16 |
N. maculata 2 | 14.41 | 1.21 | – | – | – | – | 0.0843 | – | 16 |
N. maculata 3 | 15.01 | 1.18 | – | – | – | – | 0.0785 | – | – |
N. maculata 4 | 18.64 | 1.08 | – | – | – | – | 0.0578 | – | – |
N. maculata 5 | 14.60 | 1.58 | – | 0.20 | 0.12 | 0.19 | 0.1083 | 4 | 16 |
N. maculata 6 | 15.82 | 1.29 | – | – | – | – | 0.0817 | – | 16 |
N. maculata 7 | 16.42 | 0.66 | – | 0.17 | 0.09 | 0.20 | 0.0405 | 6 | 16 |
N. maculata 8 | 12.85 | 0.74 | 0.51 | 0.10 | 0.10 | 0.18 | 0.0580 | – | – |
N. maculata 9 | 8.75 | 0.83 | 0.41 | 0.10 | 0.16 | 0.19 | 0.0955 | 5 | 16 |
N. maculata 10 | 3.79 | 0.39 | 0.38 | 0.13 | – | 0.16 | 0.1041 | 4 | 16 |
N. maculata 11 | 7.23 | 0.69 | 0.30 | 0.10 | 0.12 | 0.19 | 0.0949 | 4 | 16 |
N. maculata 12 | 12.72 | 0.64 | 0.41 | 0.13 | 0.12 | 0.16 | 0.0504 | 8 | 16 |
N. maculata 13 | 4.91 | 0.77 | – | – | 0.14 | 0.21 | 0.1576 | 5 | 16 |
N. maculata 14 | 8.01 | 1.19 | – | 0.11 | 0.11 | 0.17 | 0.1382 | 3 | 16 |
Mean ± SD | 11.91 ± 4.39 | 0.94 ± 0.06 | 0.41 ± 0.06 | 0.13 ± 0.03 | 0.12 ± 0.02 | 0.18 ± 0.02 | 0.09 ± 0.03 | 4.67 ± 1.49 | 16 |
N. maculata (= N. aurea) 1 | 3.93 | 0.38 | 0.17 | 0.08 | – | 0.17 | 0.0979 | 6 | 16 |
N. maculata (= N. aurea) 2 | 3.86 | 0.53 | 0.36 | 0.11 | – | 0.16 | 0.1388 | 5 | 16 |
N. maculata (= N. aurea) 3 | 5.47 | 0.60 | 0.60 | 0.13 | 0.11 | 0.19 | 0.1091 | 6 | 16 |
Mean ± SD | 4.42 ± 0.74 | 0.50 ± 0.09 | 0.38 ± 0.18 | 0.11 ± 0.02 | 0.11 ± 0 | 0.17 ± 0.01 | 0.12 ± 0.02 | 5.67 ± 0.47 | 16 |
Measurements followed the protocols established by
Schematic view of a typical Nausithoe sp. adult medusa, illustrating the main characters. A aboral view B lateral view. dc diameter of coronal furrow dr diameter between rhopalia dt total diameter cg coronal grove gc gastric cirri m manubrium ml marginal lappets r rhopalium t tentacle e eyespot g gonad s statolith.
Capsule types and sizes of nematocysts in the different life-cycle stages (polyp, ephyra, medusa) were measured (
Because hundreds of ephyrae were produced, most of the molecular tissue for DNA extractions came from them (and some from mature medusae). We extracted DNA from specimens representing all the putative species in this study: Nausithoe sp., Nausithoe aurea, Nausithoe maculata, and Nausithoe werneri. DNA was extracted using an ammonium acetate-based protocol adapted from
List of primers used to amplify each gene. *LEM = Laboratório de Evolução Molecular (IB–USP).
Gene | Primer | Primer sequence 5'–3' | F/R | Temp. – base pairs | Source |
---|---|---|---|---|---|
COI | COXl-F2 | TCGACTAATCATAAAGATATCGGCAC | F | 52 °C – 26 bp | Ward et al. 2005 |
MEDCOXR | TGGTGNGCYCANACNATRAANCC | R | 52 °C – 23 bp | Lawley et al. 2016 | |
LCO1490JJ4 | CIACIAAYCAYAARGAYATYGG | F | 55 °C+45 °C – 22 bp | Astrin et al. 2016 | |
HCO2198JJ4 | ANACTTCNGGRTGNCCAAARAATC | R | 55 °C+45 °C – 25 bp | Astrin et al. 2016 | |
LCO1490JJ2 | CHACWAAYCAYAARGAYATYGG | F | 60 °C+45 °C – 22 bp | Astrin et al. 2016 | |
HCO2198JJ2 | ANACTTCNGGRTGNCCAAARAATCA | R | 60 °C+45 °C – 25 bp | Astrin et al. 2016 | |
28S | F15 | CTAACAAGGATTCCCCTAGTAACGGCGAG | F | 55.5 °C – 30 bp | LEM * |
R798 | GGTCCGTGTTTCAAGACGG | R | 55.5 °C – 19 bp | Medina et al. 2001 | |
F798 | CCGTCTTGAAACACGGACC | F | 55.5 °C – 19 bp | Medina et al. 2001 | |
R1446 | GTTGTTACACACTCCTTAGCGG | R | 55.5 °C – 22 bp | Medina et al. 2001 | |
18S | 18S – A | AACCTGGTTGATCCTGCCAGT | F | 54 °C – 21 bp | Medlin et al. 1988 |
18S – L | CCAACTACGAGCTTTTTAACTG | R | 54 °C – 22 bp | Apakupakul et al. 1999 | |
18S – C | CGGTAATTCCAGCTCCAATAG | F | 54 °C – 21 bp | Apakupakul et al. 1999 | |
18S – Y | CAGACAAATCGCTCCACCAAC | R | 54 °C – 21 bp | Apakupakul et al. 1999 | |
18S – O | AAGGGCACCACCAGGAGTGGAG | F | 54 °C – 22 bp | Apakupakul et al. 1999 | |
18S – B | TGATCCTTCCGCAGGTTCACCT | R | 54 °C – 22 bp | Medlin et al. 1988 |
All the morphological features observed on the available specimens are summarized in Tables
Morphological data for studied species of Nausithoe. Data combined from literature and observations on specimens. Brazilian state abbreviations: BA, Bahia; RJ, Rio de Janeiro; SP, São Paulo.
N. sp. | N. maculata (= N. aurea) | N. maculata | N. werneri | ||
Medusae | Number / shape of lappets | 16, slightly elongate with rounded margins | 16, slightly elongate with rounded margins | 16, slightly elongate with rounded margins | 16, slightly elongate with rounded margins |
Rhopalium with ocellus | yes | yes | yes | yes | |
Number of gastric filaments | 8 (2 × 4) | 12–24 (3–6 × 4) | 28 (7 × 4) | 4–12 (1–3 × 4) | |
Gonad shape | round | round | round | round | |
Central disc shape | central dome slightly elevated | flattened | flattened | central dome elevated | |
Total diameter (mm) / Central disc diameter (mm) |
9.5 / 2.83 | 5 / 1.9 | 4 / 1.5 | 12 / 4.5 | |
General coloration | transparent | transparent with yellow pigment spot on lappets | transparent with yellow pigment spot on lappets | transparent | |
Gonad color | dark brown | yellow to brown | yellow to brown | dark brown | |
Tentacle length (mm) | 5 | 1.5 | 2 | 3 | |
Polyp | Habitus | solitary | solitary | solitary | solitary |
Occurrence | off Cabo Frio, RJ (Brazil) | Brazil (SP to BA) | Puerto Rico; Cuba | Atlantic off Morocco; Greenland | |
Depth (m) | 227 | 3–9 | 5–10 | 200–3000 | |
Length (mm) | 5.05–20.2 | 1.35–9.18 | 3.79–18.64 | 2.56–31.46 | |
Number of cusps/whorls | 8 + 16 | 16 | 16 | 8 | |
Number of whorls of cusps | 3–10 | 2–7 | 3–8 | 6–14 |
Development times (in weeks, under laboratory conditions) of several structures in the species studied.
N. werneri | N. maculata (= N. aurea) | N. maculata | N. sp. | |
---|---|---|---|---|
Ocelli | 4 | 2 | 3 | 3 |
First gastric filament | 3 | 1 | 2 | 2 |
Second gastric filament | – | – | 8 | 13 |
Tentacle buds | 7 | 3 | 3 | 2 |
Lappets, pigment spot | – | 2 | 2 | – |
Gonads | 9 | 3 | 4 | 24 |
Class Scyphozoa Goette, 1887
Subclass Coronamedusae Calder, 2009
Order Coronatae Vanhöffen, 1892
Family Nausithoidae Haeckel, 1880
Solitary polyp with typical periderm tube, dark to light brown (Fig.
Cnidome of studied species of Nausithoe. The range was obtained from 60 nematocysts of each type at each stage. *Data from
Holotrichous isorhiza | Heterotrichous microbasic eurytele | ||||
---|---|---|---|---|---|
Width (µm) | Length (µm) | Width (µm) | Length (µm) | ||
Nausithoe sp. | medusa (tentacle) | 4.41–6.49 | 5.65–8.65 | 7.28–10.96 | 8.47–12.99 |
ephyra (whole) | 4.11–7.33 | 5.29–8.98 | 7.1–12.59 | 8.19–14.27 | |
polyp (tentacle) | 5.86–7.58 | 8.24–9.67 | 9.58–11.54 | 11.28–13.53 | |
N. maculata (= N. aurea)* | ephyra (whole) | 3.6–6.0 | 5.4–7.2 | 9.0–11.4 | 10.2–12.6 |
medusa (tentacle) | 3.0–4.2 | 4.2–6.0 | 5.4–7.2 | 6.6–9.0 | |
polyp (tentacle) | 3.6–5.4 | 6.0–7.8 | 3.0–4.8 | 9.0–15.0 | |
N. maculata | medusa (tentacle) | 3.52–5.08 | 4.5–5.83 | 6.49–8.17 | 7.49–9.21 |
N. werneri | medusa (tentacle) | 4.33–6.69 | 5.47–7.45 | 7.06–9.27 | 8.67–10.92 |
Adult medusae from polyps of Nausithoe sp. AC10 (A–C) and AC20 (D–H) A beginning of gonad (g) development B two gonads with gametic cells still differentiating C general view of a medusa that we managed to maintain until the gonads emerged (note degree of irregularities in this specimen, due to the long period in cultivation) D aboral view of 3-month-old medusa, showing the radial muscle (rm), marginal lappets (ml), rhopalium (r), and tentacles (t) E detail of 6-month-old medusa, showing gastric filaments (gf), rhopalium with ocelli (e), and statocyst (s), and coronal groove (cg); note, no trace of gonad development F, G and H Oral view of medusae, showing lips (l) and projection of the manubrium, from less projected (F) to more projected (H).
Nausithoe maculata
Nausithoe aurea
Solitary polyp with typical periderm tube, dark to light brown, conical, with transverse rings on the surface with longitudinal striations (3–5 rings every 0.4 mm at 2 mm above base). Polyps 3.79–18.64 mm long. Basal disk 0.17–0.6 mm in diameter. Diameter of aperture 0.39–1.58 mm. Diameter just above the basal disc 0.08–0.2 mm. Diameter at 2-mm height 0.09–0.16 mm, and at 5-mm height 0.14–0.21 mm. Three to 8 whorls of 16 internal smooth cusps: 4 large (perradius), 4 intermediate (interradius), and 8 small (adradius). Polydisc strobilation, with more than 100 ephyrae at a time. Medusa translucent, with yellow pigment spot in center of each lappet (Fig.
Aboral view of Nausithoe maculata medusae from Cuba’s polyp culture. A four-month-old medusa with mature male gonads (g), long tentacles (t), and malformations in the lappets and central disc. B three-month-old medusa with mature female gonads (g), showing the rhopalium (r), coronal groove (cg), marginal lappets (ml) with pigment spot (ps), gastric cirri (gc), and tentacles (t).
Nausithoe werneri
Solitary polyp with typical periderm tube, dark to light brown, conical, with transverse rings on surface with longitudinal striations (4–5 rings every 0.4 mm at 2 mm above the base). Polyps 2.56–31.46 mm long. Basal disk 0.24–0.53 mm in diameter. Diameter of aperture 0.33–1.29 mm. Diameter just above basal disc 0.07–0.23 mm. Diameter at 2-mm height 0.07–0.12 mm, and at 5-mm height 0.07–0.17 mm. Six to 14 whorls of 8 internal cusps: 4 large (perradius) and 4 intermediate (interradius), with additional cusps. Polyp with up to 40 filiform tentacles. Polydisc strobilation, with more than 100 ephyrae at a time. Medusa with smooth umbrella (Fig.
Nausithoe werneri male medusae from Mediterranean’s polyp culture (A–C 5 months old D 3 months old) A aboral view of an adult medusa with mature gonads (g), contracted lappets, and extended tentacles (t) B detail of gastrovascular cavity, focusing on the gastric cirri (gc) C lateral view, focusing on the lips (l) and the extension of the manubrium D beginning of gonad (g) development (aboral view).
Sequences from all species studied are available on GenBank (Table
Sequence accession numbers in GenBank and their respective DNA extraction vouchers.
COI | 18S | 28S | DNA Voucher | |
---|---|---|---|---|
Nausithoe sp. AC02 | MT603856 (717 bp) | MT603629 (1765 bp) | MT621557 (1304 bp) | N02 |
Nausithoe sp. AC08 | MT603855 (735 bp) | MT603631 (1767 bp) | MT621552 (1309 bp) | N08 |
Nausithoe sp. AC10 | MT603857 (708 bp) | MT603630 (1765 bp) | MT621553 (1319 bp) | N10 |
Nausithoe sp. AC20 | MT603854 (609 bp) | MT603628 (1772 bp) | MT621555 (1344 bp) | N20 |
N. werneri (Mediterranean) | MT603858 (610 bp) | MT603627 (1767 bp) | MT621554 (1337 bp) | NW (Med) |
N. maculata (= N. aurea) (Brazil) | MT603859 (579 bp) | MT603632 (1777 bp) | MT621558 (1305 bp) | NA |
N. maculata (Cuba) | MT603860 (591 bp) | MT603633 (1780 bp) | MT621559 (1310 bp) | NM (Cuba) |
Genetic similarity (percent) between each Nausithoe sp. polyp (AC02, AC08, AC10, AC20), Nausithoe maculata (= N. aurea from Brazil), Nausithoe maculata (from Cuba), and Nausithoe werneri. 18S in white and 28S in italic.
AC02 | AC08 | AC10 | AC20 | N. werneri | N. maculata (Brazil) | N. maculata (Cuba) | |
AC02 | 100 | 100 | 99.94 | 99.94 | 99.86 | 99.86 | |
AC08 | 94.86 | 100 | 99.94 | 99.94 | 99.86 | 99.86 | |
AC10 | 97.04 | 94.63 | 99.94 | 99.94 | 99.86 | 99.86 | |
AC20 | 97.41 | 95 | 97.18 | 99.89 | 99.80 | 99.80 | |
N. werneri | 97.22 | 94.69 | 96.91 | 97.28 | 99.80 | 99.80 | |
N. maculata (Brazil) | 96.64 | 94.22 | 96.62 | 96.76 | 96.51 | 99.94 | |
N. maculata (Cuba) | 96.66 | 94.18 | 96.37 | 96.74 | 96.47 | 97.36 |
Genetic similarity (percent) between each Nausithoe sp. polyp (AC02, AC08, AC10, AC20), N. maculata (= N. aurea from Brazil), N. maculata (from Cuba), and N. werneri. COI in italic; all three markers combined in white. Boldface indicates higher similarity that we are considering to be the same species.
AC02 | AC08 | AC10 | AC20 | N. werneri | N. maculata (Brazil) | N. maculata (Cuba) | |
---|---|---|---|---|---|---|---|
AC02 | 96.28 | 97.33 | 94.60 | 95.35 | 91.74 | 92.08 | |
AC08 | 97.35 | 96.11 | 94.1 | 94.28 | 90.99 | 91.39 | |
AC10 | 100 | 97.32 | 94.73 | 95.32 | 91.77 | 92.11 | |
AC20 | 94.25 | 95.40 | 94.25 | 94.73 | 92.00 | 92.18 | |
N. werneri | 100 | 97.21 | 100 | 94.06 | 91.72 | 92.05 | |
N. maculata Brazil) | 80.83 | 80.83 | 80.83 | 81.35 | 80.83 | 94.06 | |
N. maculata (Cuba) | 81.89 | 82.40 | 81.89 | 82.29 | 81.89 | 93.06 |
The objective of this study was to identify the polyps of Nausithoe sp. from deep waters off southeastern Brazil by comparing them with previous records along the Brazilian coast. We used two approaches: morphology combined with life-cycle observations, and molecular data. Also, we present previously unpublished data on nematocysts for N. werneri and N. maculata from Cuba.
So far, only three species of Nausithoe have been recorded from the Brazilian coast: N. aurea, N. atlantica, and N. punctata (Oliveira et al. 2016). Nausithoe aurea is endemic to the Brazilian coast and can be found in shallow waters (
Nausithoe punctata is a cosmopolitan species that lives in shallow waters (
Nausithoe atlantica is known only from the medusa stage (
The two types of nematocysts found in Nausithoe sp. (heterotrichous microbasic euryteles and holotrichous isorhizas) are the same as in N. aurea (
As do most of the solitary Nausithoidae polyps, those of Nausithoe sp. and N. werneri resemble each other. As stated by several authors, the most useful features to distinguish Nausithoe polyps are the number and shape of the internal cusps of the tube (e.g.,
Both the ephyrae and medusae of the Brazilian deep-sea Nausithoe sp. are morphologically similar to N. werneri: translucent body, rhopalium with statocyst and red ocelli, lappets slightly elongated with rounded margins, and total diameter (Table
An interesting feature is the difference in the time taken to develop gonads between Nausithoe sp. and our specimens of N. werneri (Table
Genetic divergence related to species delimitation is difficult to discern, especially for clades with limited molecular markers and specimens. For Discomedusae, the sister clade of Coronamedusae,
Comparing the life cycle and morphology of scyphomedusae is extremely important to help in identifying and describing species. However, the simple structure of these animals, as evidenced by the traditional use of certain uninformative characters in the description of specimens (e.g.,
To conclude, based on both the morphological and molecular data obtained, we identify the deep-sea Nausithoe sp. specimens from off the Brazilian coast as Nausithoe werneri, thus expanding the distribution of this species to the western South Atlantic. Additionally and also based on molecular and morphological data, we consider the species Nausithoe aurea as a junior synonym of Nausithoe maculata.
We thank Drs Sergio A. Vanin for collecting the specimens on shipboard and Fábio L. da Silveira for keeping them for so many years. We also thank Dr Alberto A. F. Ribeiro (IB–USP) for allowing the use of the scanning electron microscope, Enio Mattos and Phillip Lenktaitis for helping with SEM observations, and Beatriz Vieira Freire, Manuel Antunes Júnior, and Sabrina Baroni for assistance with molecular protocols. Resources used in this project were provided by FAPESP (2010/50174-7, 2015/21007-9). CGM received support from a FAPESP MSc scholarship (2017/04954-0, 2018/11523-8) and CAPES/PROEX; MMM was awarded a FAPESP post-doctoral grant (2016/04560-9); ACM received support from a CNPq grant (309440/2019-0). We thank Dr Janet Reid for correcting the English and Dr Allen Collins and an anonymous referee for comments and suggestions to improve the text. This is a contribution of NPBioMar, USP.