Print
Minimalist revision and description of 403 new species in 11 subfamilies of Costa Rican braconid parasitoid wasps, including host records for 219 species
expand article infoMichael J. Sharkey, Daniel H. Janzen§, Winnie Hallwachs§, Eric G. Chapman|, M. Alex Smith, Tanya Dapkey#, Allison Brown#, Sujeevan Ratnasingham#, Suresh Naik#, Ramya Manjunath#, Kate Perez#, Megan Milton#, Paul Hebert#, Scott R. Shaw¤, Rebecca N. Kittel«, M. Alma Solis», Mark A. Metz», Paul Z. Goldstein», John W. Brown˄, Donald L. J. Quicke˅, C. van Achterberg¦, Brian V. Brownˀ, John M. Burns˄
‡ The Hymenoptera Institute, Redlands, United States of America
§ University of Pennsylvania, Philadelphia, United States of America
| University of Kentucky, Lexington, United States of America
¶ University of Guelph, Guelph, Canada
# Centre for Biodiversity Genomics, University of Guelph, Guelph, Canada
¤ University of Wyoming, Laramie, United States of America
« Hessisches Landesmuseum für Kunst und Natur, Wiesbaden, Germany
» U.S. Department of Agriculture, Washington, United States of America
˄ National Museum of Natural History, Washington, United States of America
˅ Chulalongkorn University, Bangkok, Thailand
¦ Naturalis Biodiversity Center, Leiden, Netherlands
ˀ Natural History Museum of Los Angeles County, Los Angeles, United States of America
Open Access

Abstract

Three new genera are described: Michener (Proteropinae), Bioalfa (Rogadinae), and Hermosomastax (Rogadinae). Keys are given for the New World genera of the following braconid subfamilies: Agathidinae, Braconinae, Cheloninae, Homolobinae, Hormiinae, Ichneutinae, Macrocentrinae, Orgilinae, Proteropinae, Rhysipolinae, and Rogadinae. In these subfamilies 416 species are described or redescribed. Most of the species have been reared and all but 13 are new to science. A consensus sequence of the COI barcodes possessed by each species is employed to diagnose the species, and this approach is justified in the introduction. Most descriptions consist of a lateral or dorsal image of the holotype, a diagnostic COI consensus barcode, the Barcode Index Number (BIN) code with a link to the Barcode of Life Database (BOLD), and the holotype specimen information required by the International Code of Zoological Nomenclature. The following species are treated and those lacking authorship are newly described here with authorship attributable to Sharkey except for the new species of Macrocentrinae which are by Sharkey & van Achterberg: AGATHIDINAE: Aerophilus paulmarshi, Mesocoelus davidsmithi, Neothlipsis bobkulai, Plesiocoelus vanachterbergi, Pneumagathis erythrogastra (Cameron, 1905), Therophilus bobwhartoni, T. donaldquickei, T. gracewoodae, T. maetoi, T. montywoodi, T. penteadodiasae, Zacremnops brianbrowni, Z. coatlicue Sharkey, 1990, Zacremnops cressoni (Cameron, 1887), Z. ekchuah Sharkey, 1990, Z. josefernandezi, Zelomorpha sarahmeierottoae. BRACONINAE: Bracon alejandromarini, B. alejandromasisi, B. alexamasisae, B. andresmarini, B. andrewwalshi, B. anniapicadoae, B. anniemoriceae, B. barryhammeli, B. bernardoespinozai, B. carlossanabriai, B. chanchini, B. christophervallei, B. erasmocoronadoi, B. eugeniephillipsae, B. federicomatarritai, B. frankjoycei, B. gerardovegai, B. germanvegai, B. isidrochaconi, B. jimlewisi, B. josejaramilloi, B. juanjoseoviedoi, B. juliodiazi, B. luzmariaromeroae, B. manuelzumbadoi, B. marialuisariasae, B. mariamartachavarriae, B. mariorivasi, B. melissaespinozae, B. nelsonzamorai, B. nicklaphami, B. ninamasisae, B. oliverwalshi, B. paulamarinae, B. rafamoralesi, B. robertofernandezi, B. rogerblancoi, B. ronaldzunigai, B. sigifredomarini, B. tihisiaboshartae, B. wilberthbrizuelai, Digonogastra montylloydi, D. montywoodi, D. motohasegawai, D. natwheelwrighti, D. nickgrishini. CHELONINAE: Adelius adrianguadamuzi, A. gauldi Shimbori & Shaw, 2019, A. janzeni Shimbori & Shaw, 2019, Ascogaster gloriasihezarae, A. grettelvegae, A. guillermopereirai, A. gustavoecheverrii, A. katyvandusenae, A. luisdiegogomezi, Chelonus alejandrozaldivari, C. gustavogutierrezi, C. gustavoinduni, C. harryramirezi, C. hartmanguidoi, C. hazelcambroneroae, C. iangauldi, C. isidrochaconi, C. janecheverriae, C. jeffmilleri, C. jennyphillipsae, C. jeremydewaardi, C. jessiehillae, C. jesusugaldei, C. jimlewisi, C. jimmilleri, C. jimwhitfieldi, C. johanvalerioi, C. johnburnsi, C. johnnoyesi, C. jorgebaltodanoi, C. jorgehernandezi, C. josealfredohernandezi, C. josefernandeztrianai, C. josehernandezcortesi, C. josemanuelperezi, C. josephinerodriguezae, C. juanmatai, C. junkoshimurae, C. kateperezae, C. luciariosae, C. luzmariaromeroae, C. manuelpereirai, C. manuelzumbadoi, C. marianopereirai, C. maribellealvarezae, C. markmetzi, C. markshawi, C. martajimenezae, C. mayrabonillae, C. meganmiltonae, C. melaniamunozae, C. michaelstroudi, C. michellevanderbankae, C. mingfangi, C. minorcarmonai, C. monikaspringerae, C. moniquegilbertae, C. motohasegawai, C. nataliaivanovae, C. nelsonzamorai, C. normwoodleyi, C. osvaldoespinozai, C. pamelacastilloae, C. paulgoldsteini, C. paulhansoni, C. paulheberti, C. petronariosae, C. ramyamanjunathae, C. randallgarciai, C. rebeccakittelae, C. robertoespinozai, C. robertofernandezi, C. rocioecheverriae, C. rodrigogamezi, C. ronaldzunigai, C. rosibelelizondoae, C. rostermoragai, C. ruthfrancoae, C. scottmilleri, C. scottshawi, C. sergioriosi, C. sigifredomarini, C. stevearonsoni, C. stevestroudi, C. sujeevanratnasinghami, C. sureshnaiki, C. torbjornekremi, C. yeimycedenoae, Leptodrepana alexisae, L. erasmocoronadoi, L. felipechavarriai, L. freddyquesadai, L. gilbertfuentesi, L. manuelriosi, Phanerotoma almasolisae, P. alvaroherrerai, P. anacordobae, P. anamariamongeae, P. andydeansi, P. angelagonzalezae, P. angelsolisi, P. barryhammeli, P. bernardoespinozai, P. calixtomoragai, P. carolinacanoae, P. christerhanssoni, P. christhompsoni, P. davesmithi, P. davidduthiei, P. dirksteinkei, P. donquickei, P. duniagarciae, P. duvalierbricenoi, P. eddysanchezi, P. eldarayae, P. eliethcantillanoae, P. jenopappi, Pseudophanerotoma alanflemingi, Ps. albanjimenezi, Ps. alejandromarini, Ps. alexsmithi, Ps. allisonbrownae, Ps. bobrobbinsi. HOMOLOBINAE: Exasticolus jennyphillipsae, E. randallgarciai, E. robertofernandezi, E. sigifredomarini, E. tomlewinsoni. HORMIINAE: Hormius anamariamongeae, H. angelsolisi, H. anniapicadoae, H. arthurchapmani, H. barryhammeli, H. carmenretanae, H. carloswalkeri, H. cesarsuarezi, H. danbrooksi, H. eddysanchezi, H. erikframstadi, H. georgedavisi, H. grettelvegae, H. gustavoinduni, H. hartmanguidoi, H. hectoraritai, H. hesiquiobenitezi, H. irenecanasae, H. isidrochaconi, H. jaygallegosi, H. jimbeachi, H. jimlewisi, H. joelcracrafti, H. johanvalerioi, H. johnburleyi, H. joncoddingtoni, H. jorgecarvajali, H. juanmatai, H. manuelzumbadoi, H. mercedesfosterae, H. modonnellyae, H. nelsonzamorai, H. pamelacastilloae, H. raycypessi, H. ritacolwellae, H. robcolwelli, H. rogerblancosegurai, H. ronaldzunigai, H. russchapmani, H. virginiaferrisae, H. warrenbrighami, H. willsflowersi. ICHNEUTINAE: Oligoneurus kriskrishtalkai, O. jorgejimenezi, Paroligoneurus elainehoaglandae, P. julianhumphriesi, P. mikeiviei. MACROCENTRINAE: Austrozele jorgecampabadali, A. jorgesoberoni, Dolichozele gravitarsis (Muesebeck, 1938), D. josefernandeztrianai, D. josephinerodriguezae, Hymenochaonia kalevikulli, H. kateperezae, H. katherinebaillieae, H. katherineellisonae, H. katyvandusenae, H. kazumifukunagae, H. keithlangdoni, H. keithwillmotti, H. kenjinishidai, H. kimberleysheldonae, H. krisnorvigae, H. lilianamadrigalae, H. lizlangleyae, Macrocentrus fredsingeri, M. geoffbarnardi, M. gregburtoni, M. gretchendailyae, M. grettelvegae, M. gustavogutierrezi, M. hannahjamesae, M. harisridhari, M. hillaryrosnerae, M. hiroshikidonoi, M. iangauldi, M. jennyphillipsae, M. jesseausubeli, M. jessemaysharkae, M. jimwhitfieldi, M. johnbrowni, M. johnburnsi, M. jonathanfranzeni, M. jonathanrosenbergi, M. jorgebaltodanoi, M. lucianocapelli. ORGILINAE: Orgilus amyrossmanae, O. carrolyoonae, O. christhompsoni, O. christinemcmahonae, O. dianalipscombae, O. ebbenielsoni, O. elizabethpennisiae, O. evertlindquisti, O. genestoermeri, O. jamesriegeri, O. jeanmillerae, O. jeffmilleri, O. jerrypowelli, O. jimtiedjei, O. johnlundbergi, O. johnpipolyi, O. jorgellorentei, O. larryspearsi, O. marlinricei, O. mellissaespinozae, O. mikesmithi, O. normplatnicki, O. peterrauchi, O. richardprimacki, O. sandraberriosae, O. sarahmirandae, O. scottmilleri, O. scottmorii, Stantonia billalleni, S. brookejarvisae, S. donwilsoni, S. erikabjorstromae, S. garywolfi, S. henrikekmani, S. luismirandai, S. miriamzunzae, S. quentinwheeleri, S. robinkazmierae, S. ruthtifferae. PROTEROPINAE: Hebichneutes tricolor Sharkey & Wharton, 1994, Proterops iangauldi, P. vickifunkae, Michener charlesi. RHYSIPOLINAE: Pseudorhysipolis luisfonsecai, P. mailyngonzalezae Rhysipolis julioquirosi. ROGADINAE: Aleiodes adrianaradulovae, A. adrianforsythi, A. agnespeelleae, A. alaneaglei, A. alanflemingi, A. alanhalevii, A. alejandromasisi, A. alessandracallejae, A. alexsmithi, A. alfonsopescadori, A. alisundermieri, A. almasolisae, A. alvarougaldei, A. alvaroumanai, A. angelsolisi, A. annhowdenae, A. bobandersoni, A. carolinagodoyae, A. charlieobrieni, A. davefurthi, A. donwhiteheadi, A. doylemckeyi, A. frankhovorei, A. henryhowdeni, A. inga Shimbori & Shaw, 2020, A. johnchemsaki, A. johnkingsolveri, A. gonodontovorus Shimbori & Shaw, 2020, A. manuelzumbadoi, A. mayrabonillae, A. michelledsouzae, A. mikeiviei, A. normwoodleyi, A. pammitchellae, A. pauljohnsoni, A. rosewarnerae, A. steveashei, A. terryerwini, A. willsflowersi, Bioalfa pedroleoni, B. alvarougaldei, B. rodrigogamezi, Choreborogas andydeansi, C. eladiocastroi, C. felipechavarriai, C. frankjoycei, Clinocentrus andywarreni, Cl. angelsolisi, Cystomastax alexhausmanni, Cy. angelagonzalezae, Cy. ayaigarashiae, Hermosomastax clavifemorus Quicke sp. nov., Heterogamus donstonei, Pseudoyelicones bernsweeneyi, Stiropius bencrairi, S. berndkerni, S. edgargutierrezi, S. edwilsoni, S. ehakernae, Triraphis billfreelandi, T. billmclarneyi, T. billripplei, T. bobandersoni, T. bobrobbinsi, T. bradzlotnicki, T. brianbrowni, T. brianlaueri, T. briannestjacquesae, T. camilocamargoi, T. carlosherrerai, T. carolinepalmerae, T. charlesmorrisi, T. chigiybinellae, T. christerhanssoni, T. christhompsoni, T. conniebarlowae, T. craigsimonsi, T. defectus Valerio, 2015, T. danielhubi, T. davidduthiei, T. davidwahli, T. federicomatarritai, T. ferrisjabri, T. mariobozai, T. martindohrni, T. matssegnestami, T. mehrdadhajibabaei, T. ollieflinti, T. tildalauerae, Yelicones dirksteinkei, Y. markmetzi, Y. monserrathvargasae, Y. tricolor Quicke, 1996. Y. woldai Quicke, 1996.

The following new combinations are proposed: Neothlipsis smithi (Ashmead), new combination for Microdus smithi Ashmead, 1894; Neothlipsis pygmaeus (Enderlein), new combination for Microdus pygmaeus Enderlein, 1920; Neothlipsis unicinctus (Ashmead), new combination for Microdus unicinctus Ashmead, 1894; Therophilus anomalus (Bortoni and Penteado-Dias) new combination for Plesiocoelus anomalus Bortoni and Penteado-Dias, 2015; Aerophilus areolatus (Bortoni and Penteado-Dias) new combination for Plesiocoelus areolatus Bortoni and Penteado-Dias, 2015; Pneumagathis erythrogastra (Cameron) new combination for Agathis erythrogastra Cameron, 1905. Dolichozele citreitarsis (Enderlein), new combination for Paniscozele citreitarsis Enderlein, 1920. Dolichozele fuscivertex (Enderlein) new combination for Paniscozele fuscivertex Enderlein, 1920. Finally, Bassus brooksi Sharkey, 1998 is synonymized with Agathis erythrogastra Cameron, 1905; Paniscozele griseipes Enderlein, 1920 is synonymized with Dolichozele koebelei Viereck, 1911; Paniscozele carinifrons Enderlein, 1920 is synonymized with Dolichozele fuscivertex (Enderlein, 1920); and Paniscozele nigricauda Enderlein,1920 is synonymized with Dolichozele quaestor (Fabricius, 1804). (originally described as Ophion quaestor Fabricius, 1804).

Keywords

Accelerated taxonomy, Agathidinae, BIN code, BioAlfa, Braconidae, Braconinae, caterpillar, Cheloninae, COI barcode, conservation, DNA barcode, Homolobinae, Hormiinae, Hymenoptera, Ichneumonoidea, Ichneutinae, Lepidoptera, Macrocentrinae, parasitoid host associations, Proteropinae, Rogadinae, Rhysipolinae, tri-trophic interaction, tropical

Chapter 1: Introduction and methods

Introduction

It is the purpose of this article to further refine methods to overcome the taxonomic impediment of ichneumonoid biodiversity. The current treatment deals with eleven subfamilies of Braconidae, i.e., Agathidinae, Braconinae, Cheloninae, Homolobinae, Hormiinae, Ichneutinae, Macrocentrinae, Orgilinae, Proteropinae, Rhysipolinae, and Rogadinae. Although not a thorough review of all species of these subfamilies, we here document a large number of Costa Rican species and provide names and unique identifiers for future keys, biodiversity analyses, conservation (e.g., Janzen 1999a, b; Janzen and Hallwachs 1994, 2011, 2016; Janzen et al. 2017, 2019a, b, 2020a, b), and phylogenetic studies. This paper makes available morphological, biological, and molecular (the mitochondria gene cytochrome oxidase I, the “DNA barcode”) information for 413 species of Costa Rican Braconidae, all but 13 of which are newly described. The discrimination of these species is mostly based on COI barcodes used for Barcode Index Number (BIN) analysis (Ratnasingham and Hebert 2013); however, we use an integrative approach. In 55% of the cases rearing records played a role in species discrimination, and morphology was also employed for a number of species complexes.

In the following paragraphs we justify our method and address criticisms of the Meierotto et al. (2019a) publication (which employed similar methods) proposed in a recent article by Zamani et al. (2020). Their criticisms and their proposed solutions to the taxonomic impediment can be summarized as follows. Many of these are further addressed later in the introduction.

Criticisms

1. “The method ignores previously described species”

This is not true, not for the Meierotto et al. (2019a) paper and not for the present paper. In the Meierotto et al. (2019a) paper there was a clear statement that coauthor Sharkey had seen all of the relevant types and that in his opinion none of the species treated were conspecific with these except for Zelomorpha arizonensis. The critics suggest that evidence be given to demonstrate that Sharkey had seen the types. Are they asking for letters from curators of the museums that Sharkey visited, or did they simply overlook the statement? Impossible to tell, and way beyond standard taxonomic practice by well-established authorities for a major group of insects. Perhaps they ignored another paper by Meierotto et al. (2019b) in which the presently recognized species of Zelomorpha and Hemichoma were established by creating dozens of new combinations. Clearly, one of the authors (i.e., MJS) of this latter paper must have viewed the type species, as stated in the paper. In this taxonomically broader treatment also, we have reviewed all of the relevant literature and found a number of previously described species that are mentioned where appropriate.

2. “Mitochondrial trees often disagree with nuclear species trees, especially in taxa where Wolbachia may be altering mtDNA introgression” and “congruence between nuclear and mitochondrial signal should be tested to better reinforce the species units identified”

This mostly appears to be pointless because we are not trying to recapitulate phylogeny. BOLD automatically screens out sequence uploads for Wolbachia (and other contaminants). Indeed, when barcode sequence libraries were surveyed for Wolbachia, evidence was found in only 0.16% of cases (Smith et al. 2012a). More independent DNA sequence data is clearly more useful (e.g., Janzen et al. 2017) and there is little doubt that in the years and decades to come the barcode will constitute many markers, if not entire genomes. However, adding more genes is not cost or time effective at present, as the critics themselves point out. Furthermore, part of the first pass taxonomic approach for megadiverse areas/taxa using DNA barcodes includes the creation of a whole genome DNA extract that is available for future phylogenetic work. While Costa Rica has achieved biopolitically public domain status for its CO1 barcodes as presented here (Decree 41767. 2019), the whole genomes are not (yet) full open public access for Costa Rica and most other tropical countries.

3. “purely DNA-based descriptions will… make the identification of millions of historical specimens impossible”

As we have made clear in the Meierotto et al. (2019a) paper and here, we are not proposing that comprehensive revisions that include keys and morphological diagnoses be abandoned. Rather, we view barcode-based descriptions as a first pass in an iterative approach to solve the taxonomic impediment of megadiverse and under-taxonomically resourced groups that standard technical and biopolitical approaches have not been able to tackle. For example, if a taxonomist wishes to integrate these elements to Zelomorpha or any of the taxa that we review below they will have a great starting point (and resources). When a large number of specimens, from a wide geographic range, are barcoded, effective morphological keys may be written and old museum specimens will regain their value to go along with their barcodes (e.g., Janzen et al. 2017). Nonetheless, until this milestone is achieved, and even then, the old museum specimens have little value, because of the enormous cost in time and budgets to examine and identify them morphologically, e.g., imagine trying to identify in a morphological key one of the more than 3,000 species of Neotropical Triraphis 95% of which are currently undescribed.

4. “it will impair this science [taxonomy] in developing countries which house most of the undiscovered portion of biodiversity, due to high costs and lack of staff and technology”

This is a point that one of the reviewers of our present manuscript also mentioned. Firstly, high costs, lack of public interest, and lack of staff, to say nothing of lack of biopolitical enthusiasm or budgets, have caused the taxonomic impediment worldwide, not just in developing countries. In Canada, for example, a Canadian Council of Academics report from a decade ago found that previously deep and respected taxonomic resources suffered from decades of lack of investment that resulted in insufficient capacity to describe Canadian biodiversity (Lovejoy et al. 2010). Costa Rica is a relatively poor country that cannot maintain a cohort of taxonomists to describe its biodiversity and yet we here describe more than 400 new species from the country, with many more to come, all public domain and all available to future users at any level if they have barcode access, which they will. The critics may have meant to write that demanding barcodes for species descriptions, which we do, will disenfranchise those who cannot afford the price of barcoding. At the Canadian Centre for Biodiversity Genomics (CBG) the current rates for barcoding vary between 1.02 and 25 US dollars, depending on the quantity of specimens and their age, e.g., old museum specimens are more expensive. Today most taxonomists would be looking at $10 per specimen for a minimum of 95 specimens. That is almost $1,000 and certainly an impediment to many, although not out of the range of routine expenses like salaries, lab infrastructure, and page charges. DNA evidence is necessary to delimit species in megadiverse taxa, as we demonstrate further in the introduction, and the use of which Zamani et al. (2020) promote elsewhere in their article. Our first pass approach is not more expensive than the current standards in comprehensive revisions.

5. [it will] “drastically affect other related fields of study and, importantly, conservation”

The authors did not expand on this criticism, but the opposite is true. For example, barcoded species will allow for the identification of metabarcoded specimens. This is a tool that is being used to determine the rareness and distribution of a species and potentially allow for their protection. Our method allows for the rapid naming of species and it is very unlikely that unnamed species will ever be protected, and they will have no chance of being integrated into the socioeconomics of a tropical country, a process that is vital for the conservation of tropical biodiversity (Janzen and Hallwachs 2019b).

6. “there must be several photographs available, not a single lateral photograph of a single specimen”

Of course many photographs are desirable as are fully integrated revisions. However, if we are to rid ourselves of the taxonomic impediment, time is a critical factor. Our simple images are meant simply as a voucher for a comparison with newly barcoded specimens, as well as to offer many gestalt traits. For example, we have a number of species in our treatment of Costa Rican fauna below that appear to have conspecific specimens on BOLD that were collected by others in other countries, e.g., Belize and Argentina, i.e., they are in the same BIN. In most of these cases the details on BOLD are “private” (unfortunately owing to other taxonomists’ possessiveness) and so we cannot easily examine the specimens to include them in our revision. However, the proprietors of these specimens can look at our image and conclude either, “yes that looks a lot like my specimen and is probably the same species or not”, and all of our specimens are available for examination from the CBG or from their final deposit in the Canadian National Collection in Ottawa.

7. “some text highlighting important diagnostic features is valuable… [and] the actual description of the species may be written within minutes when material and expertise are already available”

This is false. If morphological descriptions and diagnostics could be written in minutes we would include them, and the taxonomic impediment would be just a pebble in the taxasphere’s road. Even the revision of Alabagrus by Sharkey et al. (2018), which included barcode data and morphology, could not separate morphologically a number of species that, based on host data and COI sequence data, were clearly different. For megadiverse, understudied taxa like those treated herein, a morphological diagnosis separating tens to hundreds of new species from a few previously morphologically described species is a waste of time. This is because the vast majority of species in these taxa are undescribed and distinguishing a new species from the few described species leaves dozens or hundreds or thousands of species that could fit any simple morphological diagnostic. One of the advantages of the barcode approach is that it acts as a diagnostic that is effective in distinguishing newly described species from almost the entirety of both described and undescribed species yet to be captured. It is impossible to guess at all of the different morphological combinations that may be possessed by the plethora of undescribed species for any particular genus, but the COI barcode is diverse enough across taxa that it is an effective diagnostic even for these unknown species, as has been shown by its reliability for already well-known taxa such as tropical Lepidoptera.

8. “Simply assigning all BINs taxonomic names.. would indeed complete the inventory of life on Earth extremely quickly (at precisely the same pace as the rate of barcoding) – that we do not dispute. But it would also remove the quantitative and qualitative difference between these preliminary identifiers (based on a single DNA marker) and full taxonomic recognition (based on a more comprehensive diagnosis, ideally supported by multiple lines of evidence including genetic data) that lend taxonomy its value”

When the authors and the taxasphere have the budgets, the enthusiasm, the time, and the biopolitical permissions to achieve this for the 20+ million tropical species of terrestrial Eukaryota, it will be wonderful. As mentioned earlier, our method is not meant to be the final treatment for a higher taxon. We admire and we practice the integrative approach, and all authors who are taxonomists in this publication regularly publish integrative revisions; this is our standard. But every integration starts with pieces to integrate. The barcode and its associated administrative accounting, along with the specimen itself, and whatever higher taxon information is available, is what we can offer to tropical conservation through sustainable biodevelopment (e.g., Janzen et al. 2020a). We are now offering an alternative method as a taxonomic first pass for megadiverse understudied taxa, the goal being to overcome the taxonomic impediment, thereby allowing the full power of tropical biodiversity value to become truly part of tropical societies. The critics also misrepresent our method. We do not simply assign taxonomic names to BINs. Firstly, ca. 10% of BINs contain multiple species. More rarely, BINs that are presently on BOLD today may coalesce, resulting in one of the BINS disappearing, just as happens when a species is found to bear several classical scientific names (incidentally, often revealed by barcoding). A careful examination of the content of the BINS and their nearest neighbors is necessary. Working with the specimens reared by Dan Janzen, Winnie Hallwachs et al. in the Costa Rican ACG mega-inventory (Janzen and Hallwachs 2016) has been enlightening to discern species boundaries, and to understand the limits of the BIN-only approach, because of the host-caterpillar data that they have. For example, host data, and morphological evidence allowed us to distinguish seven species of Macrocentrus within the BIN BOLD:ACK7466. This is a low frequency example; for 90% of the species, BINs make a good proxy to species, just as morphological comparisons often do. They are the equivalent of placing look-alikes in a unit tray, later to be sometimes split into a species complex by yet more data, precisely what happens in classical taxonomic practice following naming of museum specimens in a monograph. This in turn generates papers with titles such as “17 new species hiding in 10 long-named gaudy tropical moths (Lepidoptera: Erebidae: Arctiinae)” (Espinoza et al. 2017), each of the 17 having been lumped within the ten classical species in unit trays for decades.

9. “It would supplant taxonomists with technicians, who need to know nothing of the biology of the units with which they are dealing”

We wish this were true and imagine the power it would and perhaps will give the general public. Certainly, more people will play a larger part in a barcoding approach. If the criticism were true, we could overcome the taxonomic impediment much more quickly, to say nothing of exporting bioliteracy possibilities to the majority of the world (Janzen and Hallwachs 2019b). Interestingly, many of the co-authors of the present paper fit the technician category. Nonetheless, due to the necessity to identify specimens to genus as well as DNA contamination, multiple species in BINs, and other minor issues, an expert is necessary for the next level of resolution or confirmation.

Solutions

1. “real revolutions are undoubtedly coming, especially from the fields of machine learning and integrative species delimitation (Solís-Lemus et al. 2015; Favret and Sieracki 2016), and also that it is possible to produce massive, rapidly assembled taxonomic monographs without compromising on quality (Rakotoarison et al. 2017)”

The ‘good news’ reported by the critics does nothing, and will do nothing, to attack the core of the taxonomic impediment. The visual identification system introduced by Favret and Sieracki (2016) is dependent on preexisting taxonomy for machine training. That is, after a species is described, numerous specimens are investigated, and a machine is trained to recognize the species. BOLD does precisely this by its barcode. The proposed revolution is a fine technology, but unrelated to the taxonomic impediment. Integrative molecular species delimitation proposed by Solis-Lemus et al. (2015) requires far more loci, sequencing, and money than does DNA barcoding and therefore suffers from most of the same criticisms the critics aim at barcoding. The comment that “massive”, rapidly assembled taxonomic monographs (Rakotoarison et al. 2017) can be assembled “without compromising on quality” refers to a revision treating fewer than 50 species, a drop in the bucket compared to our groups. It also is constructed on profuse sequencing, which would be problematic (according to the critics) for labs in developing countries, to say nothing of the general user community.

2. “a true paradigm shift in taxonomy will come only when there is a revolution in the level of financial investment in taxonomy and the natural history museums that house the described and undescribed reference material of life on Earth”

The taxasphere has been hoping for this for many decades and it will likely never happen until we show the funding agencies that we can make a dent in the taxonomic impediment without costing billions of dollars, to say nothing of showing the overall public that there is reason to bother. To our knowledge, in the USA (and we presume in many other parts of the world) there are no taxonomists that are federally funded for alpha taxonomic research unless they are also addressing interesting scientific, commercial, or public questions. Trivial funding is available for higher level phylogenetic research, although on a very limited scale. We believe that NSF (USA) and other agencies may fund large scale revisions if the revisor, employing a barcode approach, is treating thousands of species and attacking the taxonomic impediment. Unfortunately, current economic crises are causing many of the countries with appropriate resources to be more interested in funding research that will largely benefit themselves rather than the tropical countries so rich in rapidly disappearing biodiversity.

We continue now by justifying our diagnostic approach. COI barcodes are indispensable for diagnosing the species treated herein, as well as signaling where seemingly trivial morphological variation actually indicates a species boundary, and they are an invaluable tool for studies of most other hyperdiverse arthropod taxa as well. For our taxa, COI barcodes, though not infallible, are a magnitude more effective than morphology, and the evidence presented below demonstrates this. Dozens of additional examples can be found in the following studies: Hebert et al. (2004); Janzen et al. (2005, 2009, 2011, 2012, 2017, 2019b, 2020b); Hajibabaei et al. (2006); Smith et al. (20062008, 2012b); Burns et al. (2007, 2008); Chacon et al. (2013); Bertrand et al. (2014); Brown et al. (2014); Fernandez-Triana et al. (2014, 2020); Fleming (2014); Hansson et al. (2015); Phillips-Rodriguez et al. (2014); and Espinoza et al. (2017). Using a morphology-only approach, Leathers and Sharkey (2003) revised the Costa Rican species of Alabagrus (Braconidae) with an emphasis on specimens from the La Selva Biological Field Station. Later, using a morphology and COI barcode approach, Sharkey et al. (2018) re-revised Costa Rican Alabagrus with an emphasis on specimens reared in the Área de Conservación Guanacaste, only 100‒150 km distant from La Selva, and containing all of the La Selva ecosystems. When the 39 species treated by Leathers and Sharkey were barcoded, 17 were found to have been incorrectly lumped with previously described species that do not even occur in Costa Rica, and five endemic morphology-based Costa Rican species were discovered to be species complexes. The morphology-only approach resulted in an error rate of more than 60%. The following examples illustrate the sources of the errors. The Leathers and Sharkey concept of Alabagrus englishi was found to comprise five distinct species when barcoded. To quote directly from Sharkey et al. (2018). “Many paratypes of A. englishi, sensu Leathers and Sharkey (2003), will now key to the following species: A. johnobryckii, A. sarameierottoae, A. sarahsharkeyae, and A. barbsharanowskiae.” A second example is A. pachamama, which was recorded by Leathers and Sharkey as occurring in Costa Rica. As the name implies, the holotype is from Peru. This “species” turned out to be a complex of five species in Costa Rica, i.e., A. jackiemillerae, A. scottshawi, A. fernandezi, A. fernandodiasi, and A. genemonroei. Their COI barcode sequences are significantly divergent, and their host caterpillars are conspicuously different species. These facts led the authors to detect subtle morphological differences that distinguish the species, and further, to conclude that A. pachamama does not even occur in Costa Rica. These findings suggest that this complexity is common in neotropical ecosystems.

To understand how morphologically similar the species of the aforementioned complex are, compare the images of A. scottshawi and A. genemonroei (Figs 1, 2). A casual look reveals that the propodeal sculpture is different, the basal black bands in the forewings are in different positions, and the hind coxae have different colors. Without molecular data, how can one decide if these features reflect intraspecific variation or are evidence of distinct species, especially when there are only a few specimens (and sometimes only one) in hand? To add to this morphological ambiguity, there are three more congeneric species with similar, but slightly different combinations of these character states. It was only after molecular and host data signaled different species that morphological characters were confirmed to distinguish the species of this complex. Even after incorporating COI sequence data, not all species of Alabagrus treated in Sharkey et al. (2018) could be separated based on morphological characters; for example, A. jennyphillipsae, A. isidrochaconi, and A. jeanfrancoislandryi are inseparable morphologically (they end in the same terminus in the morphological key) but clearly distinguished by COI data.

Figure 1. 

Alabagrus genemonroei, holotype.

Figure 2. 

Alabagrus scottshawi, holotype.

In the Alabagrus revision (Sharkey et al. 2018) and in the species treatments that follow here, a 2% genetic distance, the conventional threshold for species delimitation using COI barcodes (Jones et al. 2011), was used to cluster putative species (Smith et al. 2012b). Morphology and host data were then employed to test and refine these approximations to species. The 2% divergence results in putative species being coded with Barcode Index Numbers (BINs) (Ratnasingham and Hebert 2013) produced by BOLD (http://www.barcodinglife.org/index.php/Public_BarcodeIndexNumber_Home). The BINs were used to sort specimens just as morphology is traditionally employed to sort specimens into museum unit trays. Morphological data, ecological data, and clustering of barcodes within a BIN were then considered to make final decisions when genetic distances between putative molecular species were near or below the 2% threshold, and commonly, two or more clusters within a BIN were each represented by numerous specimens. In one of the first published examples of “hidden diversity,” that of Astraptes fulgerator (Hebert et al. 2004), six species easily distinguished by caterpillar coloration, food plant, and ecology, fell in the same BIN (Janzen et al. 2011) because they were each less than 2% different in their barcodes, yet distinctly differently clustered within the BIN. In the case of Alabagrus, COI barcodes were 100% consistent with morphological and host data. By this, we mean that the COI data never lumped specimens that were markedly different morphologically in the same BIN; nor did it lump specimens with divergent host data. Furthermore, “Binning” did not split species that were clearly demarcated by host and morphological data.

COI data are not always diagnostic. In the revision of Lytopylus (Braconidae, Agathidinae) (Kang et al. 2017), two of the 32 reared species from Costa Rica did not achieve a 2% COI divergence, yet they had distinct morphologies and host data. The error rate, if COI had been used exclusively for the Alabagrus and Lytopylus revisions, would be ~ 1%, far better than the grossly underestimated 15% error rate assumed for predominantly morphological revisions of braconids as demonstrated in the database of Yu et al. (2016). Clearly, relying solely on COI barcode sequences will result in some overlooked cryptic species, and we do not promote COI-only species delimitation except where mass samples are being species-counted and therefore small amounts of species lumping is irrelevant (e.g., Janzen et al. 2000b), e.g., it may not matter if a year of Malaise trapping records 8,500 species or 8,516 species if it is being compared with a trap-year recording 3,456‒3,602 species. In the treatment of Macrocentrus that follows, seven species fall into the same BIN (BOLD:ACK7466). However, because they are so dissimilar morphologically and separated on the NJ tree, we treat them as distinct species. In this case, because the BIN data are not diagnostic, and will not be until the sample size is large enough to show clustering within the BIN, we provide a morphological key to the seven species. Janzen and Hallwachs’ rearing studies have revealed numerous BINs with multiple species, and they estimate a 10% rate of lumping using BOLD’s 2% genetic distance threshold. For example, in a reared sample of ca. 17,139 reared and Malaise-trapped barcoded specimens of Microgastrinae (Braconidae) from Área de Conservación de Guanacaste (ACG), there are 1,231 BINs, but more detailed examination of morphology and ecology reveals that there are at least 1,346 species in that sample (unpublished). Given the same rate for other major taxa in the inventory (Tachinidae, Ichneumonidae, Hesperiidae), for large samples that have been only BINned (as in a Malaise trap sample), we tentatively add 10% more species to large BIN numbers for a more accurate estimation of the number of species that will be defined with more intense scrutiny by specialists, coupled with more detailed ecological information.

As a final illustration of how ineffective morphology is to differentiate braconid species, we will paraphrase a report published by Kang et al. (2017). Ilgoo Kang (at that time a new graduate student) and Michael Sharkey (with decades of experience in species-level morphological alpha taxonomy) tested their ability to differentiate the species of Lytopylus before including COI and host data. They had error rates of 62% and 54%, respectively. All possible types of errors were discovered, i.e., lumping, splitting, and both lumping and splitting (mixing some of the members of two or more species into two or more incorrect species). In contrast, the molecular species concepts matched with the final species delimitations, which were also based on host data, at 96.6%. In light of the evidence presented above, and much more like it in the literature, it seems absurd to us that many in the taxasphere complain about barcode-based species concepts, yet readily accept delineations based solely on morphology. This is not to say that COI-based species discrimination will work for all taxa, but the method undoubtedly is highly superior to morphology for the Braconidae treated here and all indications are that they will be the same for most other species-rich tropical taxa (e.g., Microgastrinae Braconidae, Ichneumonidae, Tachinidae).

Hopefully, we have demonstrated the utility of COI barcode data for species circumscription. Now we address the hurdle of species descriptions. Critics claim that the description of a new taxon must include more than an image and COI sequence data, insisting that keys, morphological diagnoses, detailed figures, and the examination of the holotypes of all congeneric species known from the same realm are necessary. Our answer to these criticisms is that there are too many species and too little time. For many species-rich higher taxa, detailed place-based neotropical inventories such as that of ACG (e.g., Janzen et al. 2009, Janzen and Hallwachs 2016) deal with only a fraction of the total local diversity. In these cases, is seems inane to present a morphological key where it is obvious that no key or array of diagnoses will discriminate the described from the hundreds of species yet to be described (e.g., Fernandez-Triana et al. 2014, 2020; Fleming et al. 2014; Hansson et al. 2015). Due to humankind’s assault on the planet, there is an urgency to recognize the multitude of species that are yet to be described, quite simply because by not knowing what they are, where they are, and what they do, humanity has no compulsion to allow them and their wild ecosystems to co-exist (Janzen and Hallwachs 2019b). For years, this urgency of dealing with the taxonomic impediment has been recognized. The predominant solution proposed has been “give us more money and more taxonomists”, a laudable strategy but one doomed to fail as the last three or four decades have demonstrated.

In the following paragraphs we will demonstrate the magnitude of the task of describing the world fauna of one hymenopteran superfamily and demonstrate that the present approach to taxonomy is woefully inadequate regardless of the number of taxonomists employed. The Ichneumonoidea contains the two most species-rich families of Hymenoptera, i.e., Braconidae and Ichneumonidae. As of 2016, the superfamily comprised ca. 44,000 valid species (Yu et al. 2016). The true number of species can only be crudely estimated, but it is conceivable that there are 1,000,000 or more. Estimates of total species richness for this group are quite variable and have increased greatly over recent decades. Rodriguez et al. (2013) used the ratio of described wasp species to Lepidoptera hosts from relatively well studied sites to estimate the total number of species in the braconid subfamily Microgastrinae, which currently has ca. 3,000 described species (Fernandez-Triana et al. 2020). They estimated between 17,000 and 46,000 species of Microgastrinae, but they noted this is likely an under-estimate due to the many undescribed species of Microgastrinae from well-studied sites that were used to make the extrapolations. Extrapolating from Yu et al. (2016), five of every one hundred described ichneumonoid species are microgastrines (Yu et al. 2016). Assuming that this ratio holds true for undescribed species, and that the estimates made by Rodriguez et al. (2013) are sound, there are between 300,000 and at least 900,000 species of Ichneumonoidea.

Extrapolating again from Yu et al. (2016), from 2000 to 2011, an average of 468 species of ichneumonoids were described per year (Fig. 3). Given the current rate of species description and these estimates of species diversity, all ichneumonoids, that manage to remain extant, would be described somewhere between the years 2561 and 3843, if they were ever actually captured and curated.

Figure 3. 

Description rate of Ichneumonoidea species. Data from Taxapad (Yu et al. 2016) (modified from Meierotto et al. 2019a).

Given the number of the species treatments needed to tackle even a small portion of this diversity, classical taxonomic monographic treatments are not the answer. Most of the criticisms offered against our approach stifle or skate over the fundamental purpose of the method. More images, checking types of dubious likelihood of being conspecific with any of the species treated, and producing morphological keys and diagnoses all take time, too much time, and far greater financial resources are required. Worse, they can only be used by the ever-dwindling number of people that society will support to be “experts” in the field, and even when such experts do exist, they and their literature are not available to the global society at large that needs to have reason to know and understand. But there are other more practical reasons not to include some of these elements which we will get to shortly.

With a COI barcode approach, it will be relatively easy to check the identity of a new specimen of braconid from Costa Rica, and in these new stages of method evolution, we are strategically fortunate that > 95% are undescribed and will remain so unless treated differently than in a traditional manner. To identify any specimen, one simply needs to obtain the COI barcode from the specimen and check for a match in BOLD with a barcode or BIN, then compare the images and other information in the BOLD database to confirm or refute the identification. If there is no match, that specimen is then a starting point for further identification or description, and it has its collateral and barcode data already databased with its specimen voucher code. This may not yet be an effective approach today for most braconid taxa from Costa Rica, but it will be effective for all of the genera that are given a preliminary treatment, such as those presented in the chapters that follow. If a Costa Rican specimen is absent from BOLD after the publication of this and further preliminary revisions, it is straightforward for anyone to describe the species and make it available to all through the web. Processing at the Centre for Biodiversity Genomics (CBG) and the output in BOLD allows its placement in a taxonomic hierarchy; e.g., family, subfamily, and usually genus, the latter almost 95% accurate in braconids. Such description can simply follow an example from any of the following chapters. This is why some refer to COI barcoding as the democratization of taxonomy, and perhaps why it frightens some of our more conservative taxonomic practitioners, and especially those who normally work with just a few (today) important species far from the hyperdiverse tropics.

Compare this to the standard approach of identifying a braconid from Costa Rica. One would start by identifying the specimen to subfamily and genus, impossible tasks for most people, even with good keys, and a difficult task for specialists. In the case of Costa Rican braconids, this is also a rather tedious process for a specialist due to the number of new genera being encountered and generated annually. To make this example a little more understandable to the reader, we will not make a reference to the publications required to do this, rather we will let the reader verify the difficulty for themselves by trying to find the references themselves to attempt the subfamilial and generic identification of any braconid specimen from any Neotropical country. Once a generic name is in hand, the identifier will need to proceed to the species level with the knowledge that fewer than 10% of neotropical species are described. Typically, this means obtaining numerous publications, many of which are protected by copyright and expensive to purchase, even if available on the web, and then comparing the specimen in hand with diverse keys and descriptions, in assorted languages (e.g., German for Costa Rican Opiinae). Furthermore, many of the abundant English texts are based on a vocabulary that often does not have unambiguous translations to Spanish or Portuguese. When a tentative identification is made, an examination of the type specimen will almost certainly be needed for confirmation. Most readers understand the impossible barrier that this presents, especially for non-taxonomists from developing countries. Even if a morphological match with a holotype is obtained, the likelihood of cryptic species will make this morphological comparison far from certain.

Morphological keys for masses of hyperdiverse, poorly known species are all but useless, and their exclusion from the following chapters is not an oversight. This is why. For the genera treated herein, we estimate that we have barcoded at most 10–20% of the Costa Rican fauna. Most of the specimens come from caterpillar rearings in Área de Conservación Guanacaste (the size of the footprint of New York City and its suburbs, www.acguanacaste.ac.cr), and for practical reasons, fruit-feeding, stem-boring, and leaf-mining caterpillars have not yet been reared, nor those from canopy-restricted caterpillars. Added to this are specimens from approximately 16 Malaise trap-years of samples from six localities scattered across dry forest, rain forest, and cloud forest (e.g., Janzen and Hallwachs 2020b), a very small number given 120,000 terrestrial hectares of all ages of succession in ACG. In other words, many more species of the genera treated below are yet to be discovered/collected, and the probability of a specimen in hand during further sampling being in the key or other keys (e.g., Apanteles by Fernandez-Triana et al. 2014) would be considerably less than 50%. It is our intention to continue with a treatment of all species of Costa Rican braconids as new Malaise trap samples and more reared specimens become available through BioAlfa (Janzen and Hallwachs 2019b), which is an effort to DNA barcode the entire national Eukaryota. If keys were included in these preliminary revisions, addenda would need to be added to the keys on an ongoing basis, creating an even more impossible taxonomic morass for anyone other than a fanatically dedicated taxonomist specialized in Costa Rican Braconidae. There may eventually be some utility in morphological keys for these taxa, but only after the survey nears completion. Even then, the audience will be extremely limited because only Costa Rican species will be surveyed, and all genera are far more widespread, many of these with thousands of undescribed species worldwide, e.g., Chelonus, Triraphis, and Aleiodes. In any case, the effort of making a key at any time is of dubious value because the COI barcode alternative is so much more efficient and accurate, and the arcane vocabulary of entomological keys are impossible for non-specialists to interpret. The above arguments apply equally to morphological diagnoses. Perhaps one day there will be a large ecotourist economy attracting braconid aficionados to Costa Rica, certainly then a morphological key would be warranted, but by then each person will likely have their own personal pocket barcode recorder and can obtain their own identifications through the internet, with the barcode of the specimen in hand as the first couplet in the “key”.

We have often heard the criticism that a barcoding approach to species circumscription will result in duel taxonomic systems, one morphological and the other DNA-based. There is some truth to this statement if an effort is not made to blend the old with the new, and our suggestion is to discontinue revisions of complex faunas based only on morphology, as well as stop imagining that a visual comparison with ancient holotypes allows accurate decisions as to which of multiple species in a cryptic complex actually matches the holotype. Furthermore, once the species have been tagged with interim names, be they codes or human-readable scientific names, they can be studied and grouped morphologically at will.

Our arguments follow. In the generic treatments below every effort has been made to search the literature for species described by specialists who have spent a lifetime doing braconid taxonomy. In some cases, this has resulted in the discovery of published names for our barcoded specimens, e.g., Adelius gauldi and Adelius janzeni. A recent publication by Shimbori et al. (2019) treated the New World species of Adeliini and included color photos, facilitating identification. Furthermore, the two aforementioned species were both captured in the same areas of Guanacaste Province that are the source of many of our specimens, and where many years ago Janzen used the same kind of Malaise trap to capture them under the guidance of Ian Gauld. The same quality photos are in a revision of Leptodrepana by Dadelahi et al. (2018) in which they described 24 species from Costa Rica. Of these, only one species convincingly matched one of our barcoded species, and it too was collected in an area heavily sampled by Janzen and Hallwachs and their team. Papp (2016) described 25 new species of the several thousand undescribed species of Chelonus (as Microchelonus) from Costa Rica. From his descriptions, and the lack of color photos, it is very difficult to tell if any match our barcoded specimens. A number of his holotypes are from Guanacaste and Alajuela, where the bulk of our specimens were collected, but none are from the Área de Conservación de Guanacaste and it is doubtful that any match those treated here. This lack of matching is all the more probable when you consider that only one of the 24 species of Leptodrepana matched. When the Papp holotypes are barcoded, as they eventually will be, some synonyms may be revealed, and our names synonymized. This is a better situation than guessing that one of our species is the same as one of Papp’s. Information is not lost in the long run if species are split. However, if species are lumped, the literature becomes confounded with false data, in this case, host and distributional data being attributed to one species when there are actually two or more species. The Costa Rican braconid fauna is in an ideal position for our approach since few morphology-based revisions have been conducted on it. For areas such as Costa Rica, the solution to the perceived problem of duel taxonomic systems lies in barcoding the holotypes, not stasis until the myriad of new species has been treated at the traditional pace, if ever. These comments apply to any other neotropical country or large region as well.

As a final comment, the strategy employed herein may not be optimal for all taxa and in all regions of the globe. For example, even in Costa Rica, there are taxa for which there are already many described species (e.g., some families of Lepidoptera), and in these groups our approach may result in the description of an unacceptable number of synonyms, so caution has been employed. For example, the tortricid fauna of Costa Rica includes ca. 250 described species, the vast majority of which have not been barcoded. In this group, describing the 300‒400 BINs that currently have not been identified, would almost certainly result in an unacceptable number of synonyms. Also, because the genitalia of Lepidoptera harbor many of the most compelling morphological features for species discrimination and circumscription, considerably greater effort would be required to examine the morphology in these families than in Braconidae. On the other hand, the comparison of barcodes at $10/specimen is vastly cheaper in specialist’s time than is genitalic study of thousands of specimens and every effort should be made to barcode holotypes.

If there is any hope of overcoming the taxonomic impediment it will be achieved with the approach outlined here or something similar to it. The shortcomings of the method are obvious in that it only provides a first pass at the comprehensiveness that we all desire. First passes, such as those presented in the following chapters, will provide the foundations that can be augmented by subsequent generations of revisors as time, money, and determination allow.

Materials and methods

Specimens and generic placement

Approximately half of the species newly described here, and most of the specimens, were collected by rearing wild-caught host caterpillars in ACG in northwestern Costa Rica (Janzen and Hallwachs 2016). Caterpillars were collected by a team of Costa Rican parataxonomists (Janzen and Hallwachs 2011, 2016) as part of the ongoing project to document all ACG non-leaf-mining Lepidoptera larvae, their food plants, and their parasitoids. These caterpillars were databased with collection information, food plant information, and often a photograph, and they were reared to adults. When an adult moth, butterfly, or parasitoid emerged, the specimen was preserved oven-dried or frozen in 95% ethanol, and a leg was sent to the CBG at the University of Guelph, Canada (http://biodiversitygenomics.net; http://ibol.org) for DNA barcoding at a cost ranging from $3–$10 USD per specimen. Analyzed barcodes are deposited with their collateral specimen voucher data in the BOLD public database (www.boldsystems.org). The barcodes and specimens work their way towards whoever is eager to do morphology-based taxonomy, with the associated vouchers’ collateral data. Although the DNA barcodes are public domain (Costa Rican government decree #41767, Janzen and Hallwachs 2020b), as in a public dictionary, the genome associated with that barcoded specimen is currently only available through a permit-based contractual relationship with the government of Costa Rica, just as in any biodiversity prospecting relationship, be it for academic or commercial purposes.

Four sites in ACG are the subject of most of the Malaise-trapped specimens described here. Bosque San Emilio (BSE) is a 100-year old, 10‒20 m tall, secondary successional Pacific dry forest at ca. 300 m elevation in Sector Santa Rosa. Estación San Gerardo (ESG) is 30‒80-year old mid-elevation Caribbean rain forest at ca. 600 m elevation. Derrumbe (Cloud Forest) is a somewhat fragmented old-growth cloud forest at ca. 1400 m elevation near the top of 1500 m Volcán Cacao, a member of Cordillera Guanacaste that separates BSE from ESG. These three sites had one trap apiece that were operated continually, emptied once a week, for a year, and positioned beneath a broken portion of the canopy rather than in full sun or full heavy shade. The fourth site is a complex of seven Malaise traps in an area of ca. 5 km2 of forest with a 1.5 km2 bare-earth-rock geothermal drilling platform (trap numbers PL12-1-7) in the middle of the area; this forest is mostly composed of old growth at ca. 800 m elevation. The year of sampling at this site ranged from traps nearly insolated at the platform edge to 150 m distant into the shady forest understory. This forest lies at the intersection of ACG dry forest and rainforest at 800 m but slightly below the lower margin of cloud forest that starts at ca. 1000 m. All wild-caught caterpillars from which braconids were reared were found in some variant of the four ecosystems (dry, rain, cloud and interface) and within 20 km of one or more of the Malaise traps. In their first year (sometime between 2011 and 2014, these traps collected ca. 28,000 species of arthropods (excluding spiders, collembola and mites) as based on their BINs (Janzen et al. 2020).

Holotypes of all newly described species are deposited in the insect collection of the Canadian National Collection of Insects, Ottawa (CNC). Paratypes and all other specimens are deposited currently for the most part in the Biodiversity Institute of Ontario, at the University of Guelph, 579 Gordon St., Guelph, Ontario, N1G 1Y2, Canada. Others are divided between the CNC and the Hymenoptera Institute Collection (HIC), 116 Franklin Ave., Redlands, California, 92373, USA. Specimens deposited in the HIC will eventually be transferred to the CNC, and eventually representative specimens will be donated to the Museo Nacional de Costa Rica, San Jose, Costa Rica.

Identification of specimens to the subfamily level can be achieved using the key by Sharkey (1997a). Exceptions are the Hormiinae and Rhysipolinae, which were included in a large polyphyletic concept of Hormiinae s. l. in that publication. Also, the Ichneutinae and Proteropinae were included under Ichneutinae s. l. in Sharkey (1997a), and here they are separated following Chen and Achterberg (2019). For this reason, a diagnosis is given for these subfamilies in their respective chapters.

Morphological terms largely follow Sharkey and Wharton (1997), and definitions in English may be found at the Hymenoptera Anatomy Ontology Portal (http://portal.hymao.org/projects/32/public/ontology/).

Some host species are still awaiting full identification and are given interim names. For example, Antaeotricha Janzen233 is identified to the genus Antaeotricha by classical morphology-based criteria and to Janzen233 by barcode and ecological information. However, no formal scientific species name is available until a barcode-match is obtained with an existing holotype or until it is described as new, which may be decades. Equally, Antaeotricha radicalisEPR03 is also an interim name based on what the species LOOKS like, but is not, by its barcode, and note that the species epithet is not italicized and contains a number: it is not a scientific name, but temporarily retains the information that this species was called simply its look-alike A. radicalis before barcoding and associating it with other ecological data. Also, a name such as gelJanzen01 Janzen407 signifies a caterpillar in the family Gelechiidae for which even a generic name is not obtainable at present. In the future, the barcode, the temporary name, name, and BIN will remain searchable in the Janzen and Hallwachs database as well as in BOLD, GenBank, and any other public sequence repository. Continually updated copies of the Janzen and Hallwachs master database are deposited in the National Museum of Natural History, Washington, DC (USNM) and iCLOUD through Amazon, as well as in the Janzen lab and the BioAlfa project in parallel with the Museo Nacional de Costa Rica.

Focus-stacked images of specimens were taken using a JVC digital camera mounted on a Leica microscope and compiled with the program Automontage. Non-distortional image post-photography was done in Adobe Photoshop.

DNA extraction and sequencing

Molecular work was carried out at the CBG using their standard protocols. A leg of each specimen was destructively sampled for DNA extraction using a glass fiber protocol (Ivanova et al. 2006). Extracted DNA was amplified for a 658-bp region near the 5’ terminus of the cytochrome c oxidase subunit I (COI) gene using standard insect primers LepF1 (5’-ATTCAACCAATCATAAAGATATTGG-3’) and LepR1 (5’-TAAACTTCTGGATGTCCAAAAAATCA-3’) (Ivanova and Grainger 2007). If initial amplification failed, additional amplifications were conducted following the established protocols using internal primer pairs, LepF1-C113R (130 bp) or LepF1-C_ANTMR1D (307 bp) and MLepF1-LepR1 (407 bp) to generate shorter overlapping sequences. Amplified products were sequenced using Sanger technology though the most recent were sequenced by SEQUEL II. Specimens that “failed” barcoding are not included here unless otherwise indicated. When included, they are usually identified by unambiguous morphological and ecological information equally possessed by others from ACG in that species.

Databases

Voucher codes are presented for all holotype specimens (and other barcoded individuals) treated herein; and all host caterpillars are individually vouchered to their individual records (yy-SRNP-xxxxx). Codes beginning with DHPARxxxxx are for the parasite (or hyperparasite) specimens reared from the caterpillar. The SRNP voucher codes are from the Janzen and Hallwachs’ database (http://janzen.sas.upenn.edu/caterpillars/database.lasso). Specimen voucher codes beginning with BIOUG are from the BOLD database (http://www.boldsystems.org), and are specimens obtained from ACG Malaise traps. The abundant collateral information obtainable from these two databases complements the species treatments in important ways. A brief introduction to what to look for and how the databases supplement the species treatments follows.

As mentioned above, the braconid specimens reared in the ACG have a DHJPAR code and their host caterpillar has a SRNP code. These codes can be entered on the home page of the Janzen and Hallwachs database (Fig. 4). As an example, the information associated with holotype of Chelonus michellevanderbankae, DHJPAR0029134, appears as in Fig. 5, which is cropped to conserve space. The information includes details on the collection locality, host caterpillar and food plant information, dates of caterpillar collection and wasp eclosion, number of specimens emerging from the host (in the case of gregarious species), and notes on any interesting observations. In the case of a gregarious species, each wasp selected from the clutch to be DNA barcoded was given its own unique DHJPARxxxxx code, while its sibs remain tagged with the host yy-SRNP-xxxxxx code on their pin or in their alcohol preservative, a tube that is later deposited in the CNC. The written data can be in Spanish or English, or both. All dates are mm/dd/yyyy. Photos of the host caterpillar are obtained by clicking on the caterpillar image in the upper left of the image in Fig. 5. One of the five images of this parasitized caterpillar is shown in Fig. 6. Finally, if one wishes to see images of the adult of the host caterpillar, these can be found by returning to the home page, clicking on “Adult photographs” and typing the name of the host. In this example, some of the images generated are in Fig. 7.

Figure 4. 

Home page of the Janzen-Hallwachs database.

Figure 5. 

Specimen page on the Janzen-Hallwachs database for voucher DHJPAR0029134, Chelonus michellevanderbankae.

Figure 6. 

Anacrucis nephrodes (Tortricidae) last instar caterpillar parasitized by Chelonus michellevanderbankae, specimen DHJPAR0029134. Note white wasp larvae in the abdomen, visible through the translucent cuticle. The caterpillar has been exposed for the photograph by opening its leaf and silk nest, littered with its own fecal pellets.

Figure 7. 

Adults of caterpillar species attacked by Chelonus michellevanderbankae.

The BOLD website has a wealth of information related to the species that are treated in the chapters below. For example, selecting the link associated with the alphanumeric voucher code of the holotype of Aleiodes adrianaradulovae, BIOUG28804-F01, (http://boldsystems.org/index.php/Public_RecordView?processid=JICFP038-16) brings one to the specimen’s page on BOLD. Some of the contents of that page are shown in Fig. 8, including an image of the specimen (Fig. 8A). These images, taken by the Centre for Biodiversity Genomics Photography Group, are produced under significantly different lighting conditions than those in the following chapters and compliment them by showing wing venation more clearly and color more dramatically, even if not as realistically. For example, the image in Fig. 8D is our image of the same specimen as that of Fig. 8A which is from BOLD. Also included in the specimen’s home page is a locality map (Fig. 8B) and a link to the BIN page (Fig. 8C) to which the specimen belongs. Other information included in the specimen page, but not shown in Fig. 8 are locality data, collection data, and the specimen deposition locality. If the link to the specimen’s BIN (indicated with red arrow in Fig. 8) is selected, the BIN page is loaded, the contents of which are shown in Figs 9, 10. This information will increase in kind and bulk as the ACG local and BioAlfa national inventories grow over time; equally, name updates will be added as further ecological information and taxonomic revisions progress. In other words, these are dynamic databases. Over time they will link outward to other databases, such as GenBank and GBIF. While data for a particular specimen will remain tied to that specimen, these databases will contribute to species-based aggregators that will pool this information with that of other specimens from other places.

Figure 8. 

Data for Aleiodes adrianaradulovae specimen BIOUG28804-F01 A image of specimen BIOUG28804-F01as it appears on BOLD B distribution map on BOLD (which can be enlarged for more detailed locality) C BIN code and other data on BOLD D image of specimen BIOUG28804-F01 as it appears in this publication, image taken after point-mounting. Note its interim species epithet in BOLD, which was updated to the “real” code-compliant species epithet adrianaradulovae when the name was made public, i.e., this publication.

On the BIN page (Fig. 9) there is an image of a representative specimen from the BIN, and information on the COI barcode data of all members. The “BIN Details” section outlines a basic summary of records included in the BIN, including the number of members, the average genetic distance among them, the maximum genetic distance, and the distance to the closest member of the closest outgroup (Nearest Neighbor) which is normally another BIN. In the example in Fig. 9, BINBOLD:AAG1413” has the abnormally large maximum distance of 3.82% among its members and the Nearest Neighbor is almost 11% divergent. The BIN Details section also provides a “BIN DOI” which is a persistent URL that can be used in publications to access the BIN. If the BIN has not yet been assigned a DOI, a button is provided allowing a user to request a DOI.

Figure 9. 

Partial contents of BOLD:AAG1413.

The “Nearest Neighbor Details” section provides the details on the closest BIN, including its member count and the mean and maximum genetic distances among the members. It also includes the “Process ID” used in the CBG (not to be confused with the specimen voucher code) for the closest member of that BIN as well as the taxonomy for that BIN. In the ‘Specimen Images” section, there are four members of the BIN that have images. Clicking on the thumbnail images will bring them into the large image field above them.

Also included in the BIN page (Fig. 10) is a distribution map of all specimens included in the BIN, a haplotype network, a neighbor joining tree that includes the nearest neighbor (outgroup) to the BIN, and a graph of the pairwise distances between the specimens in the BIN. Considering the six specimens from Costa Rica in that BIN, there are no doubts about species integrity; however, adding in the specimens from other countries leads immediately to the strong suspicion that there are one or two more species in that BIN. We have not been able to examine those specimens. Finally, one can download a PDF of the same tree by selecting the link indicted with the red arrow in Fig. 9. The NJ tree generated is shown in Fig. 11, which has been modified to conserve space. These trees have been very informative for the revisions of Costa Rican braconids that follow. In this example (Fig. 11) there are four barcoded specimens outside of our collections, one from Mexico, two from Belize and another from Kentucky. In this work, we describe only the specimens from ACG or Costa Rica as a whole, and, as would be the case for morphological identification and larger series, leave the unexamined individuals with a question mark hovering over them. Unless there are images on BOLD that clearly suggest that non-Costa Rican specimens are different species (we have several cases of this), we remain agnostic. Otherwise, for the present, we know they are either conspecific or potential cryptic species to the Costa Rican specimens. Just as in morphological approaches, many more specimens between these disparate localities need to be collected and barcoded to reach informed conclusions. Experience to date within ACG has been that partitioning of a BIN such as that in Fig. 11 will often lead to three clearly different species as ecological information accumulates and sample sizes for the BIN increase. One will be the holotype and there will be two more to describe, precisely as occurred with the originally named Udranomia kikkawai (Hesperiidae) (Janzen et al. 2017). If an older, morphology-based holotype is located that appears to be this species, when that holotype is DNA barcoded it will match just one or none of the Costa Rican BINs. In the case of U. kikkawai, the 1906 holotype from Venezuelan rain forest was found to match the specimens from Costa Rican rain forest, and two others, one from dry forest and the other from the intergrade, were described as two new species.

Figure 10. 

Partial contents of BOLD:AAG1413.

Figure 11. 

NJ tree of BIN BOLD:AAG1413.

In Fig. 9 there is a red arrow pointing to the link “Public records in this BIN”. When this is selected, all of the specimens in the BIN are listed (Fig. 12) with links to public specimen pages with information such as that in Fig. 8.

From the list of the public records as shown in Fig. 12, users have access to download “Specimen Data,” “Sequences,” and “Trace Files” and generate an occurrence map. These options are in the upper right corner and provide various common formats. For example, “Specimen Data” can be downloaded in Darwin Core Format (DWC), XML, or TSV, and there is also the option to download the “Specimen Data” and “Sequence Data” in a combined file with either XML or TSV. Users may wish to download the sequences to use for further analysis such as Maximum Likelihood or Maximum Parsimony trees. We caution, however, that at present, BOLD does not store all of the collateral information for a particular ACG vouchered specimen. For that, the master database at http://janzen.upenn.edu needs to be consulted.

Figure 12. 

List of specimens in BIN BOLD:AAG1413.

A focus of BOLD Systems is to support collaboration and research networks, and as such, the support team at BOLD helps to connect interested parties with the owners of the specimens with data in BOLD so that they might inquire for further details or gain access to physical specimens, samples, or DNA extracts. Requests for these particular physical objects can be directed to the CBG but for ACG the request should go to DHJ and WH, who will distribute accordingly.

Sequence analysis and species determination

Sequences (barcodes) of the Costa Rican specimens were assigned to multi-specimen operational taxonomic units called Barcode Index Numbers (BINs) (Ratnasingham and Hebert 2013) that were generated by BOLD (as in mentioned above, like assigning look-alikes to unit trays visually). For each subfamily treated in the following chapters we produced a NJ tree except for Ichneutinae and Proteropinae which are combined in one tree (Suppl. materials 110) containing all records from the New World contained in the BOLD database. This revealed many BINs containing extra-Costa Rican specimens such as displayed in Fig. 11. We comment on each of these in the individual species accounts with respect to their likelihood of being conspecific with their Costa Rican BIN partners. The NJ trees are also useful to identify sister-species and closest neighbors. Link to the BOLD treatments of the holotype and the “species”, as represented by the BIN, are provided for each species. The paratypes are listed as BOLD codes where detailed information and often images can be found for each specimen.

Morphology and host information were compared to the BIN assignments that “package” the members of the NJ tree into putative species. Most specimen groups (most BINs) were supported by all data sources and treated as one species. However, as mentioned previously, in the treatment of Macrocentrus that follows here, seven species are lumped into the same BIN (BOLD:ACK7466). This is commonplace in other taxonomic groups; there are many cases where a single BIN has been shown unambiguously to be two or more species by their biology and a deeper genome probe (e.g., Hebert et al. 2004; Janzen et al. 2017). There are several reasons for this phenomenon. First, the BIN algorithm separates groups at ca. a 2% COI sequence divergence (Ratnasingham and Hebert 2013). However, while in the early stages of evolutionary separation, sympatric species can easily have their own distinctive biology and evolutionary trajectories long before their barcodes have attained 2% difference through cumulative mutations. Second, even after long periods of separation, the barcode region, by chance, may not have differentiated to the 2% level. These “shallow splits” in an NJ tree are very difficult to interpret with small sample sizes, but with either large samples and/or ecological data, they become evident flags for the presence of two or more species in the BIN, species that are in turn defined and diagnosed by non-BIN traits as well as the trait of being in that BIN (e.g., Burns et al. 2007, 2008; Bertrand et al. 2014) or by doing a deep genome probe (Janzen et al. 2017). In hyperdiverse tropical taxa, such as many of those treated here, the only practical and reliable method of species-level identification will be by their BIN code (and by a more comprehensive DNA barcode when there are multiple species in a BIN), rather than by attempting species-level identification of specimens one-by-one based on their morphology. This process renders the binominal scientific name and its higher classification, along with all the other more traditional kinds of specimen-based information, to be extremely useful because of its inferential value. However, for a specimen that has been identified by its DNA, whether by a barcode or a more profound examination of its genome, the scientific name is collateral to be curated and used just as are other units of collateral.

Species diagnoses

Our species treatments are comprised of a link to the BIN on BOLD, a consensus COI barcode, and a lateral or dorsal image of the specimen. Added to this are certain details such as the type depository and holotype locality information. There are a few exceptions to this generality. In several cases more than one species fall in the same BIN and in these cases a morphological key or morphological diagnoses are given to separate these. To facilitate an ongoing revision of the Neotropical Macrocentrinae we have also included morphological diagnoses and more comprehensive imaging for this taxon.

To comply with the Code of Zoological Nomenclature, a word-based diagnosis or definition is necessary for each new species proposed. In the past this was usually in the form of a morphological key or a suite of morphological characters that distinguish the species from others being treated. In our case consensus barcodes of the COI barcode region were employed. These can be seen as a suite of character states that are universally shared by all members of a species and unique to the species. Consensus barcodes were generated using custom software written by one of us (BVB) implemented at phorid.net/DNAbarcode. Fasta files of barcodes for all specimens of a species were downloaded from BOLD and aligned in AliView (Larsson 2014). A consensus sequence was generated by running the first script on the DNAbarcode website, uploading the aligned fasta files. Consensus sequences for multiple species generated in this way were pasted into a new AliView file and realigned. The third script on DNAbarcode was then run, using the aligned consensus sequences.

Braconid specimens from the following New World countries appear to be relatively well-sampled in BOLD: Canada, USA, Belize, Argentina, French Guiana, and Mexico. There is a small number of cases where specimens from these countries fall in the same BIN as one of our Costa Rican species. More sampling between these disparate localities, and more genomic and/or morphological and behavioral data will help resolve these species-level cases, which are beyond the scope of this paper. Only rarely are there images of these extra-Costa Rican specimens that suggest that they are not conspecific. These are discussed in more detail under their respective species treatments. To reiterate and confirm: we fully understand that barcodes are not a panacea that will solve all species-limit questions, we simply suggest that they are the optimal available first step.

We attach 10 supplementary chapters for the 11 subfamilies treated here representing ten COI NJ trees, all downloaded from BOLD in November 2020. Each is a snapshot of the dynamic project database at http://djanzen.sas.upenn.edu, select fields of which are routinely updated to BOLD for public use and taxonomic treatment as in this work. The project database is forever dynamic owing to the need for constant updating of the names of species in the ever-shifting taxonomy of plants, hosts and parasites, as new publication and biological relationships emerge. We use the NJ trees as quick visual summaries of sample sizes per species, degrees of specialization of the parasites, flagging of species new to the project, indications of taxonomic puzzles, variability in barcode length, BIN composition (the equivalent of sorting morphological look-alikes into unit trays), and data-checking. Typically, what we consider to be conspecifics are grouped together in their own terminal clade. However, specimens with less than about 550 base pairs are potentially suspect as to their placement in a NJ tree. The shorter the barcode, the more likely it is to be misplaced on the tree, requiring taxonomic placement by other traits, such as morphology or host data or both. It is not uncommon for unrelated specimens with short sequences to group together; this is because the sequences that would group them with their conspecifics are not present and only conserved base pairs, common to many species, are present. Defectively short barcodes are not honored with a BIN code, even though they may group with BINed conspecifics. The arrangement of presumed conspecifics within a BIN into shallowly separated monophyletic groups has high potential for suggesting the presence of a species complex within the BIN, a moderately frequent occurrence (10%). Resolution of such species complexes requires ecological correlates, morphological correlates, and/or a deep genomic probe (e.g., Janzen et al 2017). The appendices contain only the specimens that were successfully barcoded, while all specimens obtained by the inventory are recorded in the project database, irrespective of success in naming.

Chapter 2: Agathidinae

The key to genera by Sharkey and Chapman (2015) is outdated. We provide a new key that incorporates recent insights into generic limits and includes all New World genera. Agathidines are cosmopolitan and exclusively koinobiont endoparasitoids of caterpillars. They emerge from the host after the caterpillar is full-grown and has begun to spin or has already spun a cocoon. With one exception all are solitary. ACG agathidine genera were treated in the following publications: Sharkey et al. 2011a, Meierotto et al. (2019a), Kang et al. (2017), Janzen et al. (1998), Sharkey et al. (2016), and Sharkey et al. (2018). For the Agathidinae NJ tree, see Suppl. material 1.

Key to the New World genera of Agathidinae

1 A. Forewing venation greatly reduced; RS absent and crossvein r present only as a short stub; Neotropical, rare. Mesocoelus
B. Forewing venation moderately reduced; apical abscissa of RS absent, or mostly so, but crossvein r complete to junction of RS; Neotropical, rare. 2
C. Forewing venation not significantly reduced; apical abscissa of RS complete or almost complete to wing margin; widespread, common. 4
2(1) A. Hind wing subbasal (SB) cell 4-sided with vein Cub emanating from an angle in the cell AND/OR AA. Posterior surface of scutellum with a semi-circular or arc-shaped depression (post-scutellar depression) Therophilus (in part)
B. Hind wing subbasal (SB) cell 3-sided. If Cub vein is present, it emanates from a straight vein. BB. Post scutellar depression absent, but rugose sculpture usually present. 3
3(2) A. Median area of first tergum not raised above lateral portions and granulate or striogranulate. AA. Hind coxal cavities (HCC) open to metasomal foramen or narrowly closed and positioned partly above ventral margin of metasomal foramen (MF); ventral margin of metasomal foramen lacking a straight transverse carina Plesiocoelus
B. Median area of first tergum raised above lateral portions, sculpture variable but often smooth or smoothly striate. BB. Hind coxal cavities closed and positioned completely below the metasomal foramen; ventral margin of metasomal foramen with a strong, relatively straight transverse carina (TC) Aerophilus (in part)
4(1) A. Fore tarsal claws bifid 5
B. Fore tarsal claws simple, with distinct basal lobe. 9
C. Fore tarsal claws simple, lacking a distinct basal lobe. 31
5 A. Forewing areolet quadrate, not or only slightly narrower anteriorly. AA. Ovipositor as long as or longer than half the length of metasoma 7
B. Forewing areolet triangular, or if quadrate much narrower anteriorly. BB. Ovipositor shorter than half the length of metasoma. 6
6(5) A. Gena expanded into a flange posteriorly; malar space (MS) more than ½ length of eye height (EH); Neotropical, rare Hemichoma
B. Gena not modified into a flange posteriorly; malar space (MS) less than ½ length of eye height (EH); widespread, common Zelomorpha
7(5) A. Body predominantly orange/yellow. AA. Frons bordered by a carina posteriorly; widespread, common 8
B. Body predominantly black. BB. Frons not bordered by a carina posteriorly; southern USA through the tropical Neotropics, uncommon Zacremnops
8(7) A. Propodeum and hind coxa with granulate sculpture; first metasomal tergum ca. 3 × wider at apex than at base; rare; Neotropical, rare Labagathis
B. Propodeum and hind coxa lacking granulate sculpture; first metasomal tergum not ca. 2 × wider at apex than at base; widespread, relatively common Cremnops
9(4) A. Notauli present 10
B. Notauli absent 25
10(9) A. Ventral margin of clypeus projecting; width of temple longer than width of eye in lateral view; Nearctic, rare Gelastagathis
B. Ventral margin of clypeus not projecting; width of temple shorter than width of eye in lateral view; widespread, common 11
11(10) A. Frons bordered by carinae or grooves posteriorly. 12
B. Frons not bordered by carinae or grooves posteriorly. 14
12(11) A. Hind coxa with granulate sculpture. AA. Second submarginal cell minute or absent; Neotropical, rare Trachagathis
B. Hind coxa smooth, lacking granulate sculpture. BB. Second submarginal cell of normal dimensions; widespread, common. 13
13(12) A. First metasomal tergum smooth with two widely spaced converging carinae forming a teardrop-shaped basal area; Neotropical, rare Pharpa
B. First metasomal tergum usually smooth and convex, or BB. With a median longitudinal carina, or, BBB. Rarely with 2 carinae, in which case the tergum has more extensive sculpture; widespread, common Alabagrus
14(11) A. Malar space (MS) distinctly greater than ½ eye height (EH); head shape in frontal view elongate, at least as high (measured from ventral margin of clypeus) as wide. 15
B. Malar space USUALLY (95%) equal to or less than ½ eye height; head shape in frontal view wide, wider than high (measured from ventral margin of clypeus) 16
15(14) A. Third tergum completely smooth; pair of carinae on first tergum not prominent. AA. Hind coxal cavities (HCC) open to metasomal foramen or narrowly closed and positioned partly above ventral margin of metasomal foramen (MF); common in Nearctic, very rare in Neotropics Agathis (in part)
B. Third tergum usually (95%) partly or completely sculptured, sculpture often confined to narrow line along transverse depression; pair of carinae on first tergum prominent. BB. Hind coxal cavities closed and positioned completely below the metasomal foramen; ventral margin of metasomal foramen with a strong, relatively straight transverse carina (TC); widespread, common Aerophilus (in part)
16(14) A. Propodeal spiracle elongate, more than 2 × longer than wide; widespread, common Pneumagathis
B. Propodeal spiracle circular or ovoid, not more than 2 × longer than wide 17
17(16) A. Pair of carinae on first tergum NOT prominent. AA. Hind coxal cavities (HCC) open to metasomal foramen or narrowly closed and positioned partly above ventral margin of metasomal foramen (MF). 18
B. Pair of carinae on first tergum prominent; BB. Hind coxal cavities closed and positioned below the metasomal foramen; ventral margin of metasomal foramen with a strong, relatively straight transverse carina (TC); widespread, common Aerophilus (in part)
18(17) A. First tergum completely smooth, or rarely with some punctures posterolaterally 20
B. First tergum with sculpture 19
19(18) A. Vein Cub of hind wing long and partly tubular, apical margin of subbasal (SB) cell angled; widespread, common. Therophilus (in part)
B. Vein Cub of hind wing weak or absent and never tubular; apical margin of subbasal cell (SB) straight. Nearctic and northern Neotropics (i.e., Mexico and Central America), much less common Agathirsia (in part)
20(18) A. Notauli pitted or crenulate 21
B. Notauli smooth 24
21(20) A. Third tergum usually entirely smooth or weakly and partly coriarious (leather-like), if with different sculpture (especially in transverse depressions), then pair of longitudinal carinae on first metasomal tergum weaker than in B or absent. AA. Hind coxal cavities (HCC) open to metasomal foramen or narrowly closed and positioned partly above ventral margin of metasomal foramen (MF) 22
B. Third tergum usually partly or completely sculptured, sculpture often confined to narrow line along transverse depression; pair of longitudinal carinae on first metasomal tergum present and extending past spiracles. BB. Hind coxal cavities closed and positioned entirely below the metasomal foramen (MF); ventral margin of metasomal foramen with a strong, relatively straight transverse carina (TC); widespread, common Aerophilus (in part).
22(21) A. First tergum partly or completely granulate; widespread, common Neothlipsis
B. First tergum otherwise sculptured, usually striate or rugostriate. 23
23(22) A. Posterior apex of scutellum with a distinct depression in the form of a semicircle or two distinct pits; widespread, common. Therophilus (in part)
B. Posterior apex of scutellum lacking depression, smooth to rugose; common in Nearctic, very rare in Neotropics. Agathis (in part)
24(20) A. Propleuron with a distinct protuberance; gena expanded into an acute angle posteroventrally; Neotropical, rare Zamicrodus
B. Propleuron flat or weakly convex, lacking a distinct protuberance; genae not expanded and rounded posteroventrally; Neotropical, rare Aphelagathis
25(9) A. Second submarginal cell of forewing quadrate. AA. Cub vein of hind wing present and often tubular; subbasal cell angled distally at junction of Cub; Chile and southern Argentina (Note: Unlike the better known north temperate group of Earinus, members of this assemblage are found only in southern and high-altitude South America, and may deserve separate generic status), common Earinus (in part)
B. Not combining the above character states; second submarginal cell usually triangular. BB. Cub vein of hind wing usually absent or not tubular, and subbasal sell not angled distally. 26
26(25) A. Forewing vein RS+M present and complete, though sometimes weaker at midlength; Nearctic, common. Earinus (in part)
B. Forewing vein RS+M completely or mostly absent 27
27(26) A. Third tergum completely smooth. AA. Hind coxal cavities (HCC) open to metasomal foramen (MF), or narrowly closed such that the ventral part of the metasomal foramen is below the dorsal margin of the hind coxal cavities 28
B. Third tergum usually (95% of specimens) partly or completely sculptured, sculpture often confined to narrow lines along transverse depressions. BB. Hind coxal cavities closed and positioned completely below the metasomal foramen; ventral margin of metasomal foramen with a strong, relatively straight transverse carina; widespread, common Aerophilus (in part)
28(27) A. Spurious vein, RS2b, well-developed. AA. Ovipositor barely exerted, much shorter than metasoma. Neotropical, very rare Marjoriella
B. Spurious vein, RS2b, lacking. BB. Ovipositor at least as long as metasoma. Widespread, common 29
29(28) A. Second submarginal cell smaller than its dorsal stem; apical abscissa of RS curving towards fore margin of wing; Neotropical, very rare Smithagathis
B. Second submarginal cell larger than its dorsal stem; apical abscissa of RS straight 30
30(29) A. Posterolateral corner of gena sharp; propleuron with a protuberance; Neotropical, rare Amputoearinus
B. Posterolateral corner of gena rounded; propleuron evenly convex, lacking a protuberance; widespread, common. Lytopylus
31(4) A. Notauli absent, mesoscutum completely smooth; Neotropical, rare Sesioctonus
B. Notauli present though sometimes only indicated anteriorly or posteriorly; widespread and common in Nearctic, rare in Neotropics. 32
32(31) A. First tergum smooth, lacking microsculpture, at most with punctures laterally; Nearctic and Central America, rare 33
B. First tergum with microsculpture, usually in the form of longitudinal striae or rugae; widespread and common in Nearctic, extremely rare in Neotropics Agathis (in part)
33(32) A. Ovipositor barely exerted, shorter than half the length of metasoma; Nearctic and Central America (all species of Crassomicrodus key here) Crassomicrodus
B. Ovipositor at least as long as half the metasoma, often much longer; Nearctic and Central America, rare (few species key here) Agathirsia (in part)

Aerophilus Szépligeti, 1902

Aerophilus is worldwide in distribution with hundreds (described plus undescribed) of species in the New World. Members are parasitoids of a wide range of caterpillar families. The genus is well represented in both the Nearctic and Neotropical realms. Sharkey et al. (2016) revised the eastern Nearctic species, and Sharkey et al. (2011a) revised and keyed the Costa Rican species. The latter revision employed the name Lytopylus in error, and Sharkey et al. (2016) subsequently transferred all of the species described under Lytopylus in that paper to Aerophilus Szépligeti, 1902.

Aerophilus paulmarshi Sharkey, sp. nov.

Figure 13

Diagnostics

BOLD:ADC6602. Consensus barcode. TATTTTATATTTTATTTTTGGAATTTGATCAGGAATTTTAGGTTTATCAATAAGAATAATTATTCGAATAGAATTAAGATTAGGGGGTAATTTAATTGGTAAT---GATCAAATTTATAATAGAATTGTTTCTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGGGGACCTGATATAGCTTTTCCTCGTATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTAATATTAATTTTAAGATCTTTAATTAATATTGGAGTTGGTACAGGATGAACAGTTTATCCTCCTTTATCAATAAATATGAGTCATAGAGGAATATCAGTAGATTTAGCTATTTTTTCTTTACATATTGCAGGAATTTCTTCTATTATAGGAGCAATAAATTTTATTACAACTATTATAAATATATGAATAATCAATGTTAAAATTGATAAAATACCTTTATTAGTATGATCAATTTTTATTTCTGCTATTTTATTATTATTATCATTACCAGTATTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCATCAGGAGGAGGAGATCC----------------------.

Holotype ♀

Guanacaste, Sector Pailas Dos, PL12-3, 10.7631, -85.6138, 820 meters, Malaise trap, 6/iii/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG29687-E06.

Paratypes

None.

Etymology

Named in honor of Paul Marsh, eminent braconidologist.

Note

In the key provided by Sharkey et al. (2011a), A. paulmarshi runs to A. robpringlei (as Lytopylus robpringlei). It differs from the latter in many characters; the most conspicuous is the head color, which is almost entirely black in A. robpringlei and pale orange-yellow in A. paulmarshi.

Figure 13. 

Aerophilus paulmarshi, holotype.

Mesocoelus Schulz, 1911

Members are widespread but rarely collected in the neotropics. The extremely reduced venation of Mesocoelus is rare among agathidines, shared only with the Old World genus Aneurobracon (Agathidinae). The two described species are both from the Caribbean (holotypes from St. Vincent and Cuba). Reported hosts are Chilocampyla psidiella and Acrocercops sp., leaf-miners in the family Gracillariidae. No new host records for the genus are reported here.

Mesocoelus davidsmithi Sharkey, sp. nov.

Figure 14

Diagnostics

BOLD:AAV4319. Consensus barcode. AATTTTATATTTTATTTTTGGAGTATGGGCAGGAATTTTAGGGTTATCAATAAGATTAATTATTCGTATAGAATTAAGAGTTATTGGAAATTTTATTGGTAATGATCAGATTTATAATAGGATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGGTTTGGTAATTGATTAGTTCCATTAATAGTAGGAGGACCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCTTTATTATTATTAATTTTAAGGTCAATAGTTAATGTTGGGGTAGGAACTGGGTGAACAGTTTACCCTCCTTTATCTTTAAATATAAGGCATAGAGGGATTTCTGTTGATTTGGCTATTTTTTCTTTACACATTGCAGGAGTTTCTTCAATTATAGGAGCTATAAACTTTATTACTACTATTTTAAATATATGAATCATTAATATTAAAATTGATAAAATACCTTTATTAGTATGATCTATTTTAATTACTGCAATTTTATTATTATTATCATTACCTGTATTAGCCGGAGCAATTACTATATTGTTAACTGATCGTAATTTAAATACAAGATTTTTTGACCCGACAGGAGGAGGGGATCCTATTTTATATCAACATTTATTT. Of the two described species, M. davidsmithi is closest to M. laeviceps in that they both lack distinct notauli. To differentiate these two, M. davidsmithi has 27 flagellomeres, whereas M. laeviceps has between 19 and 22.

Holotype ♀

Heredia, 6 km ENE Vara Blanca, 10.183, -84.12, 2000 meters, 09/iv/2002, Malaise trap. Depository: CNC.

Host data. None.

Holotype voucher code. H1731.

Paratypes

None.

Etymology

The species is named in honor of Dave Smith, eminent symphytologist.

Figure 14. 

Mesocoelus davidsmithi, holotype.

Neothlipsis Sharkey, 2011

Neothlipsis is widespread in the Nearctic and northern Neotropical region. There may be ca. 70 species including undescribed species. The sole host record is Samea multiplicalis (Guenée) (Crambidae). Sharkey et al. (2011b) included eleven species but omitted the following: Neothlipsis smithi (Ashmead), new combination for Microdus smithi Ashmead, 1894; Neothlipsis pygmaeus (Enderlein), new combination for Microdus pygmaeus Enderlein, 1920; and Neothlipsis unicinctus (Ashmead), new combination for Microdus unicinctus Ashmead, 1894. All of the holotypes of these species were examined by MJS, and all are found in Mesoamerica including the Caribbean.

Neothlipsis bobkulai Sharkey, sp. nov.

Figure 15

Diagnostics

BOLD:ADB1901. Consensus barcode. TCTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGGTCCTGATATAGCTTTTCCTCGTATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTAATATTGATTTCTAGATCTATAATTAATATTGGTGTTGGTACAGGTTGAACTGTTTATCCTCCTTTATCTTTAAATTTAAGACATAGTGGAATTTCTGTAGATTTAGCTATTTTTTCTTTACATATTGCAGGAATTTCTTCTATTATGGGAGCAATAAATTTTATTACAACTATTTTAAATATATGAATAATAAATATTAAAATTGATAAAATACCATTATTAATTTGATCTATTTTTATTACAGCTATTTTATTATTATTATCTTTACCAGTATTAGCTGGGGCAATTACAATATTATTAACAGATCGAAATTTAAATACTAGATTTTTTGATCCTACAGGAGGGGGAGATCCA. Similar to Neothlipsis taeniativentris (Enderlein, 1920) but differing slightly in color, with the pale yellow on the head of N. taeniativentris more extensive.

Holotype ♀

Guanacaste, Sector Pailas Dos, PL12-3, 10.7631, -85.6138, 820 meters, Malaise trap, 5/xii/2013. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG29112-G02.

Paratypes

BIOUG29646-F07, BIOUG29620-B06, BIOUG29646-E01.

Etymology

This species is named in honor of Bob Kula, renowned braconidologist.

Figure 15. 

Neothlipsis bobkulai, holotype.

Plesiocoelus van Achterberg, 1990

Members are widespread but rarely collected in the neotropics. It is unlikely that there are more than ten species including undescribed species The holotype of the only described species from the New World, P. bassiformis, is from Ecuador. van Achterberg (1990a) also included specimens from Colombia and Honduras under that name. Long and van Achterberg (2016) described a new species from Vietnam. We report the first host records for the genus, Brenthia spp. (Lepidoptera: Choreutidae).

Bortoni and Penteado-Dias (2015) described two new species under Plesiocoelus, however, they both belong to other genera: Therophilus anomalus (Bortoni and Penteado-Dias) new combination for Plesiocoelus anomalus Bortoni & Penteado-Dias, 2015; Aerophilus areolatus (Bortoni and Penteado-Dias) new combination for Plesiocoelus areolatus Bortoni & Penteado-Dias, 2015. See the key to genera above that incorporates these aberrant species with reduced wing venation.

Plesiocoelus vanachterbergi Sharkey, sp. nov.

Figure 16

Diagnostics

BOLD:ABX6701. Consensus barcode. AATTTTATATTTTATTTTCGGAATTTGATCAGGAATTTTGGGRTTATCAATAAGWTTGGTTATTCGAATGGAATTAAGAATTACTAGAAATTTTATTGGTAATGATCAAATTTATAATAGTATTGTT-CTRCTCATGCTTTTATTATAATTTTTTTTATGGTAATACCTATTATGATTGGGGGATTYGGAAATTGATTAATTCCTTTAATATTAGGAGGTCCTGATATAGCTTTYCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTATTATTATTAATTTCTAGCTCAATTATTAATGTTGGAGTAGGAACAGGATGAACAGTTTATCCTCCTTTATCATTAAATTTAAGTCATAGTGGAATTTCAGTAGATTTAGCTATTTTTTCTTTACATATTGCTGGAATTTCATCAATTATAGGAGCAATAAATTTTATTACT-CTATTTTAAATATATGRATAATTAAAATTAATGTTGATAAAATAACTTTATTGATTTGRTCAATTTTAATTACAGCAATTTTATTATTATTATCATTACCGGTWTTAGCAGGAGCAATTACAATATTATTAACAGATCGAAATTTAAATACTAGATTTTTTGATCCTTCAGGAGGGGGAGATCCTATTTTATATCAACATTTATTT.

Holotype ♀

Alajuela, Sector Rincon Rain Forest, Jacobo, 10.94076, -85.3177, 461 meters, caterpillar collection date: 28/vii/2013, wasp eclosion date: 8/viii/2013. Depository: CNC.

Host data. Parasitoid of Brenthia Janzen02 (Choreutidae) feeding on leaves of Rhynchosia calycosa (Fabaceae).

Caterpillar and holotype voucher codes. 13-SRNP-69969, DHJPAR0053046.

Paratypes

Hosts = Brenthia Janzen02, Brenthia Janzen05, Brenthia Janzen14, Brenthia Janzen15. DHJPAR0049867, DHJPAR0048215, DHJPAR0050114, DHJPAR0053040, DHJPAR0053044, DHJPAR0053045, DHJPAR0053033, DHJPAR0045360. Depository: CNC.

Etymology

This species is named in honor of Kees van Achterberg, eminent braconidologist and author of the genus.

Figure 16. 

Plesiocoelus vanachterbergi, holotype.

Pneumagathis Sharkey, 2015

Members of Pneumagathis are restricted to North and Central America. There appear to be only two species, P. erythrogastra (Neotropical) and P. spiracularis (Nearctic), both of which are parasitoids of Hesperiidae.

Pneumagathis erythrogastra (Cameron, 1905), comb. nov.

Figure 17

Agathis erythrogastra Cameron, 1905.

Bassus brooksi Sharkey, 1998, syn. nov.

Pneumagathis brooksi (Sharkey, 1998), in Chapman and Sharkey (2015).

Diagnostics

BOLD:AAV3035. Consensus barcode. GATTTTATATTTTATTTTTGGAATTTGRTCRGGRATATTRGGTTTATCAATAAGTTTAATTATTCGAATAGAATTAAGAATTACAGGAAATTTTATTGGTAATGATCAAATTTATAATTCAATTGTT-CTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTYGGAAATTGRTTAGTYCCTTTGATATTAGGAGGRCCYGATATAGCTTTTCCDCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTAATATTATTAATATTAAGTTCAATTATTAATATTGGRGTAGGTACTGGATGAACAGTTTATCCTCCTTTATCTTTAAATATAAGTCATAGAGGWATATCAGTTGATTTAGCTATTTTTTCTTTACATATTGCTGGAATTTCTTCTATTATAGGAGCAATAAATTTTATTACMACAATTTTAAAYATATGAATTATTAATATTAAAATTGATAAAATACCTTTATTAGTRTGATCAATTTTTATTACTGCAATTTTATTATTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATATTATTGACTGAYCGAAATTTAAATACAAGATTWTTTGATCCTTCAGGAGGGGGRGATCCAATTTTATATCAACATTTRTTT------------------------------------------------------------------.

Notes

As reported in Janzen et al. (1998), P. erythrogastra (as Bassus brooksi) attacks a wide range of skipper caterpillars on broad leafed woody plants in Costa Rica. Sharkey and Chapman (2015) proposed the genus Pneumagathis. P. brooksi is a junior synonym of Agathis erythrogastra Cameron, 1905, which is transferred here to Pneumagathis.

Figure 17. 

Pneumagathis erythrogastra.

Therophilus Wesmael, 1837

Therophilus is a cosmopolitan genus with many hundreds of species (mostly undescribed). It is relatively rare in the neotropics. Published hosts include caterpillars of a wide range of lepidopteran families (Yu et al. 2016). No species have previously been recorded from Costa Rica or neighboring countries.

Therophilus penteadodiasae Sharkey, sp. nov.

Figure 18

Diagnostics

BOLD:ABZ8830. Consensus barcode. TATTTTATATTTTATTTTTGGGATTTGATCGGGAATTTTAGGGTTATCAATAAGATTATTAATTCGAATAGAGTTAAGTATTGGTGGTAATTTTATTGGTAATGATCAAATTTATAATAGAATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATRATTGGTGGTTTTGGTAATTGATTAATTCCTTTAATATTAGGAGGTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTAACATTATTAATTTTAAGTTCTTTAATTAATATTGGAGTTGGAACTGGATGAACAGTCTATCCTCCTTTATCGTTAAATATAAGACACAGAGGAATATCTGTTGATTTAGCAATTTTTTCTTTACATATTGCTGGTGTTTCTTCAATTATAGGGGCAATAAATTTTATTACAACTATTTTAAATATATGAATTGTAAATATTAAAATTGATAAAATATCTTTATTGGTTTGATCAATTTTAATTACAGCGATTTTATTATTGTTATCTTTACCAGTATTGGCTGGTGCAATTACTATATTATTAACAGATCGAAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGGGATCCAATTTTATATCAGCATTTATTT.

Holotype ♀

Guanacaste, Sector El Hacha, Casa Hacha Vieja, 10.98050, -85.54429, 290 meters, 290 meters, caterpillar collection date: 24/ii/2014, wasp eclosion date: 17/iii/2014. Depository: CNC.

Host data. Parasitoid of Antaeotricha Janzen146 (Depressariidae) feeding on Lonchocarpus oliganthus (Fabaceae).

Caterpillar and holotype voucher codes. 14-SRNP-55508, DHJPAR0055292.

Paratypes

Hosts = Antaeotricha Janzen146 and Antaeotricha Janzen366 (Depressariidae). DHJPAR0055209, DHJPAR0055544.

Etymology

The species is named in honor of Angelica Penteado-Dias, eminent Brazilian braconidologist.

Note

The wing venation is very similar to that of Plesiocoelus, but the characters given in the key (above), including the shape of the subbasal cell of the hind wing, clearly place this species in Therophilus.

Figure 18. 

Therophilus penteadodiasae, holotype.

Therophilus bobwhartoni Sharkey, sp. nov.

Figure 19

Diagnostics

BOLD:AAY4688. Consensus barcode. AATTTTATATTTTATTTTTGGAATTTGGTCGGGTATTTTGGGATTATCGATAAGTTTATTAATTCGGATGGAATTAAGAGTAGGGGGTAATTTTATTGGAAATGATCAAATTTATAATAGAATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATGGTTATACCAATTATAATTGGGGGATTTGGTAATTGATTAATTCCTTTAATGTTAGGGGGTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCCTCATTAATATTATTAATTTTGAGGTCATTAATTAATATTGGAGTTGGGACTGGRTGAACAGTTTACCCTCCTTTATCATTAAATATAAGTCATAGGGGGATATCTGTTGATTTAGCGATTTTTTCTTTGCATATGGCAGGAGTTTCTTCAATTATGGGGGCAATAAATTTTATTACTACAATTTTAAATATATGAATTATAAATATTAAAATTGATAAGATACCTTTATTAGTTTGATCGATTTTAATTACGGCAATTTTGTTATTATTATCATTACCTGTGTTAGCTGGAGCTATTACTATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGAGGGGATCCAATTTTATATCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Cacao, Sendero Nayo, 10.92446, -85.46953, 1090 meters, caterpillar collection date: 05/ii/2007, wasp eclosion date: 18/iii/2007. Depository: CNC.

Host data. Parasitoid of elachJanzen01 Janzen161 (Depressariidae) feeding on Viburnum costaricanum.

Caterpillar and holotype voucher codes. 07-SRNP-35262, DHJPAR0062169.

Paratype

Host = elachJanzen01 Janzen161: DHJPAR0041864.

Etymology

This species is named in honor of Bob Wharton, eminent braconidologist.

Figure 19. 

Therophilus bobwhartoni, holotype.

Therophilus donaldquickei Sharkey, sp. nov.

Figure 20

Diagnostics

BOLD:ADM6790. Consensus barcode. GGGAATGATCAAGTTTATAATAGAATTGTTACTGCGCATGCATTTATTATAATTTTTTTTATGGTGATACCAATTATAATTGGTGGGTTTGGAAATTGATTAGTTCCTTTAATGTTGGGAGGACCTGATATGGCTTTCCCACGAATAAATAATATAAGTTTTTGGTTATTAATTCCATCATTAATATTATTAATTTTGAGTTCTTTAATTAATATTGGGGTTGGAACAGGGTGGACAGTTTATCCTCCATTGTCATTAAATATAAGTCATAGAGGTATATCAGTTGATTTAGCTATTTTTTCTTTACATATAGCCGGTGTTTCTTCAATTATAGGAGCTATAAATTTTATTACTACAATTTTAAATATATGAATAATAACAATTAAAATTGATAAAATACCATTGTTAGTTTGATCTATTTTAATTACAGCAATTTTATTATTGTTATCTTTACCTGTGTTGGCGGGGGCTATTACTATATTATTAACAGATCGAAATTTAAATACAAGATTTTTTGATCCATCAGGTGGTGGTGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCGGGATTTGGGATTATTTCTCATATT.

Holotype ♀

Heredia, 16 km SSE La Virgen, 1050‒1150 meters, 21/iii/2001, Malaise trap. Depository: CNC.

Host data. None.

Holotype voucher code. H155.

Paratypes

None.

Etymology

The specific epithet is a patronym for Donald Quicke, eminent braconidologist.

Figure 20. 

Therophilus donaldquickei, holotype.

Therophilus gracewoodae Sharkey, sp. nov.

Figure 21

Diagnostics

BOLD:ADD0457. Consensus barcode. TATTTTATATTTTATTTTTGGAATTTGGTCGGGTATTTTGGGATTATCAATAAGTTTATTAATTCGTATAGAATTAAGAATTGGGGGTAACTTAATTGGTAACGATCAAATTTATAATAGAATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGTAATTGATTGATTCCTTTAATATTGGGGGGGCCTGATATAGCTTTCCCCCGGATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTAATATTATTAATTTTGAGTTCATTAATTAATATTGGAGTTGGAACAGGATGAACAGTTTATCCTCCTTTATCATTAAATATAAGTCATAGAGGTATATCAGTTGATTTAGCTATTTTTTCTTTACATATAGCTGGTATTTCATCAATTATGGGGGCAATAAATTTTATTACTACAATTTTTAATATATGAATTATAATAATTAAAATTGATAAAATACCATTATTAGTTTGATCTATTTTAATTACAGCAATTTTATTATTATTATCATTACCTGTATTGGCTGGGGCTATTACAATATTATTAACAGATCGAAATTTAAATACAAGATTTTTTGATCCTTCAGGGGGGGGGGA.

Holotype ♀

Guanacaste, Sector Cacao, Sendero Arenales, 10.92471, -85.46738, 1,080 meters, caterpillar collection date: 09/iv/2010, wasp eclosion date: 10/v/2010. Depository: CNC.

Host data. Parasitoid of Rhodoneura terminalis (Thyrididae) feeding on Hampea appendiculata (Malvaceae)

Caterpillar and holotype voucher codes. 10-SRNP-35134, DHJPAR0039519.

Paratypes

None.

Etymology

The species name is a patronym for Grace Wood, renowned entomologist.

Figure 21. 

Therophilus gracewoodae, holotype.

Therophilus maetoi Sharkey, sp. nov.

Figure 22

Diagnostics

BOLD:AAU5369. Consensus barcode. ATTTTTATATTTTATTTTTGGAATTTGATCAGGAATTTTAGGATTATCAATAAGTTTATTAGTTCGAATGGAATTAAGAATTRGTGGTAATTTTATTGGKAATGATCAAATTTATAATAGTATTGTAACTGCACATGCATTTATTATAATTTTTTTTATAGTTATGCCAATYATAATTGGAGGRTTTGGTAATTGGTTAGTACCTTTAATATTAGGAGGTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGGTTTTGATTATTAATYCCTTCATTAATATTATTAATTTTRAGATCATTAATTAATATTGGAGTTGGWACWGGTTGAACAGTATAYCCRCCRTTATCWTTAAATATAAGACATAGGGGTATATCTGTTGATTTRGCTATTTTTTCTTTACATATTGCTGGTATTTCATCTATTATAGGGGCAATAAATTTTATTACAACTATTTTAAATATATGAATTATTAATATTAAAATTGATAAAATRCCTTTATTAGTTTGATCAATTTTAATTACTGCAATTTTATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGTGGTGATCCAATTTTATATCAACATTTATTT.

Holotype ♀

Heredia, 6 km ENE Vara Blanca, 10.183, -84.12, 2000 meters, 21/ii/2002, Malaise trap. Depository: CNC.

Host data. None.

Holotype voucher code. H1168.

Paratypes

H1148, H1150, H1168.

Etymology

The species is named in honor of Kaoru Maetô, renowned Japanese braconidologist.

Figure 22. 

Therophilus maetoi, holotype.

Therophilus montywoodi Sharkey, sp. nov.

Figure 23

Diagnostics

BOLD:ADD0519. Consensus barcode. AATTTTATATTTTATTTTTGGGGTTTGATCAGGAATTGTAGGTTTATCAATAAGATTATTAATTCGAATGGAATTAAGAATTGGTGGTAATTTTATTGGTAATGATCAAATTTATAATAGAATTGTTACAGCTCATGCATTTGTAATAATTTTTTTTATAGTTATACCAATTATGATTGGGGGTTTTGGAAATTGATTAGTTCCTTTAATATTGGGGGGYCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTCTGGTTATTAATTCCTTCATTAATATTATTAATTTTAAGTTCATTAGTTAATATTGGAGTTGGAACAGGGTGAACAGTTTATCCTCCTTTATCTTTAAATATAAGTCATAGAGGTATATCGGTTGATTTAGCTATTTTTTCTTTACATATTGCAGGGGTTTCATCAATTATAGGGGCTATAAATTTTATTACTACAATTTTAAATATATGAATTATGAATATTAAAATTGATAAAATACCTTTATTAGTGTGATCAATTTTAATTACAGCAATTTTATTATTATTATCATTACCAGTGTTAGCAGGGGCAATTACAATATTATTAACAGATCGTAATTTGAATACAAGATTTTTTGATCCTTCTGGTGGGGGGGATCCAATTTTATATCAACATTTATTT.

Holotype ♀

Alajuela, Sector San Cristobal, Finca San Gabriel, 10.87766, -85.39343, 645 meters, caterpillar collection date: 31/vii/2009, wasp eclosion date: 26/viii/2009. Depository: CNC.

Host data. Parasitoid of Strepsicrates Brown25 (Tortricidae) feeding on Psidium guajava (introduced) (Myrtaceae).

Caterpillar and holotype voucher codes. 09-SRNP-4023, DHJPAR0040068.

Paratypes

Host = Strepsicrates Brown25: DHJPAR0038338. Depository: CNC.

Etymology

The specific epithet is a patronym for Monty Wood (RIP), renowned tachinidologist.

Figure 23. 

Therophilus montywoodi, holotype.

Zacremnops Sharkey & Wharton, 1985

Members are widespread in the neotropics. Sharkey (1990) revised the species, and one new species is reported here. There are no previously reported hosts, but here we document four species of Zacremnops on crambid caterpillars (Crambidae).

Zacremnops brianbrowni Sharkey, sp. nov.

Figure 24

Diagnosis

The COI barcode has only 293 bases and therefore was not given a BIN. This species can be distinguished from all other species of Zacremnops by red coloration restricted to the metapleuron (i.e., not on the propodeum) in combination with the melanic hind tarsus.

Holotype ♂

Alajuela, Sector Rincon Rain Forest, Sendero Juntas, 10.90661, -85.28784, 400 meters, caterpillar collection date: 11/viii/2010, wasp eclosion date: 3/ix/2010. Depository: CNC.

Host data. Parasitoid of Microthyris prolongalis (Crambidae) feeding on Ipomoea batatas (Convolvulaceae).

Caterpillar and holotype voucher codes. 10-SRNP-42859, DHJPAR0041189.

Paratypes

None.

Etymology

The species is named in honor of Brian Brown, eminent dipterist (phoridologist).

Figure 24. 

Zacremnops brianbrowni, holotype.

Zacremnops coatlicue Sharkey, 1990

Figure 25

Diagnostics

No barcode available. This species can be distinguished from all other species of Zacremnops by restriction of the red coloration to the metapleuron and propodeum, in combination with the melanic hind tarsus

Host data. All parasitoids of Syllepte belialis (Crambidae).

Material examined

Several dozen specimens reared from caterpillars collected in lowland Pacific forest, e.g., Guanacaste, Sector Santa Rosa, Sendero Natural, 10.836, -85.613, 290 meters, caterpillar collection date: 11/vi/2001, wasp eclosion date: 11/iv/2002, DHJPAR0015422.

Figure 25. 

Zacremnops coatlicue.

Zacremnops cressoni (Cameron, 1887)

Figure 26

Diagnosis

BOLD: AAV3186. Z. cressoni is the only known species of Zacremnops that has yellow hind tarsi. What appears to be this species is widespread from southern USA to northern Colombia and Venezuela, including the Caribbean.

Host data . The sole reared specimen parasitized Microthyris prolongalis (Crambidae) feeding on Ipomoea batatas (Convolvulaceae).

Material examined

Alajuela, Sector Rincon Rain Forest, Palomo, 10.96187, -85.28045, 96 meters, caterpillar collection date: 03/vi/2009, wasp eclosion date: 20/vi/2009, 09-SRNP-67297, DHJPAR0035228.

Figure 26. 

Zacremnops cressoni.

Zacremnops ekchuah Sharkey, 1990

Figure 27

Diagnosis

There are no COI barcodes available for any of the six reared specimens; however, Z. ekchuah is the only species of Zacremnops that is entirely black. What appears to be this species is widespread in Mexico with southern records in Costa Rican Caribbean mid-elevation rain forest.

Host data. Specimens were reared from spilomeline cambids, i.e., Microthyris prolongalis, Microthyris prolongalisDHJ02, Pantographa suffusalis, and Syllepte amandoDHJ02 (Crambidae).

Material examined

DHJPAR0057410, DHJPAR0052687, DHJPAR0015404, DHJPAR0015405, DHJPAR0015403, and DHJPAR0021168.

Figure 27. 

Zacremnops ekchuah.

Zamicrodus Viereck, 1912

Members of this genus are distributed widely across the neotropics. The two described species are from South America. The first host record (Hesperiidae) for the genus is reported here. The genus has not been revised, though there are likely to be fewer than ten species.

Zamicrodus josefernandezi Sharkey, sp. nov.

Figure 28

Diagnostics

BOLD:ACC5208. Consensus barcode. AATTTTATATTTTATTTTTGGTGTTTGATCAGGAATTTTAGGTTTATCTATAAGAATAATTATTCGAATAGAATTAAGAATTACAAGTAATTTTATTGGAAATGATCAAATTTATAATTCTATTGTCCTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGGACCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTATTATTAATTATAAGATCTATTATTAATATTGGAGTAGGACTGGATGAACAGTTTATCCTCCTTTATCATTAAATTTAAGTCATAGAGGTATTTCAGTAGATTTAGCTATTTTTTCTTTACATATTGCAGGAATTTCTTCTATTATAGGAGCTATAAATTTTATTACAACAATTTTAAATATATGAATTATTAATATTAAAATTGATAAAATACCCTTATTAGTTTGATCAATTTTTATTACAGCAATTTTATTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACTATATTATTACTGATCGAAATTTAAATACAAGATTTTTTGATCCTTCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT. The two described species differ from Z. josefernandezi in that their mesosomata are partly to completely pale yellow-orange, whereas that of Z. josefernandezi is completely black.

Holotype ♀

Guanacaste, Sector Pitilla, Medrano, 11.01602, -85.38053, 380 meters, caterpillar collection date: 9/ii/2012, wasp eclosion date: 8/iii/2012. Depository: CNC.

Host data. Parasitoid of Quasimellana sethos (Hesperiidae) feeding on Rhipidocladum racemiflorum (Poaceae).

Caterpillar and holotype voucher codes. 12-SRNP-70305, DHJPAR0048733.

09-SRNP-4023, DHJPAR0048733.

Paratypes

Host, Quasimellana sethos: DHJPAR0057459, DHJPAR0048728.

Etymology

The specific epithet is a patronym for José Fernandez-Triana, renowned Cuban-Canadian braconidologist.

Figure 28. 

Zamicrodus josefernandezi, holotype.

Zelomorpha Ashmead, 1900

The Costa Rican species of Zelomorpha were revised by Meierotto et al. (2019a) employing barcodes as diagnostic characters. The sole gregarious species of Agathidinae, Zelomorpha gregaria (Sarmiento & Sharkey, 2004) (originally named Coccygidium gregarium), was inadvertently omitted from that publication. The inclusion of Z. sarahmeierottoae brings the total number of Costa Rican species to 17. Hosts include caterpillars in the following families: Erebidae, Euteliidae, Geometridae, Nolidae, Notodontidae, and Noctuidae.

Zelomorpha sarahmeierottoae Sharkey, sp. nov.

Figure 29

Diagnostics

BOLD:ACG5511. Consensus barcode. TGTTTTATATTTTTTATTTGGTATATGAAGGGGAATTTTAGGATTAAGATTGAGTTTATTGGTTCGATTTGAATTAGGATTAAGAGGAAATTTAATTGGAAGTGATCAAATTTATAATAGGATAGTACTTATCATGCATTAATTATGATTTTTTTTATAGTTATACCTATTATGATTGGAGGATTTGGTAATTGGTTGGTTCCTTTATTGTTAGGAAGACCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTATTACCTTCATTAATATTATTAATTTTAAGTTCTTTTGTTAATATTGGAGCAGGTACAGGTTGGACTATTTATCCTCCATTATCATTAAATTTTAGACATAGGGGTATGTCGGTTGATTTAATAATTTTTGCTTTGCATATTGCTGGTGTTTCATCAATTATAGGTGCAATTAATTTTATTACTACTATTTTAAATATATGAATAATAAATATTAATATAGATAAAATATCTTTATTTGTTTGATCTATTTTATTAACAGCTATTTTATTATTATTATCTTTGCCAGTTTTAGCTGGAGCTATTACTATATTATTAAGAGATCGAAATTTAAATTCAAGATTTTTTGATCCTACTGGGGGAGGGGATCCTATTTTATATCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Santa Rosa, Bosque San Emilio, 10.8438, -85.6138, Malaise trap, 04/vii/2012. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG05883-E01.

Paratypes

None.

Etymology

The species is named in honor of Sarah Meierotto, former graduate student of MJS.

Figure 29. 

Zelomorpha sarahmeierottoae, holotype.

Chapter 3: Braconinae

Braconines are primarily idiobiont parasitoids of Coleoptera and Lepidoptera, but many other insect orders have been used. Below we treat only Costa Rican species. The ten reared species described below are all gregarious parasitoids of caterpillars. Hosts of the Malaise-trapped species could be larval Lepidoptera or the larvae of a number of other insect orders, the most likely being Coleoptera. The key by Quicke (1997) is somewhat dated, and a new key to the New World genera of Braconinae is presented below (constructed by Sharkey, Quicke, and van Achterberg). For the Braconinae NJ tree, see Suppl. material 2.

Key to the New World genera of Braconinae

The shape of the antennal scape is important for identification of genera. For determination of the relative lengths of the dorsal and ventral sides of the scape, as in couplets 3‒5, 11, 12, and 16, the antennae should be positioned as those of couplet 3, i.e., horizontally.

1 A. Face with a median projection that is approximately round in cross section; Neotropical, rare Lasiophorus
B. Face with large, horizontal, dorsally concave plate-like projection; Neotropical, rare 2
C. Face without a projection; widespread, common 3
2(1) A. First flagellomere with thorn-like projection Cervellus
B. First flagellomere simple or occasionally slightly flared apically Palabracon
3(1) A. Basal flagellomere (1) expanded ventrally 4
B. Basal flagellomere (1) simple, not expanded ventrally 5
4 (3) A. Scape shorter ventrally than dorsally (antenna directed anteriorly); flagellum uniformly dark, without white or cream-colored band at midlength; widespread Coeloides
B. Scape longer ventrally than dorsally (antenna directed anteriorly); flagellum with white or cream-colored band at midlength; Neotropical Megacoeloides
5(3) A. Scape with false sub-apical margin, well-separated from the real margin, and scape basally abruptly and concavely narrowing 6
B. Scape without false sub-apical margin, and scape basally gradually narrowing towards base. 10
6(5) A. Antennal sockets greatly protruding in profile; scape as wide as long; temple wider than eye; Neotropical, rare. Calobracon
B. Antennal sockets slightly protruding in profile; scape longer than wide; temple shorter than eye. 7
7(6) A. Tergum 2 with triangular or (rarely) quadrate raised area narrowed posteriorly; widespread 8
B Tergum 2 smooth and flat or with a smooth posteriorly widening “pinched-up” area; Neotropical 9
8(7) A. Raised median area of tergum 1 with semi-circular emargination postero-laterally; Neotropical Hemibracon
B. Raised median area of petiole without abrupt emargination postero-laterally; widespread. Atanycolus
9(7) A. Metasomal tergum 2 strongly ‘pinched-up’ antero-medially Gracilibracon
B. Metasomal tergum 1 not or hardly ‘pinched-up’ antero-medially Cyclaulax (in part)
10(5) A. Middle part of face clearly demarked from lateral parts by a pair of sub-medial, longitudinal carinae or rugose grooves running ventrally from the antennal sockets. AA. Metasomal tergum 2 without medial, basal, posteriorly-narrowing triangular area. 11
B. Middle part of face not clearly demarked from lateral parts by longitudinal grooves or carinae. BB. Metasomal tergum 2 often with medial, basal, posteriorly-narrowing triangular area 16
11(10) A. Hypopygium truncated in lateral aspect Compsobracon
B. Hypopygium acutely pointed in lateral aspect 12
12(11) A. Scape shorter ventrally (V) than dorsally (D) (antenna directed anteriorly) 13
B. Scape longer ventrally (V) than dorsally (D) (antenna directed anteriorly) 14
13(12) A. Propodeum simple, entirely smooth; second metasomal tergite flat or weakly pinched anteromedially Compsobraconoides
B. Propodeum with a distinct longitudinal carina posteromedially; second metasomal tergite more pinched-up medio-anteriorly Gozmanycomp
14(12) A. Length of tergum 2 more than ½ as long as tergum 3 15
B. Length of tergum 2 less than ½ length of tergum 3 Cyclaulax (in part)
15(14) A. Face rugose with a lot of granulate sculpture, often with a raised granulate area medially. AA. Raised median area of petiole rather square in cross-section, lateral margin more or less carinate posteriorly Cyclaulacidea
B. Face coarsely carinate-rugose medially with little or no granulate sculpture and without a raised granulate area medially. BB. Raised median area of petiole more rounded in cross-section Sacirema
16(10) A. Scape not, or only weakly, emarginate apicolaterally; scape shorter ventrally than dorsally (antenna directed anteriorly). 17
B. Scape apicolaterally emarginate; scape longer ventrally than dorsally (antenna directed anteriorly) 24
17(16) A. Marginal cell of forewing short, vein 3RS reaching wing margin at most 0.7 × distance between apex of stigma and wing tip. AA. Clypeus with pair of long setae arranged in a cluster and often touching apically and/or AAA. Metasomal tergum 4 with characteristic pattern of fine striae that curve away from the midline; widespread. Vipio
B. Marginal cell of forewing usually longer, vein 3RS reaching wing margin at least 0.8 × distance between apex of stigma and wing tip; if shorter, then BB. Clypeus without pair of long setae arranged in two clusters (clypeal guard setae evenly spaced and not touching apically. BBB. Metasomal tergum 4 without fine striae that curve away from the midline 18
18(17) A. Hind tibia strongly compressed laterally, very broad in lateral aspect, with conspicuously long setae. AA. Metasomal tergum 2 with a mid-longitudinal ridge; Neotropical Myosomatoides
B. Hind tibia usually not strongly compressed laterally, usually without conspicuously long marginal setae. BB. If rather strongly compressed with long marginal setae (most Myosoma species) then metasomal tergum 2 lacking mid-longitudinal ridge 19
19(18) A. Body very strongly depressed dorso-ventrally, mesosoma more than 2.8 × longer than maximally high; Nearctic, rare Chartobracon
B. Body not or only moderately depressed dorso-ventrally, mesosoma less than 2.3 × longer than maximally high 20
20(19) A. Median tergite of petiole very long and narrow, more than 2.0 × longer than maximum width. AA. First tergum usually (in dead specimens) almost vertical and abutting propodeum, and therefore difficult to see 21
B. Petiole with median tergite not especially elongate, less than 2.0 × longer than maximum width, and first tergum more or less horizontal 22
21(20) A. Hind femur and tibia with short setae typical of Braconinae; introduced to Florida and a number of Neotropical countries Amyosoma
B. Hind femur and hind tibia with long black setae; widespread Myosoma
22(20) A. Propodeum and metanotum both with a complete lamelliform mid-longitudinal carina. AA. Sternaulus deep and crenulate; Nearctic, rare Lapicida
B. Propodeum and metanotum both simple, or at most propodeum with a short mid-longitudinal carina posteriorly and/or with metanotum forming a short carina mid-anteriorly. BB. Sternaulus not depressed or if weakly depressed then not crenulate; widespread, common. 23
23(22) A. Fore wing 3RSa less than 1.5 × length of r (usually less than 1.2 ×); Antenna usually with fewer than 25 flagellomeres; widespread, common Habrobracon
B. Fore wing 3RSa more than 1.6 × length of r (usually more than 1.8 ×); antenna often with more than 25 flagellomeres; widespread, common Bracon
24(16) Propodeum coarsely sculptured. A. Forewing marginal cell short, vein 3RS reaching wing margin less than 0.8 × distance between apex of stigma and wing tip Vipiomorpha
Propodeum smooth and shiny, at most with weak punctures at bases of setae. B. Forewing marginal cell long; vein 3RS reaching wing margin more than 0.8 × distance between apex of stigma and wing tip; forewing RS+M variable, but often distinctly curved or angled posteriorly shortly after arising from 1M 25
25(24) A. Ventral border of clypeus slightly concave in frontal aspect; flagellum with fewer than 50 flagellomeres Alienoclypeus
B. Ventral border of clypeus slightly convex in frontal aspect; flagellum usually with more than 60 flagellomeres 26
26(25) A. Mandibles massive; Neotropical, rare Gnathobracon
B. Mandibles of normal size; widespread, common 27
27(26) A. With three very long pseudo-ovipositors (more than 5 × longer than body) extending from anal region [true ovipositor (indicated by arrow) much shorter]; Neotropical, very rare Pheloura
B. Without pseudo-ovipositors 28
28(27) A. Scape very long, more than 2.5 × longer than mid-width; Neotropical, rare Megabracon
B. Scape much shorter, less than 2.0 × longer than mid-width 29
29(28) A. Metasomal terga 2‒5 very long and slender, tergum 3 more than 2 × longer than maximum width; posterior margins of terga 3‒5 strongly emarginate and membranous medially, with extremely long internal apodemes; a long, slender wasp; Neotropical, rare Leptobracon
B. Metasomal terga 2‒5 not as long and slender, tergum 3 less than 2 × longer than maximum width; posterior margins of terga 3‒5 at most weakly emarginate and never with a distinct membranous median zone, and with internal apodemes never more than 2 × longer than medially wide; never as long and slender; widespread, common. 30
30(29) A. Posterior halves of metasomal terga 3‒5 thickly sclerotized and convex in lateral aspect. AA. Metasomal terga coarsely sculptured in most species; widespread, common. Digonogastra
B. Posterior halves of metasomal terga 3‒5 less thickly sclerotized and straighter in lateral aspect. BB. Metasomal terga mostly smooth; widespread, common. Cyanopterus

Bracon Fabricius, 1804

Bracon is an enormous, polyphyletic, cosmopolitan genus with thousands of undescribed species. They are idiobiont ectoparasitoids, attacking hosts in many insect orders, but primarily Coleoptera and Lepidoptera.

Bracon alejandromarini Sharkey, sp. nov.

Figure 30

Diagnostics

BOLD:ADH4980. Consensus barcode. GGAGTTTTATATTTTTTATTCGGTATATGAGCTGGTATAATTGGTTTATCTATAAGTTTAATTATTCGTTTAGAATTAGGTAYACCAGGAAGTATACTAGGGAATGACCAAATTTATAATAGAATAGTGACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGTTTAAATAATATAAGGTTTTGGTTATTAATTCCTTCATTAACTTTATTATTATTAAGAAGAATTTTAAATATTGGTGTAGGAACAGGATGAACTATATATCCTCCTTTATCTTCAAGTTTAGGCCATAGAGGTATATCAGTTGATTTGGCAATTTTTTCTTTACATTTAGCTGGGGCATCTTCAATTATAGGGGCAATAAATTTTATTACTACTATTTTAAATATACATTTAATAATAATAAAATTAGATCAATTAACTTTATTAATTTGATCTATTTTTATCACAACTATTTTATTATTATTATCTTTACCAGTATTAGCAGGGGCAATTACTATATTATTGACAGAT.

Holotype ♀

Guanacaste, Sector Cacao, Derrumbe, 10.9292, -85.4643, 1220 meters, Malaise trap, 12/iii/2015. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG32921-A02.

Paratype

BIOUG32997-A06. Depository: CNC.

Etymology

Bracon alejandromarini is named to honor Alejandro Marin for his efforts to shadow his father, Sigifredo Marin, as an apprentice to the overall managerial aspects of the projects of the Guanacaste Dry Forest Conservation Fund in support of Área de Conservación Guanacaste, and for his enthusiastic willingness to apply his professional medical knowledge to GDFCF staff in Costa Rica.

Figure 30. 

Bracon alejandromarini, holotype.

Bracon alejandromasisi Sharkey, sp. nov.

Figures 31, 32

Diagnostics

BOLD:AAA5367. Consensus barcode. TGTATTATATTTTTTATTTGGAATATGAGCYGGAATAATTGGTTTATCAATAAGTTTAATTATTCGTTTAGAATTAGGRATACCAGGTAGTTTAYTAGGTAATGATCAAATTTATAATAGTATAGTTACAGCKCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATATTAGGAGGWTTTGGTAATTGATTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTYCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTAATTTTATTATTATTAAGAAGAATTTTAAATGTTGGTGTAGGRACAGGCTGAACTATTTATCCTCCTTTATCTTCTATAATAGGTCATAGAGGWATATCTGTRGATTTATCTATTTTYTCTTTACATTTAGCTGGTATTTCTTCTATTATAGGATCGATTAATTTTATTACAACAATTTTAAATATACATTTATTAATATTAAAATTAGATCAATTAACTTTATTTATTTGATCAATTTTTATTACAACTATTTTATTATTATTATCTTTACCTGTATTAGCAGGAGCTATTACTATAYTATTAACTGATCGAAATTTWAATACTTCATTTTTTGATTTTTCTGGAGGTGGGGATCCAATTYTATTTCAACATTTATTT. Bracon alejandromasisi and B. tihisiaboshartae occupy the same BIN and have the same consensus barcode. Bracon tihisiaboshartae can be differentiated from B. alejandromasisi by the color of the metasomal terga: entirely yellow in B. tihisiaboshartae and partly black in B. alejandromasisi

Holotype ♀

Guanacaste, Sector Cacao, Sendero Nayo, 10.92446, -85.46953, 1090 meters, caterpillar collection date: 22/x/2013, wasp eclosion date: 09/xi/2013, number eclosed 17. Depository: CNC.

Host data. Gregarious parasitoid of Consul electra (Nymphalidae) feeding on leaves of Piper psilorhachis (Piperaceae).

Caterpillar and holotype voucher codes. 13-SRNP-36214, DHJPAR0054650.

Note

Bracon alejandromasisi and Bracon tihisiaboshartae occupy the same BIN but are clearly two species, see comments for B. tihisiaboshartae.

Paratypes

Hosts = Consul electra and Consul cecrops (Nymphalidae) feeding on four species of Piper (Piperaceae). 14 specimens, same data as holotype and DHJPAR0029029, DHJPAR0029036, DHJPAR0029031, DHJPAR0034263. Depository: CNC.

Etymology

Bracon alejandromasisi is named in honor of Alejandro Masis’ persistent high-quality biopoliticking on behalf of ACG in San José, Costa Rica, and especially in Guanacaste Province.

Figure 31. 

Bracon alejandromasisi, holotype.

Figure 32. 

Bracon alejandromasisi 09-SRNP-20369, dark brown cocoons filling the ultimate instar caterpillar nest of Consul fabius (Nymphalidae), with black exit holes cut by the adult wasps.

Bracon alexamasisae Sharkey, sp. nov.

Figure 33

Diagnostics

BOLD:ADF2876. Consensus barcode. GTTTTATATTTTTTATTTGGTATATGATCTGGAATATTAGGTTTATCAATAAGGTTAATTATTCGTTTAGAATTAGGTATACCAGGGAGATTATTGGGTAATGATCAAATTTATAATAGTATAGTTACTGCTCATGCTTTTGTAATAATTTTTTTTATGGTTATACCTGTAATAATTGGAGGTTTTGGAAATTGATTATTGCCTTTAATATTAGGAGCTCCAGATATAGCTTTCCCTCGTCTTAATAATATAAGATTTTGGTTATTAATTCCTTCTTTATTTTTATTACTTATAAGAAGAGTTTTAAATGTTGGTGTAGGTACAGGTTGAACAGTTTATCCACCTTTATCTTCTTCTATGGGTCATAGAGGTTTATCTGTTGATTTAGCTATTTTTTCTTTACATATTGCTGGTATTTCTTCTATTTTGGGTGCTATTAATTTTATTACAACTATTTTAAATATACATTTGTATACTTTAAAATTAGATCAGATAACTTTATTAATTTGATCAGTTTTTATTACAGTAATTTTATTATTATTATCTTTACCAGTTTTAGCTGGTGCTATTACTATATTGTTAACTGAT.

Holotype ♀

Guanacaste, Sector Cacao, Derrumbe, 10.9292, -85.4643, 1220 meters, Malaise trap, 6/xi/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG31518-E04.

Paratypes

None.

Etymology

Bracon alexamasisae is named to honor Alexa Masis for her cheerful participation in the lives and dedication of the Masis + Boshart family as it has carried out a vital role in the growth and management of the Guanacaste Dry Forest Conservation Fund and Área de Conservación Guanacaste.

Figure 33. 

Bracon alexamasisae, holotype.

Bracon andresmarini Sharkey, sp. nov.

Figure 34

Diagnostics

BOLD:ADD6766. Consensus barcode. ATATTATATTTTTTATTTGGATTATGAGCTGGTATATTAGGATTATCTATAAGTTTAATTATTCGTTTAGAATTAGGTATACCTGGTAGATTATTAGGTAATGATCAAATTTATAATAGAATAGTTACTGCCCATGCTTTTGTAATAATTTTTTTTATAGTTATACCAGTAATATTAGGAGGATTTGGAAATTGATTAATTCCGTTAATATTAGGTGCACCAGATATAGCTTTCCCTCGTTTAAATAATATAAGATTTTGATTATTAATTCCTTCATTAATTTTATTAATATTAAGAAGAATTTTAAATATTGGAGTAGGCACAGGATGAACTATATATCCTCCTTTATCATCAAATTTAGGCCACAGAGGTATATCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCCGGAGTATCCTCAATTATAGGCTCAATAAATTTTATTACAACTATTTTAAATATACATTTAGTTATAATAAAATTAGATCAACTAACTTTATTAATTTGATCAATTTTTATTACAACTATTTTATTATTATTATCTTTACCTGTTTTAGCAGGA.

Holotype ♀

Guanacaste, Sector Pailas Dos, PL12-2, 10.7634, -85.335, 824 meters, Malaise trap, 23/i/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG30922-D05.

Paratypes

None.

Etymology

Bracon andresmarini is named to honor Andres Marin for his cheerful participation in the lives and business future of the Marin and Romero families as they have carried out its vital role in the growth and management of the Guanacaste Dry Forest Conservation Fund and Área de Conservación Guanacaste.

Figure 34. 

Bracon andresmarini, holotype.

Bracon andrewwalshi Sharkey, sp. nov.

Figure 35

Diagnostics

BOLD:AAY4684. Consensus barcode. AGTTTTATATTTTTTATTTGGTATATGAGCTGGTATAGTAGGTTTATCAATAAGATTAATTATTCGTTTAGAATTAGGTATACCTGGAAGTTTATTAGGTAATGACCAAATTTATAATAGAATAGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTYATACCAGTTATATTAGGTGGATTTGGTAATTGATTAATCCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGGTTGTTAATTCCTTCATTAATTTTATTATTATTAAGAAGAATTTTAAATGTGGGTGTAGGAACAGGATGAACTATATACCCACCTTTATCTTCAAGATTAGGGCATAGAGGTTTATCTGTTGATTTAGCTATTTTTTCTCTACATTTAGCAGGAGTTTCTTCAATTATAGGTTCAATAAATTTTATTACAACTATTTTAAATATACATCTATTAATATTAAAATTAGATCAATTAACTTTATTAGTTTGATCAATTTTTATTACTACTATTTTATTATTGTTATCATTACCTGTTTTAGCAGGAGCTATCACTATATTATTAACTGATCGTAATTTAAATACTTCATTTTTTGATTTTTCAGGAGGTGGGGACCCAATTTTATTCCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Rincon Rain Forest, Zompopera, 10.8884, -85.259, 440 meters, caterpillar collection date: 19/iv/2018, wasp eclosion date: 2/v/2018. Depository: CNC.

Host data. Pirascca tyriotes (Riodinidae) feeding on Miconia argentea (Melastomataceae).

Caterpillar and holotype voucher codes. 18-SRNP-40675, DHJPAR0062680.

Paratypes

None.

Etymology

Bracon andrewwalshi is named in honor of Andrew Walsh, son of Karen Sharkey.

Figure 35. 

Bracon andrewwalshi, holotype.

Bracon anniapicadoae Sharkey, sp. nov.

Figure 36

Diagnostics

BOLD:ACL5572. Consensus barcode. AATTTTATATTTTTTATTTGGCATATGATCAGGTATAATTGGATTATCTATAAGTTTAATTATTCGATTAGAATTAAGAATACCTGGTAGATTATTAGGTAATGATCAAATTTATAATAGTATAGTAACAGCTCATGCTTTAATAATAATTTTTTTTATAGTTATACCAATTATATTAGGAGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGATTAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTAATTTTATTATTATTAAGAAGAATTTTAAATGTAGGGGTAGGAACAGGTTGAACTATATATCCACCTTTATCATCAAATATGGGACATAGAGGTTTATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCTTCCATTATAGGATCAATTAATTTTATTTCAACTATTTTAAATATACATTTAAAAATATTAAAATTAGATCAATTAACATTATTAATTTGATCAATTTTTATTACAACTATTTTATTATTATTATCATTACCTGTTTTAGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACTTCTTTTTTTGATTTTTCAGGAGGAGGAGACCCAATTTTATTCCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Santa Rosa, Bosque San Emilio, 10.8438, -85.6138, 300 meters, Malaise trap, 3/ix/2012. Depository: CNC.

Host data. None,

Holotype voucher code. BIOUG08904-B08..

Paratypes

BIOUG09441-F08, BIOUG09739-C05, BIOUG28764-A07, BIOUG28769-G07, BIOUG29282-F10. Depository: CNC.

Etymology

Bracon anniapicadoae is named to honor Annia Picado for her years of dedicated fly and microlepidopteran processing for the development of the former INBio arthropod collection, now in the Museo Nacional de Costa Rica, and now her furthering the BioAlfa program to DNA barcode all of Costa Rican eukaryote biodiversity.

Figure 36. 

Bracon anniapicadoae, holotype.

Bracon anniemoriceae Sharkey, sp. nov.

Figure 37

Diagnostics

BOLD:ADA8088. Consensus barcode. ATTTTATATTTTTTATTTGGTATATGGGCTGGTATAGTTGGTTTATCTATAAGTTTAATTATTCGTTTAGAATTGGGGATACCTGGTAGTTTATTAGGTAATGATCAAATTTATAATAGAATAGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCAGTTATATTAGGGGGRTTTGGTAATTGATTAATTCCTTTAATATTAGGGTCGCCTGATATAGCATTTCCTCGTTTAAATAATATAAGATTTTGRTTATTAGTTCCTTCATTAATTTTATTATTATTAAGAAGAATTTTAAATGTAGGAGTAGGAACTGGGTGGACAATATATCCCCCTTTATCTTCAAGTTTAGGTCATAGAGGYTTATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGGGTTTCTTCAATTATAGGTTCAATAAATTTTATTACTACTATTCTTAATATGCATTTATTAATATTAAAATTAGATCARTTGAGTTTATTGATTTGATCAATTTTTATTACTACTATTTTATTATTATTATCTTTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACAGATCGTAATTTAAATACT.

Holotype ♀

Guanacaste, Sector Pailas Dos, PL12-2, 10.7634, -85.335, 824 meters, Malaise trap, 13/ii/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28680-H11.

Paratypes

BIOUG28680-G08, BIOUG28770-H05. Depository: CNC.

Etymology

Bracon anniemoriceae is named to honor Annie Morice for her many years of cheerful office administration on behalf of Área de Conservación Guanacaste.

Figure 37. 

Bracon anniemoriceae, holotype.

Bracon barryhammeli Sharkey, sp. nov.

Figure 38

Diagnostics

BOLD:ACZ9844. Consensus barcode. TTTTTATTTGGAATTTGATCAGGTTTATTAGGGTTATCAATAAGTTTAATTATTCGTTTAGAATTAGGGACACCTAGAAGTTTAATAATAAATGATCAAATTTATAATAGAATAGTAACATCCCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATATTAGGAGGATTTGGAAATTGACTATTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTCATTATACCTTCTTTATTTTTGTTATTAATAAGAAGAATTCTGAATGTAGGGGTTGGGACTGGGTGAACTATATACCCTCCATTATCTAGTTCTTTAGGACATAACGGATTATCGGTAGATTTAGCTATTTTTGCTTTACATATAGCTGGAATATCCTCTATTTTAGGATCAATTAATTTTATTACAACTATTTTTAATATACAAATATTAAATTTAAAATTAGATCAATTAACTTTATTTATTTGATCAATTCTTATTACTACTTTTTTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACCATATTACTTACAGATCGT---------------------------------------------------.

Holotype ♂

Guanacaste, Sector San Cristobal, Estación San Gerardo, 10.8801, -85.389, 575 meters, Malaise trap, 3/viii/2015. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28152-C12.

Paratypes

None.

Etymology

Bracon barryhammeli is named to honor Barry Hammel for his many years of dedicated curatorial and taxonomic efforts for the development of the former INBio plant collection, now in the Museo Nacional de Costa Rica, and now his furthering the BioAlfa program to DNA barcode all of Costa Rican eukaryote biodiversity, with an emphasis on all Costa Rica’s plant species.

Figure 38. 

Bracon barryhammeli, holotype.

Bracon bernardoespinozai Sharkey, sp. nov.

Figure 39

Diagnostics

BOLD:ACG5363. Consensus barcode. TGTTTTATATTTTTTATTTGGGATTTGAGCAGGAATAATTGGATTATCAATAAGATTAATTATTCGGTTAGAATTA---GGAATACCAGGAAATTTATTAAATAATGATCAAATTTATAATAGTATGGTTACTTCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATAGCATTCCCCCGTCTAAATAATATAAGATTTTGGTTAATTATTCCTTCAATAATTTTATTATTATTAAGAAGAGTTGTAAATGTAGGTGTAGGTACAGGATGAACAATTTATCCACCTTTATCTTCTAATTTAGGTCACAGAGGGGTTTCAGTAGATATAGCAATTTTTTCTTTACATTTAGCTGGGGTTTCTTCTATTTTAGGGGCAATTAATTTTATTACAACAATTTTAAATATACATTTAAACATTATAAAATTAGATCAATTAACTTTATTAATCTGGTCAATTTTTATTACAACAATTTTATTGCTTTTATCTTTACCAGTATTAGCAGGTGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCTTTTTT-------------------------------------------------------------------.

Holotype ♂

Guanacaste, Sector Santa Rosa, Bosque San Emilio, 10.8438, -85.6138, 300 meters, Malaise trap, 30/vii/2012. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG05883-A04.

Paratypes

None.

Etymology

Bracon bernardoespinozai recognizes Bernardo Espinoza for his many years of dedicated curatorial and taxonomic efforts for the enhancement of the former INBio arthropod collection, now in the Museo Nacional de Costa Rica, and now his furthering the BioAlfa program to DNA barcode all of Costa Rican eukaryote biodiversity with an emphasis on Arctiinae.

Figure 39. 

Bracon bernardoespinozai, holotype.

Bracon carlossanabriai Sharkey, sp. nov.

Figure 40

Diagnostics

BOLD:ADA3386. Consensus barcode. GTTTTATATTTTTTATTTGGGATATGAGCTGGTATAGTAGGTTTATCTATAAGATTAATCATTCGTTTAGAATTAGGTATACCTGGTAGTTTACTAGGTAATGATCAAATTTATAATAGAATAGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCAGTAATAATTGGTGGATTTGGGAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATAGCTTTTCCACGTTTAAATAATATAAGATTTTGGTTATTAATTCCTTCATTAATTTTATTATTATTAAGAAGAATTTTAAATGTAGGTGTAGGTACTGGTTGAACAATATACCCTCCATTATCTTCAAGATTAGGACATAGGGGTTTATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGGGTTTCTTCAATTATAGGAGCAATAAATTTTATTACAACTATTTTAAATATACATTTATTAATATTAAAATTAGATCAATTAACTTTATTAATTTGATCTATTTTTATTACAACAATTTTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATA---------------------------------------------------------.

Holotype ♂

Guanacaste, Sector San Cristobal, Estación San Gerardo, 10.8801, -85.389, 575 meters, Malaise trap, 14/iv/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28246-E07.

Paratypes

None.

Etymology

Bracon carlossanabriai is named to honor Carlos Sanabria for his many years of dedicated efforts on behalf of Costa Rica’s Phytosanitary Service (Servicio Fitosanitario del Estado, or SFE), which in turn supports Costa Rica’s new BioAlfa program to DNA barcode the country.

Figure 40. 

Bracon carlossanabriai, holotype.

Bracon chanchini Sharkey, sp. nov.

Figure 41

Diagnostics

BOLD:ACR7966. Consensus barcode. ATTTTATATTTTTTATTTGGAATATGAGCTGGAATATTAGGTATATCTATAAGTTTAATTATTCGATTAGAATTAGGTATACCAGGTAGTTTATTGGGTAATGATCAAATTTATAACAGTATAGTTACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGGTTTGGGAATTGATTATTACCTTTAATATTAGGAGCCCCTGATATAGCATTCCCTCGTTTGAATAATATAAGGTTTTGATTAATTATCCCTTCTTTAATTTTATTATTAATAAGAAGAATTTTAAATGTAGGTGTTGGAACTGGATGAACAGTATACCCTCCTTTATCTTCTTCTTTAGGACATGGAGGATTATCTATAGATTTAGCTATTTTTTCTTTACATATGGCTGGAATTTCATCTATTTTAGGTGCAATTAATTTTATTACAACTATTTTAAATATGCATTTATTTATTTTGAAGTTGGATCAGTTAACTTTATTAATTTGATCTATTTTTATTACAGTAATTTTATTATTATTATCTTTACCAGTTTTAGCTGGAGCAATCACTATATTATTAACTGAT---------------------------------------------.

Holotype ♀

Guanacaste, Sector Santa Rosa, Bosque San Emilio, 10.8438, -85.6138, 300 meters, Malaise trap, 11/vi/2012. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG17967-B03.

Paratypes

None.

Etymology

Bracon chanchini is named to honor Chanchin, an essential member of the fauna of Sector Orosi of ACG, for his dedication to the exploration and conservation of ACG Sector Orosi.

Figure 41. 

Bracon chanchini, holotype.

Bracon christophervallei Sharkey, sp. nov.

Figure 42

Diagnostics

BOLD:ADB0826. Consensus barcode. GTTTTATATTTTTTATTTGGTATATGAGCTGGGATAATTGGTTTATCAATAAGTTTAATTATTCGTTTAGAATTAGGCATACCAGGATCTTTATTAAGAAATGATCAAATTTATAATAGAATAGTTACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGTTCTCCAGATATAGCTTTCCCTCGTTTAAATAATATGAGATTTTGATTAATTATTCCTGCAATAATTTTATTATTATTAAGGAGAATTTTAAATGTAGGTGTAGGTACTGGTTGAACAATATACCCACCTTTATCTTCTTCATTAGGTCATAGAGGAATTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAGTTTCATCTATTTTAGGTTCAATTAATTTTATTACTACCATTTTAAATATACATTTAAATATTTTAAAGATAGATCAATTAACTTTATTAGTTTGATCAATTTTTATTACAACAATTTTATTACTTTTATCTTTACCTGTTTTAGCAGGT---------------------------------------------------------.

Holotype ♂

Guanacaste, Sector Pailas Dos, PL12-6, 10.7637, -85.333, 853 meters, Malaise trap, 20/iii/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG29096-E05.

Paratypes

None.

Etymology

Bracon christophervallei is named to honor Christopher Valle, ex-fisher in ACG, for his new dedication to the conservation of ACG Sector Marino and the growth and survival of Chanchin as a member of Sector Orosi of ACG.

Figure 42. 

Bracon christophervallei, holotype.

Bracon erasmocoronadoi Sharkey, sp. nov.

Figure 43

Diagnostics

BOLD:ADH0668. Consensus barcode. TTTTTATTTGGAATATGAGCCGGAATATTAGGAATATCTATAAGTTTAATTATTCGGTTAGAATTAGGGATACCAGGTAGTTTATTGGGTAATGATCAAATTTATAATAGAATAGTTACTGCTCATGCTTTTGTAATGATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTACTACCTTTAATATTAGGTGCTCCTGATATAGCATTTCCTCGTTTAAATAATATAAGATTTTGATTAATTATTCCTTCTTTAATTTTATTATTAATAAGAAGAATTTTAAATGTAGGTGTTGGAACTGGTTGAACAGTTTACCCTCCCTTATCTTCTTCTTTAGGTCATAGAGGGCTATCTGTAGATTTAGCTATTTTTTCTTTACATATAGCTGGTATCTCCTCTATTTTAGGAGCAATTAATTTTATCACAACTATTTTAAATATACATTTATTTATTTTAAAATTAGATCAATTGACTTTATTAATTTGATCAATTTTTATCACAGTAATTTTATTACTATTATCTTTACCAGTTTTAGCTGGA-------------------------------------------------------------------.

Holotype ♀

Guanacaste, Sector Cacao, Derrumbe, 10.9292, -85.4643, 1220 meters, Malaise trap, 26/ii/2015. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG32860-H09.

Paratypes

None.

Etymology

Bracon erasmocoronadoi is named to honor Erasmo Coronado for his many years of assistance to Sigifredo Marin and other GDFCF and ACG staff, in all aspects of Área de Conservación Guanacaste management.

Figure 43. 

Bracon erasmocoronadoi, holotype.

Bracon eugeniephillipsae Sharkey, sp. nov.

Figure 44

Diagnostics

BOLD:ADA9990. Consensus barcode. GTTTTATATTTTTTATTTGGTTTATGATCAGGAATTTTAGGTCTATCAATAAGTTTAATTATTCGATTAGAATTAGGTATACCAGGCAGGATATTAGGTAATGATCAAATTTATAATAGTATTGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGGTTATTGCCTTTAATATTAGGAGCTCCTGATATGGCATTYCCTCGTTTAAATAATATAAGATTTTGATTAATTTTCCCTTCTTTAATTTTATTATTAATAAGTAGGATTTTAAATGTAGGAGCAGGTACAGGTTGGACAGTTTATCCTCCTTTATCTTCTTCATTAGGACATAGAGGTTTATCAGTTGATTTAGCTATTTTTTCTTTACATATAGCTGGTGTATCTTCAATTTTAGGAGCAATTAATTTTATCACTACAATTTTAAATATGCATTTAAATACTTTAAARTTAGATCAATTAACTTTAATAATTTGATCAATTTTTATTACTGTAATTTTATTATTGTTATCTTTACCAGTTTTAGCAGGGGCTATTACTATATTATTAACTGATCGA.

Holotype ♀

Guanacaste, Sector Pailas Dos, PL12-9, 10.76, -85.3341, 809 meters, Malaise trap, 6/ii/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28680-G05.

Paratypes

BIOUG28680-A07, BIOUG28680-E08, BIOUG29219-D01.

Etymology

Bracon eugeniephillipsae is named to honor Eugenie (Jenny) Phillips for her many years of dedicated curatorial and taxonomic efforts for the development of the former INBio arthropod collection, now in the Museo Nacional de Costa Rica, and now her administrative development of BioAlfa, the program to DNA barcode all of Costa Rican eukaryote biodiversity.

Figure 44. 

Bracon eugeniephillipsae, holotype.

Bracon federicomatarritai Sharkey, sp. nov.

Figure 45

Diagnostics

BOLD:ACM9419. Consensus barcode. TGTCTTATATTTTTTATTTGGTTTATGAGCTGGAATATTAGGTTTATCTATAAGTTTAATTATTCGATTAGAATTAGGTATACCTGGTAGATTATTAGGTAATGACCAAATTTATAATAGTATAGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCAGTAATATTAGGAGGATTTGGAAATTGGTTAATTCCTTTAATATTAGGGGCCCCAGATATAGCTTTCCCACGTTTAAATAACATAAGATTTTGATTACTAATTCCTTCATTAATTTTATTATTATTAAGAAGAATTTTAAATATTGGGGTTGGTACAGGTTGGACAATATACCCCCCATTATCATCAAATTTAGGACATAGAGGGATATCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTATAGGGTCAATAAATTTTATTACAACTATTTTAAATATACATTTAATTACAATAAAACTAGATCAACTAACTTTATTAGTTTGATCAATTTTTATTACAACTATTTTACTATTATTATCTCTACCTGTTTTAGCAGGGGCTATTACTATACTTTTAACAGATCGTAATTTAAATACTTCTTTTTTCGATTTTTCAGGAGGAGGGGACCCTATTTTATTCCAACATTTATTT.

Holotype ♀

Alajuela, Sector Rincon Rain Forest, Sendero Anonas, 10.90527, -85.27881, 405 meters, caterpillar collection date: 18/iii/2014, wasp eclosion date: 30/iii/2014, 2 wasps eclosed from 2 cocoons. Depository: CNC.

Host data. Gregarious parasitoid of Tebenna Janzen02 (Choreutidae) feeding on Ficus citrifolia (Moraceae).

Caterpillar and holotype voucher codes. 14-SRNP-41359, DHJPAR0055286.

Paratype: One specimen same data as holotype. Depository: CNC.

Etymology

Bracon federicomatarritai is named in honor of Federico Matarrita’s diligent and high-quality management of the ACG web site and guiding the parataxonomists to iteratively contribute to it.

Figure 45. 

Bracon federicomatarritai, holotype.

Bracon frankjoycei Sharkey, sp. nov.

Figure 46

Diagnostics

BOLD:ACJ2744. Consensus barcode. TATTTTATATTTTTTATTTGGTATATGAGCAGGTATAGTAGGTTTATCTATAAGATTAATTATTCGTTTAGAATTAGGTATACCT---GGGAGTTTATTAGGTAATGATCAAATTTATAATAGTATAGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTATTATATTAGGTGGGTTTGGAAATTGGTTAATTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGATTAAATAATATGAGATTTTGATTATTAATCCCTTCATTAATTTTATTATTATTAAGAAGAATTTTAAATGTTGGTGTAGGTACTGGGTGAACAATATACCCTCCATTATCTTCAAGATTAGGCCATAGAGGTTTATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTGTTTCTTCAATTATAGGGTCAATAAATTTTATTACTACAATTTTAAATATACATTTATTAATGTTAAAAATAGATCAATTAACTTTATTAATTTGATCAATTTTTATTACTACTATTTTATTATTATTATCTTTACCAGTATTAGCAGGGGCTATTACAATATTATTAACTGATCGTAACTTAAATACTTCTTTTTTTGACTTTTCTGGCGGAGGGG--------------------------.

Holotype ♀

Guanacaste, Sector Santa Rosa, Bosque San Emilio, 10.8438, -85.6138, 300 meters, Malaise trap, 9/iv/2012. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG07560-C12.

Paratypes

None.

Etymology

Bracon frankjoycei is named to honor Frank Joyce for his many decades of insanely invaluable attention to the biodiversity and sociology on behalf of Parque Nacional Santa Rosa and now Área de Conservación Guanacaste.

Figure 46. 

Bracon frankjoycei, holotype.

Bracon gerardovegai Sharkey, sp. nov.

Figure 47

Diagnostics

BOLD:ACW3155. Consensus barcode. TTATTAGGGATTTGATCTGGAATTTTAGGATTATCTATAAGATTAATTATTCGGTTAGAACTAGGAACTTCAGGATTTTTATTAGGTAATGATCAAATTTATAATAGATTAGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATACTAGGAGGATTTGGAAATTGATTAATCCCTTTAATATTGGGGGCTCCTGATATAGCATTCCCTCGAATAAATAATATAAGGTTTTGACTTCTTATTCCTTCATTAATATTATTAATTTTAAGAAGAATCTTAAATGTAGGAGTTGGCACAGGGTGAACAATATATCCTCCTTTATCTTCTTCTATAGGTCATAGAGGATTATCTACAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAGCATCCTCAATTTTAGGAGCTATTAATTTTATTACAACAATTTTTAATATAAAATTAAATTCAATAAAATTAGATCAATTAACTTTATTAATTTGATCTATTTTAATTACTACAATTTTATTATTATTATCTTTACCTGTGTTAGCTGGAGCTATTACTATATTATTAACGGAT.

Holotype ♀

Guanacaste, Sector San Cristobal, Estación San Gerardo, 10.8801, -85.389, 575 meters, Malaise trap, 2/xii/2013. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG22966-G03.

Paratype

BIOUG27938-F06. Depository: CNC.

Etymology

Bracon gerardovegai is named to honor Gerardo Vega (RIP) for his many years of dedicated and enthusiastic field assistance to Janzen and Hallwachs’ field ecological studies in Costa Rica’s Parque Nacional Corcovado and Parque Nacional Santa Rosa.

Figure 47. 

Bracon gerardovegai, holotype.

Bracon germanvegai Sharkey, sp. nov.

Figure 48

Diagnostics

BOLD:ADL8270. Consensus barcode. TTATTAGGGATTTGATCTGGAATTTTAGGATTATCTATAAGATTAATTATTCGGTTAGAACTAGGAACTTCAGGATTTTTATTAGGTAATGATCAAATTTATAATAGATTAGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATACTAGGAGGATTTGGAAATTGATTAATCCCTTTAATATTGGGGGCTCCTGATATAGCATTCCCTCGAATAAATAATATAAGGTTTTGACTTCTTATTCCTTCATTAATATTATTAATTTTAAGAAGAATCTTAAATGTAGGAGTTGGCACAGGGTGAACAATATATCCTCCTTTATCTTCTTCTATAGGTCATAGAGGATTATCTACAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAGCATCCTCAATTTTAGGAGCTATTAATTTTATTACAACAATTTTTAATATAAAATTAAATTCAATAAAATTAGATCAATTAACTTTATTAATTTGATCTATTTTAATTACTACAATTTTATTATTATTATCTTTACCTGTGTTAGCTGGAGCTATTACTATATTATTAACGGAT.

Holotype ♂

Guanacaste, Sector Cacao, Derrumbe, 10.9292, -85.4643, 1220 meters, Malaise trap, 4/vi/2015. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG36580-A08.

Paratypes

None.

Etymology

Bracon germanvegai is named to honor German Vega for his many years of administrative and taxonomic efforts in the Museo Nacional de Costa Rica.

Figure 48. 

Bracon germanvegai, holotype.

Bracon isidrochaconi Sharkey, sp. nov.

Figure 49

Diagnostics

BOLD:ADA7614. Consensus barcode. GTTTTATATTTTTTATTTGGAATATGAGCTGGTATAGTTGGTTTATCAATAAGAATAATTATTCGTTTAGAATTAGGTATACCTGGATTTTTATTAATAAATGATCAAATTTATAATAGAATAGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGGAATTGATTAGTTCCTTTAATATTAGGTTCTCCAGATATAGCTTTCCCTCGTTTAAATAATATAAGATTTTGATTAATTATCCCAGCAATAATTTTATTATTATTAAGAAGAATTTTAAATGTTGGTGTAGGTACAGGTTGAACAATTTACCCTCCTTTATCTTCTTCTTTAGGACATAGAGGAATTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGTTCAATTAATTTTATTACAACAATTTTAAATATACATTTAAATGTATTAAAGATAGATCAATTAACTTTATTTGTTTGGTCAATTTTTATTACTACAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACAATATTA------------------------------------------------------.

Holotype ♀

Guanacaste, Sector Pailas Dos, PL12-9, 10.76, -85.3341, 809 meters, Malaise trap, 23/i/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28721-H09.

Paratypes

None.

Etymology

Bracon isidrochaconi is named to honor Isidro Chacon for his many years of dedicated curatorial and taxonomic efforts for the advancement of the former INBio arthropod collection, now in the Museo Nacional de Costa Rica, and now his furthering the BioAlfa program to DNA barcode all of Costa Rican eukaryote biodiversity with an emphasis on Notodontidae, butterflies, Bombycoidea, and Noctuoidea.

Figure 49. 

Bracon isidrochaconi, holotype.

Bracon jimlewisi Sharkey, sp. nov.

Figure 50

Diagnostics

BOLD:ADL5861. Consensus barcode. TGTTTTATATTTTTTATTTGGGGTTTGATCTGGATTTTTAGGTTTATCTATAAGATTAATTATTCGTATAGAATTGAGTATACCAGGAAGATTATTAAGTAATGATCAAATTTATAATAGTTTAGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATAGCTTTCCCTCGATTAAATAATATAAGATTTTGGTTAATTATTCCTTCATTAATACTATTAATTTTAAGAAGAATTTTAAATGTTGGGGTAGGTACAGGTTGAACAATATACCCCCCTTTATCTTCTTCTTTAGGGCATAGAGGTAATTCAACTGATTTAGCTATTTTTTCTTTACATATAGCTGGAATTTCTTCAATTTTAGGGGCTATTAATTTTATTACAACTATTTTTAATATAAAATTATTTTTTTTAAAATTTGATCAATTAACTTTATTTATTTGATCAATTTTAATTACAACAATTTTATTATTGTTATCTTTACCAGTTTTAGCTGGGGCAATCACAATA---------------------------------------------.

Holotype ♀

Guanacaste, Sector Cacao, Derrumbe, 10.9292, -85.4643, 1220 meters, Malaise trap, 9/vii/2015. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG36967-F06.

Paratypes

None.

Etymology

Bracon jimlewisi is named to honor Jim Lewis for his many years of dedicated volunteer curatorial and taxonomic efforts for the construction of the former INBio arthropod collection, now in the Museo Nacional de Costa Rica, and now his furthering the BioAlfa program to DNA barcode all of Costa Rican eukaryote biodiversity, with an emphasis on Hemiptera.

Figure 50. 

Bracon jimlewisi, holotype.

Bracon josejaramilloi Sharkey, sp. nov.

Figures 51, 52

Diagnostics

BOLD:ACK7911. Consensus barcode. TATTTTATATTTTTTATTTGGTATATGAGCTGGTATGTTAGGTTTATCAATAAGAATAATTATTCGGTTAGAATTAGGTATACCAGGAAGATTACTAGGTAATGATCAAATTTATAATAGTATAGTTACTGCTCATGCATTTGTTATAATTTTTTTTATAGTTATACCAATTATATTAGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGATTAATTATTCCTTCTTTAGTTTTATTATTATTAAGAAGAATTTTAAATATTGGGGCAGGAACAGGATGAACTATATATCCTCCTTTATCTTCTCATTTAGGTCATAGAGGTATATCAGTTGATTTAGCTATTTTTTCTTTACATATAGCAGGGATTTCATCAATTTTAGGATCTATTAATTTTATTACAACAATTTTAAATATACATTTATTTACTTTAAAATTAGATCAATTAACTTTATTAGTTTGATCAATATTTATTACTACAATTTTATTATTATTATCTTTACCAGTTTTAGCAGGGGGTATTACAATATTATTAACAGACCGTAAYCTAAATACTTCATTTTTTGATTTTTCTGGAGGAGGAGATCCTATTTTATTCCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Pitilla, Pasmompa, 440 meters, 11.01926, -85.40997, caterpillar collection date: 21/ii/2012, wasp eclosion date: 08/iii/2012, 11 wasps eclosed from 15 cocoons. Depository: CNC.

Host data. Gregarious parasitoid (Fig. 52) of Lerema liris (Hesperiidae) feeding on leaves of Homolepis aturensis (Poaceae).

Caterpillar and holotype voucher codes. 12-SRNP-30473, DHJPAR0049094.

Paratypes

Hosts = Lerema liris and Morys valerius (Hesperiidae). DHJPAR0049094, DHJPAR0028977, DHJPAR0058913.

Etymology

Bracon josejaramilloi is named in honor of José Jaramillo of Área de Conservación Guanacaste in recognition of his 30 years of managing ACG mechanics, telecommunication, computer, and internet processing for ACG and its web site.

Figure 51. 

Bracon josejaramilloi, holotype.

Figure 52. 

Bracon josejaramilloi (12-SRNP-30473) ultimate instar wasp larvae below their host ultimate instar caterpillar Lerema liris (Hesperiidae); as a group they will spin a roof-in-common followed by their individual closely packed cocoons below that roof, adjacent to the cadaver of the caterpillar.

Bracon juanjoseoviedoi Sharkey, sp. nov.

Figure 53

Diagnostics

BOLD:ADB0539. Consensus barcode. ATTTTATATTTTTTATTTGGTATATGAGCTGGAATATTAGGTTTATCAATAAGATTAATTATTCGATTAGAATTAGGAATACCAGGAAGATTATTAGGAAATGATCAAATTTATAATAGAATAGTGACAGCTCATGCATTTGTTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTATTACCTTTAATATTAGGGGCTCCTGATATAGCTTTTCCTCGTCTTAATAATATAAGATTTTGATTAATTATTCCGGCTTTAATTTTATTACTAATAAGAAGAATTTTAAATGTAGGTGTAGGTACTGGTTGAACAGTTTATCCTCCTTTATCTTCTTCTTTAGGTCATAGAGGTTTATCTGTTGATTTAGCTATTTTTTCTTTACATATTGCTGGTATTTCTTCAATTTTAGGGGCAATTAATTTTATTACAACAATTTTAAATATACATTTATATAAATTAAAATTAGATCAATTAACTTTATTAACTTGATCAATTTTTATTACAGTAATTCTTTTACTTTTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTTTTAACTGATCGA------------------------------.

Holotype ♀

Guanacaste, Sector Pailas Dos, PL12-2, 10.7634, -85.335, 824 meters, Malaise trap, 13/ii/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28680-H09.

Paratypes

None.

Etymology

Bracon juanjoseoviedoi is named to honor Juan José Oviedo for his new efforts on behalf of Costa Rica’s Phytosanitary Service (Servicio Fitosanitario del Estado, or SFE), which in turn supports Costa Rica’s new BioAlfa program to DNA barcode the country.

Figure 53. 

Bracon juanjoseoviedoi, holotype.

Bracon juliodiazi Sharkey, sp. nov.

Figure 54

Diagnostics

BOLD:ACG3370. Consensus barcode. TATTTTATATTTTTTATTCGGAATATGAGCAGGTATATTAGGATTATCTATAAGAATAATTATTCGATTAGAATTAGGRATACCTGGGACTTTATTAGGCAATGATCAAATTTATAATAGAATAGTGACAGCTCATGCATTTGTTATAATTTTTTTTATAGTTATACCAATTATACTAGGGGGTTTCGGTAATTGATTAATTCCTTTAATATTAGGAGCCCCAGACATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTAATTATTCCTTCTTTAATTTTATTATTATTAAGAAGAATTTTAAATGTAGGGGTAGGTACTGGATGAACTGTTTATCCTCCCTTATCTTCTTCTTTAGGTCATAGAGGCATATCTGTTGATTTAGCAATTTTTTCATTACATTTAGCAGGTATTTCTTCAATTTTAGGTTCAATTAATTTTATTACAACTATTTTAAATATAAAATTACATACAATAAAATTAGATCAATTAACTTTATTAATTTGATCAATTTTTATTACTACAATTTTATTATTATTATCTTTACCAGTTYTAGCGGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATTTTTCTGGGGGAGGTGACCCTATTTTATTCCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Santa Rosa, Bosque San Emilio, 10.8438, -85.6138, 300 meters, Malaise trap, 29/x/2012. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG09074-C11.

Paratypes

BIOUG09074-B05, BIOUG09074-B02. Depository: CNC.

Etymology

Bracon juliodiazi is named to honor Julio Diaz for his many years of dedicated guidance and administration of the ACG Protection and Fire Control Program.

Figure 54. 

Bracon juliodiazi, holotype.

Bracon luzmariaromeroae Sharkey, sp. nov.

Figure 55

Diagnostics

BOLD:ADF0526. Consensus barcode. AATTTTATATTTTTTATTTGGAATATGATCTGGAATAATTGGTTTATCTATAAGTTTAATTATTCGTTTAGAATTAGGAATACCTGGAAGATTATTGAGAAATGACCAAATTTATAATAGAATAGTTACAGCTCATGCTTTAGTAATAATTTTTTTTATAGTTATACCAATTATATTAGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGATTAAATAATATAAGATTTTGATTATTAATTCCTTCTTTAATTTTATTATTATTAAGAAGAATTTTAAATGTTGGTGTTGGAACAGGATGAACTTTATACCCTCCTTTATCTTCAAATTTAGGACATAATGGAGTATCTGTAGATTTATCTATTTTTTCTTTACATTTAGCTGGTATTTCATCAATTATAGGTTCATTAAATTTTATTACTACTATTTTAAATATACATTTATTAATATTAAAATTAGATCAATTAACTTTATTAATTTGATCAATTTTTATTACAACTATTTTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTTCATTTTTTGATTTTTCAGGAGGTGGTGACCCAATTCTATTTCAACATTTATTT.

Holotype ♂

Alajuela, Sector Rincon Rain Forest, Casa Keyner, 10.95644, -85.26611, 121 meters, caterpillar collection date: 13/viii/2016, wasp eclosion date: 23/viii/2016, six wasps eclosed from six cocoons. Depository: CNC.

Host data. Gregarious parasitoid of Vettius aurelius (Hesperiidae) feeding on mature leaves of Lasiacis sorghoidea (Poaceae).

Caterpillar and holotype voucher codes. 16-SRNP-46268, DHJPAR0060193.

Paratypes

Five specimens, same data as holotype but still coded with their caterpillar code 16-SRNP-46268 (DHJPAR codes not assigned). Depository: CNC.

Etymology

Bracon luzmariaromeroae is named in recognition of Luz Maria Romero’s 30+ years of facilitating ACG, developing its Biological Education Program, and coaching the parataxonomists to improve their databases and species pages on the ACG web site.

Figure 55. 

Bracon luzmariaromeroae, holotype.

Bracon manuelzumbadoi Sharkey, sp. nov.

Figure 56

Diagnostics

BOLD:ADH5864. Consensus barcode. GTGTTTTATATTTTTTGTTTGGTATATGGTCTGGGATATTAGGGATATCTATAAGATTAATTATTCGATTAGAATTAGGAATACCCGGTAGATTATTAGGGAATGATCAACTTTATAATAGTATGGTAACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTGTAATAATTGGGGGTTTTGGCAATTGATTATTACCTTTAATATTAGGGTCCCCTGATATAGCTTTCCCTCGTCTTAATAATATAAGATTTTGATTGATTATTCCTTCATTAATTTTGTTATTAATAAGAAGAATTTTGAATGTAGGTGTAGGTACTGGTTGAACTGTATATCCTCCTTTATCTTCTTCTTTAGGACATAGGGGGATATCTGTTGATTTAGCTATTTTTTCTTTACATATTGCTGGAGTATCCTCAATTTTAGGAGCAATTAATTTTATTAGAACTATTTTAAATATACATTTATTTATATTAAAATTGGATCAATTAACTTTGTTAATTTGATCAATTTTTATTACTGTTATTTTATTATTATTATCTTTACCAGTTTTAGCTGGTGCAATTACTATATTATTAACTGAT.

Holotype ♀

Guanacaste, Sector Cacao, Derrumbe, 10.9292, -85.4643, 1220 meters, Malaise trap, 2/iv/2015. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG33120-A12.

Paratypes

None.

Etymology

Bracon manuelzumbadoi is named to honor Manuel Zumbado for his many years of dedicated curatorial and taxonomic efforts for the construction of the former INBio arthropod collection, now in the Museo Nacional de Costa Rica, and now his furthering the BioAlfa program to DNA barcode all of Costa Rican eukaryote biodiversity, with an emphasis on Diptera.

Figure 56. 

Bracon manuelzumbadoi, holotype.

Bracon marialuisariasae Sharkey, sp. nov.

Figure 57

Diagnostics

BOLD:ADA9695. Consensus barcode. GTTTTATATTTTTTGTTTGGGATATGATCTGGTATAATTGGTTTATCAATAAGTTTAATTATTCGTTTAGAATTGGGTATACCAGGTAGATTATTAGGCAATGATCAGATTTATAATAGTATAGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATGCCTGTAATATTAGGAGGGTTTGGGAATTGATTAATTCCTTTAATGTTGGGTGCTCCTGATATAGCTTTCCCTCGTATAAATAATATAAGGTTTTGGTTATTAATTCCTTCATTGGTTTTATTATTACTAAGAAGAATTTTAAATGTTGGTGTTGGGACTGGGTGAACTATATACCCTCCTTTATCTTCAAGATTAGGTCATAGTGGTTTGTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGGGTATCTTCAATTATAGGGGCAATTAATTTTATTACAACTATTTTAAATATACATTTATTTATATTAAAATTAGATCAATTAACTTTGTTAATTTGATCAATTTTTATCACAACTATTTTATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATGTTATTAACTGATCGTAAT---------------------------.

Holotype ♂

Guanacaste, Sector Pailas Dos, PL12-2, 10.7634, -85.335, 824 meters, Malaise trap, 23/i/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28680-C06.

Paratypes

None.

Etymology

Bracon marialuisariasae is named to honor Maria Luisa Arias for her decades of administrative effort on behalf of Parque Nacional Santa Rosa and now Área de Conservación Guanacaste.

Figure 57. 

Bracon marialuisariasae, holotype.

Bracon mariamartachavarriae Sharkey, sp. nov.

Figure 58

Diagnostics

BOLD:AAV6295. Consensus barcode. AATTTTATATTTCTTATTTGGYATATGAGCAGGTATAGTAGGYYTATCAATAAGTTTAATTATTCGATTAGAATTAGGKATACCTGGRTCATTATTAGGWAATGATCAAATTTATAATAGAATAGTKACAGCTCATGCTYTARTWATAATTTTTTTTATAGTTATACCAGTAATATTAGGAGGTTTTGGTAATTGATTAATTCCTTTAATATTAGGWGCTCCTGATATAGCYTTCCCTCGATTAAATAATATAAGTTTTTGRTTAYTAATYCCTTCATTAATTTTATTAATATTAAGAAGAATTTTAAATGTAGGTGTAGGTACAGGTTGAACTTTATAYCCTCCATTATCYTCAAATTTAGGACATAGAGGDTTATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTGTATCTTCAATTATAGGTTCAATAAATTTTATTACTACTATTTTAAATATACATTTATTAATATTAAAATTAGATCAATTAACTTTATTAATTTGATCAATTTTTATTACAACTATTTTATTATTATTATCTTTACCYGTWTTAGCAGGWGCAATTACAATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATTTTTCAGGWGGAGGAGAYCCAATTYTATTYCAACATTTATTT. Terminal flagellomeres black, concolorous with basal flagellomeres.

Holotype ♀

Alajuela, Sector Rincon Rain Forest, Selva, 10.92291, -85.31877, 410 meters, caterpillar collection date: 05/viii/2017, wasp eclosion date: 21/viii/2017; nine wasps eclosed from 11 cocoons. Depository: CNC.

Host data. Gregarious parasitoid of Drephalys Burns01 (Hesperiidae) feeding on mature leaves of Vochysia guatemalensis (Vochysiaceae).

Caterpillar and holotype voucher codes. 17-SRNP-80872, DHJPAR0061668.

Paratypes

Eight specimens, same data as holotype. Depository: CNC.

Other specimens

There are three specimens from French Guiana (e.g., ASNUR330-11) and one from Argentina (BIOUG13458-C11) in the same BIN, none of which we consider to be conspecific with the Costa Rican specimens. Images on BOLD show that the French Guiana specimens have the terminal flagellomeres yellow. There are no images for the Argentinian specimen, but its locality makes it unlikely to be conspecific.

Etymology

Bracon mariamartachavarriae is named in honor of Maria Marta Chavarria in recognition of her persistent efforts as co-coordinator of ACG research; intense education efforts to adults, teenagers, and schoolchildren about ACG biology both terrestrial and marine; maintenance and data management of ACG weather data; ACG biopolitics; and rescue of key ACG animals.

Figure 58. 

Bracon mariamartachavarriae, holotype.

Bracon mariorivasi Sharkey, sp. nov.

Figure 59

Diagnostics

BOLD:ADA3193. Consensus barcode. GTATTATATTTTTTATTTGGTATATGATCTGGCATTTTAGGTTTATCAATAAGTTTAATAATTCGATTGGAATTGGGGACGCCAGGTAGATTGTTAGGTAATGATCAAATTTATAATAGAATGGTGACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCAGTTATAGTTGGAGGTTTTGGAAATTGATTATTACCTTTAATATTAGGATCTCCAGATATAGCATTTCCTCGATTAAATAATATAAGGTTTTGACTAATTATTCCTTCTTTAATTCTTTTATTAATAAGAAGGATTTTAAATGTAGGAGTTGGTACGGGATGAACAGTTTATCCTCCTTTATCTTCTTCTTTAGGTCATAGAGGTTTATCTATAGATTTAGCTATTTTTTCTCTTCATATAGCAGGAATTTCTTCAATTTTAGGTGCTATTAATTTTATTTCTACAATTTTTAATATACATTTATATAATTTAAAATTAGATCAATTAGTTTTATTAATTTGGTCTATTTTTATTACTGCTGTTTTATTATTGTTGTCATTACCTGTTTTGGCAGGGGCTATTACAATACTTTTAACAGAT------------------------------------------.

Holotype ♂

Guanacaste, Sector San Cristobal, Estación San Gerardo, 10.8801, -85.389, 575 meters, Malaise trap, 17/ii/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28290-E07.

Paratypes

None.

Etymology

Bracon mariorivasi is named to honor Mario Rivas for his support in ACG being able to purchase forested properties in the formation of ACG, and for the idea of Malaise trapping his pitaya plantations on behalf of BioAlfa.

Figure 59. 

Bracon mariorivasi, holotype.

Bracon melissaespinozae Sharkey, sp. nov.

Figure 60

Diagnostics

BOLD:ACJ4722. Consensus barcode. AATTTTATATTTTTTATTTGGGATATGGTCTGGAATAATTGGTTTATCTATAAGTTTAATTATTCGATTAGAATTGAGAATACCTGGTAGATTATTAGGTAATGATCAAATTTATAATAGTATAGTAACAGCTCATGCTTTAATAATAATTTTTTTTATAGTTATACCAATTATATTAGGAGGTTTTGGGAATTGATTAATTCCTTTAATGTTAGGAGCTCCTGATATAGCTTTCCCACGTTTAAATAATATAAGTTTTTGGTTATTAATCCCCTCTTTAATTTTATTATTATTAAGAAGAATTTTAAATGTAGGGGTAGGAACAGGTTGAACTATATATCCACCTTTATCATCAAATATAGGACATAGAGGTTTATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCTTCAATTATAGGATCAATTAATTTTATTTCAACTATTTTAAATATACATTTAAAAATATTAAAATTAGATCAATTAACATTATTAATTTGATCAATTTTTATTACAACTATTTTATTATTGTTATCATTACCTGTTTTAGCGGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACTTCTTTTTTTGATTTTTCAGGAGGAGGTGATCCAATTTTATTTCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Santa Maria, Light Site Trail, Volcán Santa Maria, 10.75772, -85.30598, 840 meters, caterpillar collection date: 29/viii/2012, wasp eclosion date: 10/ix/2012, 16 wasps eclosed. Depository: CNC.

Host data. Gregarious parasitoid of unknown caterpillar in leaf nest on Smilax spinosa (Smilacaeae).

Caterpillar and holotype voucher codes. 12-SRNP-13169, DHJPAR0051204.

Paratypes

15 specimens, same data as holotype, still labelled with 12-SRNP-13169. Depository: CNC.

Etymology

Bracon melissaespinozae is named in honor of Melissa Espinoza’s proactive and growing abilities as a science reporter for all things ACG for the ACG web site (www.acguanacaste.ac.cr).

Figure 60. 

Bracon melissaespinozae, holotype.

Bracon nelsonzamorai Sharkey, sp. nov.

Figure 61

Diagnostics

BOLD:ADB4596. Consensus barcode. ATTTTATATTTTTTATTTGGGATATGAGCTGGGATAATTGGTTTATCAATAAGTTTAATTATTCGATTAGAATTAGGGATACCTGGAAGTTTATTAGGTAATGACCAAATTTATAATAGTATAGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATATTAGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGTTTAAATAATATAAGATTTTGATTATTAATCCCTTCTTTAATTTTATTAATTTTGAGAAGAATTTTAAATATTGGGGTAGGCACAGGCTGAACTATATACCCCCCTTTATCGTCTAGATTAGGTCATAGAGGAGTATCTGTTGATTTAGCAATTTTTTCATTACATTTAGCAGGAATCTCTTCTATTATAGGAGCAATAAATTTTATTACCACTATTTTAAATATACATTTATTAATATTAAAATTAGACCAATTAACCTTATTAATCTGATCAATTTTTATTACAACTATTTTATTATTACTATCTTTACCAGTATTAGCTGGAGCTATCACTATACTATTAACAGATCGAAACCTAAAC---------------------------------.

Holotype ♂

Guanacaste, Sector Cacao, Derrumbe, 10.9292, -85.4643, 1220 meters, Malaise trap, 22/v/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG29002-G10.

Paratypes

None.

Etymology

Bracon nelsonzamorai is named to honor Nelson Zamora for his many years of dedicated curatorial and taxonomic efforts for the growth of the former INBio plant collection, now in the Museo Nacional de Costa Rica, and his furthering the BioAlfa program to DNA barcode all of Costa Rican eukaryote biodiversity, with an emphasis on all of Costa Rica’s plant species.

Figure 61. 

Bracon nelsonzamorai, holotype.

Bracon nicklaphami Sharkey, sp. nov.

Figure 62

Diagnostics

BOLD:ACP6341. Consensus barcode. AATTTTATATTTTTTATTTGGTATATGATCTGGTATAATTGGTTTATCAATAAGATTAATTATTCGTTTAGAATTAGGTATACCTGGAAGATTATTAAGAAATGATCAAATTTATAATAGAATAGTCACAGCCCATGCTTTAGTAATGATTTTTTTTATAGTTATACCAATTATATTAGGAGGTTTTGGAAATTGGTTAATTCCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCTTTAATTTTGTTATTATTAAGAAGAATTTTAAATGTAGGTGTAGGAACAGGATGGACATTATATCCTCCTTTATCTTCAAATTTAGGTCATAGAGGTTTATCTGTGGATTTATCTATTTTTTCTATTCATTTAGCTGGAATTTCATCAATTATAGGTTCATTAAATTTTATTACTACAATTTTAAATATACATTTATTAATATTAAAATTAGATCAATTAACTTTATTAATTTGATCAATTTTTATTACAACTATTTTATTATTATTATCTTTACCTGTTTTGGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTTCATTTTTTGATTTTTCAGGAGGTGGGGATCCAATTTTATTTCAACATTTATTT.

Holotype ♀

Alajuela, Sector Rincon Rain Forest, Palomo, 10.96187, -85.28045, 96 meters, caterpillar collection date: 24/iv/2014, wasp eclosion date: 4/v/2014. Depository: CNC.

Host data. Damas immacula (Hesperiidae) feeding on Geonoma congesta (Arecaceae).

Holotype voucher code. DHJPAR0055350.

Paratypes

None.

Etymology

Bracon nicklaphami is named in honor of Nick Lapham’s long-appreciated contributions to publicity for ACG and GDFCF, and now BioAlfa.

Figure 62. 

Bracon nicklaphami, holotype.

Bracon ninamasisae Sharkey, sp. nov.

Figure 63

Diagnostics

BOLD:ADA4862. Consensus barcode. ATTTTATATTTTTTATTTGGAATATGATCAGGAATAATTGGTCTATCAATAAGATTAATTATTCGGTTAGAATTAAGAATACCTGGTAGATTATTAGGTAATGACCAAATTTATAATAGTATAGTAACAGCTCATGCTTTAATAATAATTTTTTTTATAGTTATACCAATTATATTAGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTTTAAATAATATAAGTTTTTGACTATTAATTCCTTCTTTAATTTTATTATTATTAAGAAGAATTTTGAATATAGGAGTAGGTACAGGTTGAACTTTATACCCACCTTTATCTTTAAGAATTGGTCATAGAGGTTTATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCTTCAATTATAGGATCAATTAATTTTATTTCAACTATTTTAAATATACATTTAAAATCATTAAAATTAGATCAATTAACATTATTAATTTGATCAATTTTTATTACAACTATTTTATTATTATTATCATTACCTGTTTTAGCAGGAGCAATTACTATA---------------------------------------------------------.

Holotype ♀

Guanacaste, Sector San Cristobal, Estación San Gerardo, 10.8801, -85.389, 575 meters, Malaise trap, 9/xii/2013. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28011-B01.

Paratypes

None.

Etymology

Bracon ninamasisae is named to honor Nina Masis for her cheerful participation in the lives and dedication of the Masis + Boshart family as it carried out its vital role in the growth and management of the Guanacaste Dry Forest Conservation Fund and Área de Conservación Guanacaste.

Figure 63. 

Bracon ninamasisae, holotype.

Bracon oliverwalshi Sharkey, sp. nov.

Figure 64

Diagnostics

BOLD:ABV9910. Consensus barcode. AATTCTTTATTTTTTATTTGGTATATGAGCAGGAATATTAGGTTTATCAATAAGATTAATTATTCGTTTAGAACTAGGAATACCAGGTAGATTATTAGGGAATGACCAAATTTATAATAGAATAGTTACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCAGTAATAGTTGGAGGGTTTGGGAATTGATTATTACCTTTAATATTAAGGGCCCCTGATATAGCTTTCCCACGTTTAAATAATATAAGATTTTGGTTATTAATTCCTTCTTTATTTTTATTATTAATAAGAAGAGTATTAAATGTAGGTGTTGGTACTGGATGAACAATATATCCTCCTTTGTCTTCTTCTTTAGGTCATAGGGGTATATCAGTTGATTTAGCTATTTTTTCTTTACATATTGCGGGTATTTCATCAATTTTAGGGGCTATAAATTTTATTTCAACTATTTTTAATATACATTTATTAACTTTAAAATTAGATCAATTAACTTTATTTATTTGATCAATTTTTATTACAACTTTGTTATTATTATTATCTTTACCAGTATTAGCTGGGGCTATTACCATATTATTAACTGATCGAAATTTAAATACTTCTTTTTTTGATTTTTCTGGTGGAGGTGACCCAATTTTATTTCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Cacao, Sendero Cima, 10.933, -85.457, 1460 meters, Malaise trap, 9/iii/2009. Depository: CNC.

Host data. None.

Holotype voucher code. DHJPAR0046065.

Paratypes

None.

Etymology

Bracon oliverwalshi is named in honor of Oliver Walsh, son-in-law of Karen Sharkey.

Figure 64. 

Bracon oliverwalshi, holotype.

Bracon paulamarinae Sharkey, sp. nov.

Figure 65

Diagnostics

BOLD:ADB2848. Consensus barcode. GTTTTATATTTTTTATTTGGTATATGGGCAGGAATAGTAGGATTATCAATAAGATTAATTATTCGATTAGAATTAGGTATGCCTGGCAGATTACTGGGGAATGATCAAATTTATAATAGGATAGTAACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCAGTTATATTAGGGGGGTTTGGCAATTGATTAATTCCTTTAATATTGGGTGCTCCAGATATGGCTTTCCCTCGATTAAATAATATAAGATTTTGGTTATTAATTCCTTCTTTAATTTTATTATTATTAAGAAGAATTTTAAATGTAGGGGTAGGAACTGGTTGAACAATATACCCTCCTTTATCTTCTAATTTAGGACATAGGGGATTGTCAGTTGATTTAGCTATTTTTTCTCTACATTTAGCTGGGGCATCTTCAATTATAGGGTCTATAAATTTTATTACTACAATTTTAAATATACATTTAATAATATTAAAATTAGATCAATTAACTTTATTAATTTGGTCAATTTTTATTACTACTATTTTATTATTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACT------------------------------------------.

Holotype ♀

Guanacaste, Sector Cacao, Derrumbe, 10.9292, -85.4643, 1220 meters, Malaise trap, 9/vii/2015. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28824-F05.

Paratypes

None.

Etymology

Bracon paulamarinae is named to honor Paula Marin for her cheerful participation in the lives and nutritional health of the Marin and Romero families as they have carried out its vital role in the growth and management of the Guanacaste Dry Forest Conservation Fund and Área de Conservación Guanacaste.

Figure 65. 

Bracon paulamarinae, holotype.

Bracon rafamoralesi Sharkey, sp. nov.

Figure 66

Diagnostics

BOLD:ADB5058. Consensus barcode. ATTTTATATTTTTTATTTGGTATATGATCAGGTATAGTTGGTTTATCAATAAGGTTAATTATTCGATTAGAATTAGGTTTACCTGGGAGTTTATTAGGTAATGATCAAATTTATAATAGAATAGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTTATATTAGGGGGGTTTGGTAATTGATTAATTCCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGTTTAAATAATATAAGATTTTGGTTATTATTTCCTTCTTTAATTTTATTATTATTGAGAAGAATTTTAAATGTTGGTGTAGGCACTGGTTGAACAATATATCCTCCTTTATCATCTAGGTTAGGTCATAGAGGTTTATCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGGGTTTCTTCTATTTTAGGTTCAATAAATTTTATTACAACAATTTTAAACATGCATTTATTAATATTAAAGTTAGATCAATTGACTTTATTAATTTGGTCAATTTTTATTACAACTATTTTATTATTATTGTCTTTACCTGTTTTGGCTGGTGCTATTACTATATTATTAACAGAT------------------------------------------------.

Holotype ♂

Guanacaste, Sector Pailas Dos, PL12-3, 10.7631, -85.3344, 820 meters, Malaise trap, 19/xii/2013. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG29288-B07.

Paratypes

None.

Etymology

Bracon rafamoralesi is named to honor Rafa Morales, an essential member of the fauna of Sector Orosi of ACG, for his dedication to exploration and management for conservation of ACG Sector Orosi and Estación Biologica Maritza within it.

Figure 66. 

Bracn rafamoralesi, holotype.

Bracon robertofernandezi Sharkey, sp. nov.

Figure 67

Diagnostics

BOLD:ADC8245. Consensus barcode. GTTTTATATTTTTTATTTGGGATATGAGCTGGCATGCTGGGGTTATCAATAAGATTGATTATTCGATTAGAATTAGGCATACCAGGAAGAATATTAGGTAATGATCAAATTTATAATAGTATAGTTACTGCGCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGTGGGTTTGGAAATTGATTACTACCATTAATATTAGGGGCCCCAGATATGGCATTTCCTCGATTAAATAATATAAGATTTTGATTAATTATTCCTGCTTTAATTATATTATTAATAAGTAGAATTTTAAATGTTGGTGTAGGAACTGGTTGAACTGTTTATCCTCCTTTATCTTCTTCATTGGGGCATAGGGGGATATCTGTTGATTTAGCTATTTTTTCATTACATATAGCTGGAATTTCTTCAATTTTAGGTGCAATTAATTTTATTACTACTATTTTTAATATACAACTATATATTTTAAAATTAGACCAATTAACTTTATTAATTTGATCAATTTTTATCACAGTTGTCTTGTTATTATTATCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGT------------------------.

Holotype ♀

Guanacaste, Sector Pailas Dos, PL12-2, 10.7634, -85.335, 824 meters, Malaise trap, 30/x/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG30497-D09.

Paratypes

None.

Etymology

Bracon robertofernandezi is named to honor Roberto Fernandez for his previous efforts on behalf of environmental planning for ICE, the National Electric Company, and now his work for BioAlfa the program to DNA barcode all of Costa Rican eukaryote biodiversity.

Figure 67. 

Bracon robertofernandezi, holotype.

Bracon rogerblancoi Sharkey, sp. nov.

Figures 68, 69

Diagnostics

BOLD:AAA5369. Consensus barcode. AATTTTATATTTTTTATTTGGTTTATGATCTGGTATAGTTGGATTATCTATAAGTTTAATTATTCGTTTAGAATTAGGTATACCTGGAAGATTATTAAGTAATGACCAAATTTATAATAGAATAGTTACAGCTCATGCTTTAGTAATAATTTTTTTTATAGTTATACCAATTATATTAGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCTCGATTAAATAATATAAGATTTTGATTATTAATTCCTTCTTTAATTTTATTATTATTAAGAAGAATTTTAAATGTTGGAGTAGGAACAGGTTGAACTTTATACCCTCCTTTATCTTCAAATTTAGGTCATAATGGTATATCTGTAGATTTATCTATTTTTTCTTTACATTTAGCTGGTATTTCATCAATTATAGGTTCATTAAATTTTATTACTACTATTTTAAATATACATTTATTAACATTAAAATTAGATCAATTAACTTTATTAATTTGATCAATTTTTATTACAACTATTTTATTATTATTATCTTTACCTGTTTTAGCAGGRGCTATTACTATATTATTAACTGATCGTAATTTAAATACTTCATTTTTTGATTTTTCAGGAGGTGGAGACCCAATTTTATTTCAACATTTATTT.

Holotype ♀

Alajuela, Sector Rincon Rain Forest, Palomo, 10.96187, -85.28045, 96 meters, caterpillar collection date: 05/vii/2012, wasp eclosion date: 17/vii/2012, 8 wasps eclosed. Depository: CNC.

Host data. Gregarious parasitoid of Lerema liris (Hesperiidae) feeding on leaves of Paspalum fasciculatum (Poaceae) (Fig. 69).

Caterpillar and holotype voucher codes. 12-SRNP-68015, DHJPAR0049816.

Paratypes

Hosts = Synapte salenus, Parphorus storax, Morys lydeDHJ01, Lerema liris (all Hesperiidae, Hesperiinae). 11 specimens, same data as holotype and DHJPAR0029034, DHJPAR0052239, DHJPAR0051799, DHJPAR0029037, DHJPAR0051186, DHJPAR0029035, DHJPAR0049816, DHJPAR0058162, DHJPAR0058165, DHJPAR0058166. Depository: CNC.

Etymology

Bracon rogerblancoi is named to honor Sr. Roger Blanco, former parataxonomist, and Research Program Coordinator, and now the Subdirector of ACG, in recognition of three decades of intense support and facilitation of ACG germination and growth.

Figure 68. 

Bracon rogerblancoi, holotype.

Figure 69. 

Bracon rogerblancoi (DHJPAR0029037) mass of white cocoons spun by the wasp larvae below their roof-in-common and end-to-end cocoons adjacent to the ultimate instar of a Morys lydeDHJ01 (Hesperiidae, Hesperiinae) caterpillar cadaver in its rolled grass leaf nest (06-SRNP-43580); prepupal larvae exposed by tearing away one wall of the leaf-silk caterpillar nest.

Bracon ronaldzunigai Sharkey, sp. nov.

Figure 70

Diagnostics

BOLD:ACR7910. Consensus barcode. GTATTATATTTTTTATTTGGAATATGGGCAGGTATATTAGGTTTATCAATAAGTATAATTATTCGTTTAGAATTAGGYAYAGTTGGAAGTTTATTAATAAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTGTAATAATTTTTTTTATAGTTATGCCTGTAATAGTTGGGGGTTTTGGAAATTGATTATTACCTTTAATGTTAGGATCTCCTGATATAGCTTTTCCTCGGTTAAATAATATAAGATTTTGATTACTTATTCCTTCTTTAATTATATTATTGTTTAGTAGAGTTTTAAATATTGGTGTGGGGACTGGGTGAACTATATATCCTCCTTTATCTTCTTTATTAGGTCATGGTGGATTGTCAGTAGATTTAGCTATTTTTTCTTTACATATTGCAGGAGTTTCATCAATTTTAGGGGCTATTAATTTTATTTCAACTATTTTAAATATATTTTTATATACTTTAAAATTAGATCAATTAACTTTGTTGATTTGATCAATTTTTATTACAGCTATTTTGTTATTATTATCTTTACCTGTTTTAGCAGGCGCTATTACAATACTATTAACAGATCGAAATTTAAAT.

Holotype ♀

Guanacaste, Sector San Cristobal, Estación San Gerardo, 10.8801, -85.389, 575 meters, Malaise trap, 19/v/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG25142-A09.

Paratype

BIOUG18005-A01. Depository: CNC.

Etymology

Bracon ronaldzunigai is named to honor Ronald Zuniga for his many years of dedicated curatorial and taxonomic efforts for the advancement of the former INBio arthropod collection, now in the Museo Nacional de Costa Rica, and his furthering the BioAlfa program to DNA barcode all of Costa Rican eukaryote biodiversity, with an emphasis on Hymenoptera.

Figure 70. 

Bracon ronaldzunigai, holotype.

Bracon sigifredomarini Sharkey, sp. nov.

Figure 71

Diagnostics

BOLD:ACG5126. Consensus barcode. TATTTTATATTTTTTATTTGGAATATGAGCTGGGATATTAGGTATATCTATAAGATTAATTATTCGTTTAGAATTAGGGGTACCAGGTAGCTTATTAGGAAATGATCAAATTTATAATAGGATAGTTACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTATTACCTTTAATATTAGGGGCTCCTGATATAGCATTCCCTCGTTTAAATAATATAAGGTTTTGATTGATTATTCCTTCTTTAATTTTATTATTAATAAGAAGAATTTTAAATGTAGGAGTTGGTACTGGTTGAACAGTTTACCCTCCTTTATCTTCATCTTTAGGACATAGAGGGCTATCTGTAGATTTAGCAATTTTTTCTTTACATATAGCTGGTATTTCATCTATTTTAGGTGCAATTAATTTTATTACAACTATTTTAAATATACATTTATTTATTTTGAAATTAGATCAATTAACTTTATTAATTTGATCAATTTTTATTACAGTTATTTTATTATTATTATCTTTACCAGTTTTAGCTGGGGCAATTACTATATTATTAACTGACCGAAATTTAAATACATCTTTTTTTGATTTTTCTGGAGGAGGGGATCCAATTTTATTCCAACATTTATTT.

Holotype ♂

Guanacaste, Sector Santa Rosa, Bosque San Emilio, 10.8438, -85.6138, 300 meters, Malaise trap, 30/vii/2012. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG05422-G01.

Paratypes

None.

Etymology

Bracon sigifredomarini is named to honor Sigifredo Marin for his decades of managerial soul and energy and effort on behalf of Parque Nacional Santa Rosa, Área de Conservación Guanacaste, and then the Guanacaste Dry Forest Conservation Fund projects in and around ACG.

Figure 71. 

Bracon sigifredomarini, holotype.

Bracon tihisiaboshartae Sharkey, sp. nov.

Figures 72, 73

Diagnostics

BOLD:AAA5367. Consensus barcode. TGTATTATATTTTTTATTTGGAATATGAGCYGGAATAATTGGTTTATCAATAAGTTTAATTATTCGTTTAGAATTAGGRATACCAGGTAGTTTAYTAGGTAATGATCAAATTTATAATAGTATAGTTACAGCKCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATATTAGGAGGWTTTGGTAATTGATTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTYCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTAATTTTATTATTATTAAGAAGAATTTTAAATGTTGGTGTAGGRACAGGCTGAACTATTTATCCTCCTTTATCTTCTATAATAGGTCATAGAGGWATATCTGTRGATTTATCTATTTTYTCTTTACATTTAGCTGGTATTTCTTCTATTATAGGATCGATTAATTTTATTACAACAATTTTAAATATACATTTATTAATATTAAAATTAGATCAATTAACTTTATTTATTTGATCAATTTTTATTACAACTATTTTATTATTATTATCTTTACCTGTATTAGCAGGAGCTATTACTATAYTATTAACTGATCGAAATTTWAATACTTCATTTTTTGATTTTTCTGGAGGTGGGGATCCAATTYTATTTCAACATTTATTT. Bracon tihisiaboshartae and B. alejandromasisi occupy the same BIN. Bracon tihisiaboshartae can be differentiated from B. alejandromasisi by the color of the metasomal terga: entirely yellow in B. tihisiaboshartae and partly black in B. alejandromasisi. The two can also be differentiated based on their host caterpillars and style of cocoons, see note below.

Holotype ♀

Guanacaste, Sector Mundo Nuevo, Quebrada Tibio Perla, 10.76261, -85.42979, 330 meters, caterpillar collection date: 17/xi/2013, wasp eclosion date: 1/xii/2013, 26 wasps eclosed. Depository: CNC.

Host data. Gregarious parasitoid of Memphis boisduvali (Nymphalidae) feeding on Mespilodaphne veraguensis (Lauraceae) (Fig. 72)

Caterpillar and holotype voucher codes. 13-SRNP-57185, DHJPAR0054608.

Paratype

Host = Memphis pithyusa: DHJPAR0040072. Depository: CNC.

Note

Bracon alejandromasisi and Bracon tihisiaboshartae are placed in the same BIN, but their COI barcodes differ by ca. 1%, and each is reared from different genera of caterpillars (Consul, Memphis) feeding on very different plants (Piper, Croton). The cocoons of the former are dark brown and tightly fill the caterpillar nest (Fig. 32), whereas the cocoons of the later are white-golden and form an irregular mass in a much looser leaf roll nest of the host caterpillar, not filling it (Fig. 73). Experience has shown that with this level of difference within ACG ecosystems and hosts, larger sample sizes demonstrate that this species-level taxonomic hypothesis is almost certainly correct.

Etymology

Bracon tihisiaboshartae is name in honor of Tihisia Boshart in specific recognition of her rapid and high-quality rendering of artwork for Hymenoptera and Lepidoptera patronyms for major Costa Rican decision-makers helping ACG.

Figure 72. 

Bracon tihisiaboshartae, holotype.

Figure 73. 

Bracon tihisiaboshartae (09-SRNP-56390-DHJ474143.jpg) white-golden cocoons piled together in two masses on the leaf, rather than filling the nest cavity as the case with Bracon alejandromasisi; wasp exit hole is in the mass on the left.

Bracon wilberthbrizuelai Sharkey, sp. nov.

Figure 74

Diagnostics

BOLD:ADB1539. Consensus barcode. ATTTTATACTTCTTATTCGGAATATGAGCTGGAATAATTGGTTTATCTATAAGATTAATTATTCGGTTAGAATTAGGTATACCTGGGAGATTATTAAAAAATGACCAAATTTATAATAGAATAGTCACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATATTAGGAGGGTTTGGAAATTGATTAACCCCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCTCGATTAAATAATATAAGATTTTGATTATTAATTCCTTCTTTAATTTTATTATTATTAAGAAGAATTTTAAATGTTGGGGTAGGAACAGGTTGAACTATATACCCCCCATTATCATCAAATTTAGGACACAGAGGTTTATCAGTTGATTTAGCTATTTTTTCCTTACATTTAGCAGGAATTTCTTCTATTATAGGGGCAATAAATTTTATTTCTACTATTTTAAATATACATTTATTTACATTAAAAATAGATCAATTAACTTTATTTGTTTGATCTATTTTTATCACAACTATTTTATTACTATTATCTTTACCAGTTTTAGCTGGTGCTATCACTATATTATTAACAGAT------------------------------------------------.

Holotype ♀

Guanacaste, Sector Pailas Dos, PL12-2, 10.7634, -85.335, 824 meters, Malaise trap, 2/i/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG29474-A02.

Paratypes

None.

Etymology

Bracon wilberthbrizuelai is named to honor Wilberth Brizuela for his cheerful and always-ready restaurant at Nuevo Zelandia, that has supported many ACG staff and visitors.

Figure 74. 

Bracon wilberthbrizuelai, holotype.

Digonogastra Viereck, 1912

Digonogastra is a large and species rich genus restricted to the New World. Members attack larval Lepidoptera and Coleoptera. The generic assignment of many species of Digonogastra from Cyanopterous is difficult or impossible because the precise limits of the two are not well defined at present.

Digonogastra montylloydi Sharkey, sp. nov.

Figure 75

Diagnostics

BOLD:ADD0356. Consensus barcode. ATTTTATATTTTTTATTTGGGATGTGATCTGGAATAGTAGGGTTATCAATAAGTTTAATTATTCGATTAGAATTAGGAGTTCCTGGAAGGTTATTAGGTAATGATCAAATTTATAATAGAATAGTTACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCAATTATATTAGGTGGATTTGGAAATTGGTTAATTCCTTTAATATTAGGTGCTCCTGACATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTATTAATATTATTGTTGAGAGGAATTTTAAATGTGGGTGTAGGTACTGGATGAACAATTTATCCTCCATTATCTTCATTTTTGGGACATGGAGGGATTTCTGTTGATTTAGCTATTTTTTCTTTACATTTGGCTGGTGTTTCTTCAATTATAGGATCAATTAATTTTATTACAACAATTTTAAATATACGATTATTTTTTTTGAAATTAGATCAATTAACTTTATTTATTTGATCAATTTTTATTACTACAATTTTATTATTATTATCTTTACCAGTTTTAGCTGGGGGAATTACTATATTATTAACAGATCGTAATTTAAATACAACTTTTTTTGATTTTTCTGGTGGAGGAGATCCAATTTTATTTCAACATTTA.

Holotype ♀

Guanacaste, Sector Pitilla, Estación Quica, 10.99697, -85.39666, 470 meters, caterpillar collection date 28/iv/2008, wasp eclosion date: 30/iv/2008. Depository: CNC.

Host data. Oiketicus kirbyi (Psychidae) feeding on Byrsonima crassifolia (Malpighiaceae). The gregarious wasp larvae spin their cocoons inside the bagworm silk and twig nest; the paratypes are sibs of the holotype.

Caterpillar and holotype voucher codes. 08-SRNP-70260, DHJPAR0028324.

Paratypes

Host = same as holotype: DHJPAR0028320, DHJPAR0028321, DHJPAR0028322, DHJPAR0028323. Depository: CNC.

Etymology

Digonogastra montylloydi is named in honor of Monty Lloyd’s long-appreciated contributions to publicity for ACG, GDFCF, and now, BioAlfa.

Figure 75. 

Digonogastra montylloydi, holotype.

Digonogastra montywoodi Sharkey, sp. nov.

Figure 76

Diagnostics

BOLD:ADJ0327. Consensus barcode. TATATTATATTTTTTATTTGGTATATGAGCTGGAATAATTGGTTTGTCTATAAGATTAATTATTCGTTTAGAGTTAGGTATACCGGGTAGAATATTAAATAATGATCAAATTTATAATAGAATAGTTACTGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATAATAGTAGGTGGATTTGGGAATTGATTAACACCTTTAATATTAGGGGCTCCTGATATGGCTTTCCCACGAATAAATAATATAAGATTTTGGTTATTGGTTCCTTCAATTTTATTATTAATATTAAGAAGAATTATAAATATTGGAGTAGGTACTGGATGAACAATATATCCTCCTTTATCTTCTTTATTAGGACATAGTGGAATTTCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCGGGGGTTTCTTCAATTATAGGTTCAATTAATTTTATTTCAACAATTTTAAATATACGTTTATTTTATTTAAAATTAGATCAATTAACTTTATTTATTTGATCAATTTTTATTACAACAATTTTGTTATTATTATCTTTACCTGTTTTGGCGGGGGGTATTACTATGTTATTAACTGATCGTAATTTAAATTCTACATTTTTTGATTTTTCTGGAGGAGGAGATCCAATTTTATTTCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Pailas, Catarata Borinquen, 10.817721, -85.390465, 945 meters, 29/i/2017, light-trapped. Depository: CNC.

Host data. None.

Holotype voucher code. DHJPAR0061034.

Paratypes

None.

Other material

A specimen from Panama is in the same BIN and is likely conspecific.

Etymology

Digonogastra montywoodi is named in honor of Monty Wood’s (RIP) long-appreciated contributions to publicity for ACG, GDFCF, and now, BioAlfa.

Figure 76. 

Digonogastra montywoodi, holotype.

Digonogastra motohasegawai Sharkey, sp. nov.

Figure 77

Diagnostics

BOLD:ADJ4657. Consensus barcode. GATATTGTATTTTTTATTTGGTATATGGGCTGGGATAGTTGGTTTATCAATAAGATTAATTATTCGTTTAGAGTTGGGGATACCTGGAAGGATGTTAGGTAATGATCAAATTTATAATAGAATAGTGACGGCACATGCTTTTGTAATAATTTTTTTTATAGTTATACCAGTAATATTGGGGGGGTTTGGAAATTGGTTAATTCCATTAATGTTAGGGGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGGTTTTGATTACTTATTCCTTCAATTTTATTATTATTATTAAGAAGAATTTTAAATATTGGRGTAGGTACAGGGTGAACTGTTTATCCTCCTTTATCTTCATCTTTAGGACATAGAGGGGTATCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTGTTTCTTCTATTATAGGGTCAATTAATTTTATTACAACAATTTTAAATATACGTTTATTTTTTTTAAAATTAGATCAATTAACTTTATTTATTTGATCAATTTTTATTACAACAATTTTATTGTTATTATCTTTACCTGTTTTGGCAGGGGGAATTACAATACTATTAACAGATCGAAATTTAAATACAACATTTTTTGATTTTTCTGGGGGAGGGGATCCTGTTTTGTTTCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Pailas, Catarata Borinquen, 10.817721, -85.390465, 945 meters, 29/i/2017, light-trapped. Depository: CNC.

Host data. None.

Holotype voucher code. DHJPAR0061037.

Paratypes

DHJPAR0061039. Depository: CNC.

Etymology

Digonogastra motohasegawai is named in honor of Moto Hasegawa’s long-appreciated contributions to publicity for ACG, GDFCF, and now, BioAlfa.

Figure 77. 

Digonogastra motohasegawai, holotype.

Digonogastra natwheelwrighti Sharkey, sp. nov.

Figure 78

Diagnostics

BOLD:ADM7321. Consensus barcode. AATATTGTATTTTTTATTTGGTATGTGAGCTGGTATAGTTGGATTATCAATAAGGTTGATTATTCGTTTAGAATTAGGTATACCAGGGAGTTTATTAGGTAATGATCAGATTTATAATAGTATAGTAACTGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATATTAGGGGGATTTGGGAATTGATTAATTCCTTTAATATTGGGGGCCCCAGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTACTTATTCCTTCTATTTTGTTGTTATTATTAAGGAGATTTATAAATATTGGGGTTGGTACAGGATGGACAGTTTATCCTCCTTTATCTTCTTCTTTGGGGCATAGGGGTATTTCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCTTCAATTATGGGGTCAATTAATTTTATTTCTACTATTTTAAATATACATTTATTTTTTTTAAAATTAGATCAGTTAACTTTGTTTATTTGATCAATTTTTATTACAACAATTTTATTGTTATTATCTTTACCTGTTTTAGCTGGGGGTATTACTATATTATTAACGGATCGTAATTTAAATACAACTTTTTTTGATTTTTCGGGGGGGGGAGATCCTATTTTATTTCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Pailas, PDL#5, 10.7627, -85.334, 825 meters, 4/i/2014, light-trapped. Depository: CNC.

Host data. None.

Holotype voucher code. DHJPAR0062413.

Paratypes

None.

Etymology

Digonogastra natwheelwrighti is named in honor of Nat Wheelwright’s long-appreciated contributions to publicity for ACG, GDFCF, and now, BioAlfa.

Figure 78. 

Digonogastra natwheelwrighti, holotype.

Digonogastra nickgrishini Sharkey, sp. nov.

Figure 79

Diagnostics

BOLD:ADJ3490. Consensus barcode. GGTATTATATTTTTTATTTGGGATGTGATCAGGAATATTAGGTTTATCAATAAGAATAATTATTCGTTTAGAATTAGGGATACCAGGAAGAATATTAGGTAATGATCAAATTTATAATAGAATAGTTACTATTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATATTAGGTGGATTTGGTAATTGATTAATTCCATTAATATTAGGGGCACCTGATATGGCTTTCCCTCGAATAAATAATATAAGATTTTGATTAATTATTCCTTCTTTAATGTTATTATTATTAAGAAGGGTAATAAATGTTGGAGTAGGAACTGGTTGAACTATATATCCTCCTTTATCATCATTTTTAGGTCATGGAGGAATATCAGTTGATTTATCAATTTTTTCTTTACATTTGGCTGGAATTTCTTCAATTATGGGTGCAATTAATTTTATTACAACTATTTTAAATATACGTTTATTTTTTTTAAAGTTAGATCAGTTAACTTTATTTATTTGATCAATTTTTATTACTACAATTTTATTATTATTATCATTACCAGTTTTAGCTGGTGGAATTACAATATTATTAACTGATCGTAATTTAAATACTACATTTTTTGATTTTTCTGGAGGGGGGGATCCAATTTTATTTCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Pailas, Catarata Borinquen, 10.817721, -85.390465, 945 meters, 29/i/2017, light-trapped. Depository: CNC.

Host data. None.

Holotype voucher code. DHJPAR0061042.

Paratypes

None.

Etymology

Digonogastra nickgrishini is named in honor of Nick Grishin’s long-appreciated contributions to publicity for ACG, GDFCF, and BioAlfa.

Figure 79. 

Digonogastra natwheelwrighti, holotype.

Chapter 4: Cheloninae

Cheloninae have been viewed as solitary, koinobiont, egg-larval parasitoids, i.e., lay one egg in the egg of the host and delaying development until the host caterpillar is nearing maturity (van Achterberg 1990b; Shaw and Huddleston 1991; Shaw 1997; Hanson and Gauld 2006). Contrary to this generalization, of the 60 species reared by the inventory, Chelonus motohasegawai [2 records] (Fig. 81), Chelonus michellevanderbankae [13 records] (Figs 82, 83), and Chelonus nataliaivanovae [3 records] (Fig. 84) are gregarious. It is not known if these species are injecting multiple eggs into an egg of the host, or if the wasp eggs are polyembryonic. The question is complicated because oviposition behavior of Cheloninae is based on few records (Shaw and Huddleston 1991). It is not even known if all chelonines are egg-larval parasitoids. For example, there are no rearing records for Adeliini and most of the less common chelonine genera such as Pseudophanerotoma and Ascogaster.

Quicke et al. (2012) noted that when gene trees of the barcode region of COI are the product of species-rich samples, they are impressionably accurate in recapitulating the assumed phylogeny. Four of the six included genera are effectively monophyletic in the COI neighbor-joining tree (Suppl. material 3), and we obtained the same result with a multilocus tree that included extensive outgroups (not illustrated). Only two species cause the lack of monophyly for Pseudophanerotoma: Pseudophanerotoma allisonbrownae and Pseudophanerotoma bobrobbinsi. These are both nested within Phanerotoma in the tree (Suppl. material 3). P. bobrobbinsi is well nested within Phanerotoma even though it has all of the other characteristics of Pseudophanerotoma, other than being somewhat unusual in its dark coloration (Fig. 205). Pseudophanerotoma allisonbrownae is placed as the sister to all Phanerotoma and its generic affiliation is somewhat questionable. Unlike all other members of Pseudophanerotoma, the second submarginal cell of the forewing does not intersect vein 1RS+M. Instead, it meets the junction of 1RS+M and crossvein cu-a. Furthermore, the origin of 1RS+M is close to vein M rather than high in the parastigma. However, unlike all members of Phanerotoma, Pseudophanerotoma allisonbrownae has more than 21 flagellomeres. We prefer to rely on this single character due to its clear definition and lack of intermediates. With these comments in mind, the New World genera may be identified using the key below.

All reared Cheloninae reported here are parasitoids of wild-caught leaf rolling and webbing “Microlepidoptera” caterpillars and none from “macrocaterpillars” even though there are 550+ species of leaf-sheltering or leaf-nest Hesperiidae caterpillars in the rearing inventory (Janzen et al. 2011). The 66 reared species are derived from a sample of ca. 1,170 caterpillars among 719,000 “wild-caught then lab-reared” caterpillars of ca. 5,000 species over 40 years (1978‒2018 inclusive) in all ACG ecosystems and habitats. However, if we restrict the summaries to the leaf-rolling and webbing “small” caterpillars in the ACG inventory (Crambidae, Gelechiidae, Depressariidae, Thyrididae, Oecophoridae, Tortricidae, Choreutidae, Immidae, Gracillariidae), the available sample is ca. 107,000 caterpillars of ca. 2,700 species. Because chelonine parasitization is both obvious and restricted, we can offer these generalizations, but further inventory is required to offer this for other subfamilies

Dan Boyce (1936) observed that a species of Ascogaster pupated within the pupal chamber of the host, and that has become the universal truth applied to all chelonines (Hanson and Gauld 2006). The ACG rearing experience has confirmed this for all species of Cheloninae reared by the inventory, though the host pupal chamber ranges from a silk cocoon on a leaf surface to between two leaf surfaces silked together by the caterpillar. It is quite commonplace for the feeding caterpillar to live between two leaves lightly silked together, which then become the roof and floor of the chamber into which the wasp larva spins its cocoon after emerging from the prepupal caterpillar (or an earlier stage, whichever the case may be).

In some cases where there are many records for a single species of reared Cheloninae, this is because the host caterpillars are often gregarious and live in a sloppy mass of silked-together leaves. Presumably, the female moth lays a large mass of 50‒200 eggs, and when a female chelonine wasp finds it, it has the opportunity to oviposit into many eggs. The consequence is that the eclosing wasps will be sibs (e.g., Pseudophanerotoma alexsmithi, Chelonus sujeevanratnasinghami, Chelonus scottshawi, Chelonus gustavogutierrezi).

The ACG rearing inventory has found that an identification trait of most chelonine cocoons is that they are squared at both apices, as shown in Fig. 80. This is diagnostic for most reared ACG members of the subfamily, with the occasional exception such as Chelonus michellevanderbankae (Fig. 83).

All Adelius and most Ascogaster and Phanerotoma were captured with Malaise traps and rarely reared. In part, this is because they may be parastioids of caterpillars that are miners in leaf tissue, rather than exposed in a leaf-silk webbing. For practical reasons, leaf-mining caterpillars are rarely reared in the ACG, remaining for further development of the inventory. For the Cheloninae NJ tree, see Suppl. material 3.

Figure 80. 

Cocoon of Chelonus rodrigogamezi (DHJPAR0050074).

Figure 81. 

Cocoons of Chelonus motohasegawai in the remains of the host caterpillar pupal chamber spun between sides of a plastic rearing bag (DHJPAR0042920).

Figure 82. 

Multiple white larvae of Chelonus michellevanderbankae (DHJPAR0029134) inside its translucent host caterpillar (05-SRNP-30968).

Figure 83. 

Cocoons of Chelonus michellevanderbankae, (DHJPAR0039447); all larvae emerged from a single caterpillar (see Fig. 82).

Figure 84. 

Prepupae of Chelonus nataliaivanovae (DHJPAR0035559) inside the pupal chamber of a single caterpillar of its host (Anacrusis turrialbae 09-SRNP-44104) after the leaf ceiling was lifted off. The head and thorax capsule of the caterpillar are inside the ring of prepupae in the cocoons that they have spun; a yellow meconial pellet is at the posterior end of each cocoon.

Key to New World genera of Cheloninae

1 A. RS of forewing not reaching wing margin; small specimens usually under 2 mm 2
B. RS of forewing reaching wing margin; specimens usually longer than 2 mm 3
2 (1) A. First two metasomal terga sculptured; Nearctic Paradelius
B. First two metasomal terga not or only weakly sculptured; widespread Adelius
3(1) A. Metasomal carapace with two traverse depressions on 4
B. Metasomal carapace without two traverse depressions 10
4(3) A. Forewing crossvein cu-a and vein M meeting or almost so; occipital carina incomplete dorsally; Chile, rare. Leptochelonus
B. Forewing crossvein cu-a originating far distal to M; occipital carina complete dorsally; widespread, common. 5
5(4) A. Antenna with 23 antennal articles, including scape (S) and pedicel (P). AA. 1RS+M vein well distant from vein M and intersecting parastigma (PS) 6
B. Antenna with more than 23 antennal articles including scape (S) and pedicel (P). BB. 1RS+M vein intersecting vein M or parastigma (PS) very close to vein M 8
6(5) A. Clypeus without teeth or rounded protuberances; Neotropical, rare Phanerotomoides
B. Clypeus with two or more teeth or rounded protuberances; widespread, common 7
7(6) A. Metasomal carapace decurved apically and covering all segments; widespread, common. Phanerotoma
B. Metasomal carapace relatively flat apically and not covering all segments; Neotropical, rare Huseyinia
8(5) A. Clypeus ca. as long as wide and without teeth or rounded protuberances; Neotropical, rare. Furcidentia
B. Clypeus distinctly wider than long and with teeth or rounded protuberances (the latter sometimes very weak) 9
9(8) A. Latero-posterior margin of carapace with two large teeth; Neotropical; rare Dentigaster
B. Latero-posterior margin of carapace without pair of large teeth; widespread; relatively common Pseudophanerotoma
10(3) A. Forewing 1-SR+M absent Chelonus
B. Forewing 1-SR+M present 11
11(10) A. Ocelli forming an isosceles triangle Ascogaster
B. Ocelli forming an equilateral triangle Leptodrepana

Adelius Haliday, 1833

Adelius is worldwide in distribution. Hosts are leaf-mining Lepidoptera, e.g., Nepticulidae. Shimbori et al. (2019) revised the New World species of Adelius and included 19 species, seven of which are from Costa Rica.

Adelius adrianguadamuzi Sharkey, sp. nov.

Figure 85

Diagnostics

BOLD:ADF7277. Consensus barcode. ATTTTATATTTTATATTTGGTATTTGATCAGGTGGTTTAGGTTTATCACTAAGAATAATAATTCGTATAGAATTAAGAACAGTAGGAAGTTATTTGGGTAATGATCAAATTTATAATAGAATTGTAACTCTTCATGCTTTTGTGATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGGTTAATTCCATTAATAGTAATAAGACCTGATATATCATTTCCTCGAATAAATAATATGAGATTTTGATTATTAATTCCTTCTTTATTTTTATTGATTATGAGAAGATTTGTAAATGTTGGTGTAGGTACAGGATGAACAGTTTATCCTCCTTTATCTTTAATTATAGGTCATGGTGGTGTAGCTGTAGATTTATCAATTTTTTCTTTACACTTAGCTGGGATTTCATCAATTATGGGTGCTATAAATTTTATTGTTACAATTTTTAATAGATCAATATTAATAAATATATTTAATAAAATTTCTTTATTTTGTTGATCTGTTTTTATTACAGCTTTTTTATTGCTATTATCTTTACCAGTATTAGCTGGGGCTATTACTATATTATTAACTGAT----------------------------. Similar to A. excelsus Bortoni and Shimbori, but differs slightly in color, and the hind tibia is much more swollen in A. adrianguadamuzi.

Holotype ♀

Guanacaste, Sector Cacao, Derrumbe, 10.9292, -85.4643, 1220 meters, 18‒25/x/2014, Malaise trap. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG31661-B07..

Paratypes

None.

Note

The holotype and all but one paratype of A. excelsus are from high elevation localities in Colombia. The paratype of A. excelsus from Costa Rica is likely to be a member of A. adrianguadamuzi in the opinion of MJS.

Etymology

Adelius adrianguadamuzi is named to honor Sr. Adrian Guadamuz of GDFCF and ACG for his many years as a dedicated plant parataxonomist, and Malaise and mouse live trapper for ACG.

Figure 85. 

Adelius adrianguadamuzi, holotype A BOLD image B mounted image.

Adelius gauldi Shimbori & Shaw, 2019

Diagnostics

BOLD:ACJ2315. Image available on BOLD.

Host data. None.

Material examined

♀, Guanacaste, Sector Santa Rosa, Bosque San Emilio, 10.8438, -85.6138, 300 meters, 16‒23/iv/2012, Malaise trap. BIOUG07619-D09, BIOUG18398-G03.

Adelius janzeni Shimbori & Shaw, 2019

Diagnostics

BOLD:ACJ2270. Image available on BOLD.

Host data. None, Malaise trap.

Material examined

♀, Guanacaste, Sector Santa Rosa, Bosque San Emilio, 10.8438, -85.6138, 300 meters, 16‒23/iv/2012, Malaise trap. BIOUG07614-F11.

Ascogaster Wesmael, 1835

No described species of Ascogaster are documented from Costa Rica, and only two species are recorded from the Neotropics, i.e., Peru and Uruguay, though there are probably a few hundred species undescribed. Numerous lepidopteran families serve as hosts. Here we add records from Tortricidae and Depressariidae, neither of which is a new family record.

Ascogaster gloriasihezarae Sharkey, sp. nov.

Figure 86

Diagnostics

BOLD:ADA4144. Consensus barcode. ATTTTATATTTTATTTTTGGAATTTGATCAGGTATATTTGGTTTATCTTTAAGTCTAATTATTCGAATAGAATTAAGGTCGGTTACAGCTTATTTAGGTAACGATCAAATTTATAACAGGTTAGTTACAATACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGTGGTCCTGATATATCATTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCACTTTTTTTATTGATTATAAGAAGTTTTGTAAATGTAGGTGTGGGTACAGGATGAACAGTTTATCCTCCTTTATCATTAATTATTGGGCATGGTGGGGTATCAGTTGATATTAGAATTTTTTCTTTACATATAGCTGGAATATCTTCTGTAATAGGTGCATTAAATTTTATTGTAACAATTATAAATATATGAATTGGAGTAAAATATATAGATAAATTGTCTTTATTCACTTGATCAGTTTTTATTACAGCTATTTTATTATTACTATCCTTGCCTGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGAAATTTTAAT---------------------------------.

Holotype ♂

Alajuela, Sector San Cristobal, Estación San Gerardo, 10.8801, -85.389, 575 meters, 16‒23/xii/2013, Malaise trap. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28068-C02.

Paratypes

None.

Etymology

Ascogaster gloriasihezarae is named to honor Sra. Gloria Sihezar of GDFCF and ACG for three decades of outstanding parataxonomist inventory of ACG biodiversity.

Figure 86. 

Ascogaster gloriasihezarae, holotype.

Ascogaster grettelvegae Sharkey, sp. nov.

Figure 87

Diagnostics

BOLD:ABX8525. Consensus barcode. TATTTGGACTATCTTTAAGTTTAATTATTCGAATAGAATTAAGTTCTATTACTTCTTATTTAGGTAATGATCAGATTTATAATAGAGTAGTTACTCTACATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGCGGTTTTGGAAATTGGTTGGTTCCTTTAATGTTAGGAGGACCAGATATATCATTTCCTCGAATAAATAATTTAAGATTTTGATTGTTAGTACCTTCAATTATTTTATTAATTAATAGAAGTTTTATTAATGTAGGGGTAGGAACAGGATGAACTGTATATCCGCCTTTATCTCTTATAATTGGCCATAGAGGAGCTTCTGTAGATTTAAGTATTTTTTCTTTGCATTTAGCTGGAATATCCTCTATTATAGGGGCTGTAAATTTTATTGTTACTATTTTAAATATAAGTTTTAGATTTAAAAATATAGATAAATTTCCTTTGTTTGTGTGATCAATTATAATTACTGCAATTTTATTACTTCTATCTTTACCTGTCTTAGCAGGTGCAATTACTATATTATTAACAGATCGAAATTTAAATACTAGATTTTTTGACCCCTCAGGGGGCGGTGATCCAATTTTATATCAACATTTATTT.

Holotype ♂

Guanacaste, Sector San Cristobal, Tajo Angeles, 10.865, -85.415, 540 meters, caterpillar collection date: 13/i/2011, wasp eclosion date: 05/ii/2011. Depository: CNC.

Host data. Episimus ortygia (Tortricidae) feeding on Vismia baccifera (Hypericaceae).

Caterpillar and holotype voucher codes. 11-SRNP-180, DHJPAR0043010.

Paratypes

None.

Etymology

Ascogaster grettelvegae is named to honor Sra. Grettel Vega of SINAC for her support of BioAlfa as Director of SINAC, Costa Rica’s National System of Conservation areas.

Figure 87. 

Ascogaster grettelvegae, holotype.

Ascogaster guillermopereirai Sharkey, sp. nov.

Figure 88

Diagnostics

BOLD:ACJ4048. Consensus barcode. AATTTTATATTTTATATTTGGAATTTGATCAGGAATAATTGGATTATCTTTAAGTTTATTAATTCGTATAGAATTAAGTTCAGTTTCTTCTTATTTAGGTAATGATCAAATTTATAATAGAATTGTAACTATACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGCTTCGGAAATTGATTAGTTCCTTTAATATTAGGGGCTCCTGATATATCTTTCCCTCGATTGAATAATTTGAGATTTTGATTATTAATTCCTTCACTTTTTTTTTTATTAATTGGTGGTATTTTGAATTCAGGAGTTGGAACTGGATGAACAGTTTATCCACCGTTGTCATTAGGTATTTATCATAGAGGTATTTCTGTAGATTTAAGTATTTTTTCTTTACATATAGCTGGAATATCTTCAATTTTAGGGGCCTTAAATTTTATTATTACTATTTATTGTATATGGTTAGGTTCAAAAAATATGGATAAGTTATCTTTATTTGTTTGATCAGTAATAATTACTGCATTTTTATTAATTACATCTTTACCAGTTCTAGCAGGCGCAATTACTATATTATTAACTGATCGTAATTTAAATACTAGATTTTTTGATCCTTCTGGTGGTGGTGATCCTGTTTTATATCAACATTTATTT.

Holotype ♂

Alajuela, Sector San Cristobal, Rio Blanco Abajo, 10.90037 -85.37254, 500 meters, caterpillar collection date: 27/ix/2012, wasp eclosion date: 15/x/2012.

Host data. Mictopsichia Janzen330 (Tortricidae) feeding on Marcgravia nepenthoides (Marcgraviaceae).

Caterpillar and holotype voucher codes. 12-SRNP-5277, DHJPAR0051332.

Paratype

Host = Mictopsichia Janzen330: DHJPAR0051327.

Etymology

Ascogaster guillermopereirai is named to honor Sr. Guillermo Pereira of GDFCF and ACG for his many decades as a dedicated inventory parataxonomist, Malaise and mouse live-trapper, and specimen processor for ACG.

Figure 88. 

Ascogaster guillermopereirai, holotype.

Ascogaster gustavoecheverrii Sharkey, sp. nov.

Figure 89

Diagnostics

BOLD:AAL0574. Consensus barcode. TATTTTATATTTTATATTTGGAATTTGATCTGGTATAGTTGGTTTATCCTTAAGTTTATTAATTTGTATAGAATTAAGATTAGTTTCTTCTTATTTAGGTAATGATCAAATTTATAATAGAGTAGTTACTATACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGCGGTTTCGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATGTCTTTTCCTCGTTTAAATAATTTAAGTTTTCGACTTTTGGTTCCTTCTCTATTTTATTCAATATTAAGAGGTATTTTAAATACTGGGAATGGTACAGGATGAACAGTATATCCACCATTATCATTAGGAATATATCATAGAGGTATTTCTGTAGATCTTAGAATTTTTTCTTTACATATAGCTGGTATATCATCAATTTTAGGAGCTTTAAATTTTATTATTACTATTTATTGTATATGAATTGGTTTTAAAAATATAAATAAATTATCATTATWTGTTTGATCTGTATTAATTACTACTTTTTTATTAATTACATCTTTACCTGTATTAGCAGAAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTAGATTTTTTGATCCATCTGGTGGAGGAGATCCTGTATTATATCAACATTT.

Holotype ♀

Alajuela, Sector San Cristobal, Sendero Huerta, 10.93, -85.372, 527 meters, caterpillar collection date: 18/xi/2013, wasp eclosion date: 12/xii/2013. Depository: CNC.

Host data. Megalota crassana (Tortricidae) feeding on Croton schiedeanus (Euphorbiaceae).

Caterpillar and holotype voucher codes. 13-SRNP-6613, DHJPAR0054560.

Paratypes

Hosts = Megalota ochreoapex, Megalota spinulosa, Megalota simpliciana, Megalota delphinosema, Megalota crassana. DHJPAR0042852, DHJPAR0042856, DHJPAR0045414, DHJPAR0046941, DHJPAR0049003, DHJPAR0053678, DHJPAR0054566, DHJPAR0062572. Depository: CNC.

Etymology

Ascogaster gustavoecheverrii is named to honor Sr. Gustavo Echeverri for his thousands of hectares donated to ACG and financial support of the ACG Biological Education Program.

Figure 89. 

Ascogaster gustavoecheverrii, holotype.

Ascogaster katyvandusenae Sharkey, sp. nov.

Figure 90

Diagnostics

BOLD:AAK1026. Consensus barcode. AATTTTGTATTTTTTATTTGGCATTTGATCCGGTGTATTTGGGTTGTCTTTAAGATTAATTATTCGAATAGAATTAAGTTCAGTCACTTCTTATTTAGGTAATGATCAGATTTATAATAGTATTGTCACCCTTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATGTTAGGGGGTCCAGATATATCATTCCCTCGTATAAATAATTTAAGATTTTGATTATTGGTTCCTTCAATTATTTTACTAATTAATAGAAGTTTTATTAATGTTGGGGTAGGGACAGGATGAACTGTTTATCCACCTTTATCTCTTATTATTGGACATAGAGGAGCTTCTGTAGATATAAGAATTTTTTCTTTACATTTAGCTGGTATATCTTCAATTATAGGGGCTGTAAATTTTATTGTTACTATTTTAAACATAAGATTTAGGTTTAAAAATATGGATAAATTTCCTTTATTTGTTTGATCAATTATAATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACAGATCGAAATTTAAATACAAGTTTTTTTGACCCTTCAGGGGGGGGAGACCCAATTTTATATCAGCATTTATTT.

Holotype ♂

Guanacaste, Sector San Cristobal, Tajo Angeles, 10.865, -85.415, 540 meters, caterpillar collection date: 18/viii/2010, wasp eclosion date: 31/viii/2010. Depository: CNC.

Host data. Megalota spinulosa (Tortricidae) feeding on Croton schiedeanus (Euphorbiaceae).

Caterpillar and holotype voucher codes. 10-SRNP-4345, DHJPAR0055824.

Paratype

Host = Amorbia decerptana: DHJPAR0035314. Depository: CNC.

Etymology

Ascogaster katyvandusenae is named to honor Mrs. Katy Van Dusen of Monteverde and Cuajiniquil for her decades of support of ACG activities with birds and marine projects, and chief collaborator with Frank Joyce.

Figure 90. 

Ascogaster katyvandusenae, holotype.

Ascogaster luisdiegogomezi Sharkey, sp. nov.

Figure 91

Diagnostics

BOLD:ACC1221. Consensus barcode. AATTTTGTATTTTTTATTTGGTATTTGATCAGGTATAATTGGTTTATCTTTAAGTTTATTAATTCGTATAGAATTAAGATCAGTTTCTTCTTATTTAGGAAATGATCAAATTTATAATAGGGTAGTAACAATGCATGCTTTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGTTTTGGGAATTGATTAGTTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGATTAAATAATTTAAGTTTTTGATTATTAATTCCTTCTTTATTTTTTTTATTAATTAGAGGTATTTTAAATATTGGAGTTGGTACAGGATGAACTGTTTATCCACCATTATCATTAGGTATATTTCATAGAGGAATTTCAGTTGATTTAAGAATTTTCTCTTTACATATAGCAGGCATATCTTCTATTTTAGGAGCTTTAAATTTTATTATTACTATTTTTTGTATATGATTTGGATTTAAATATATAGATAAATTATCTTTATTTATTTGATCAGTAGTAATTACTGCATTTTTATTAATTACATCTTTACCCGTTTTAGCAGGTGCTATTACAATATTATTAACAGATCGAAATTTAAATACTAGTTTTTTTGACCCTTCTGGTGGAGGTGACCCAATTTTATATCAACATTTGTTT.

Holotype ♀

Alajuela, Sector San Cristobal, Sendero Huerta, 10.93, -85.372, 527 meters, caterpillar collection date: 09/vi/2012, wasp eclosion date: 04/vii/2012. Depository: CNC.

Host data. Stenoma Janzen414 (Depressariidae) feeding on Ocotea atirrensis (Lauraceae).

Caterpillar and holotype voucher codes. 12-SRNP-2366, DHJPAR0049931.

Paratypes

None.

Etymology

Ascogaster luisdiegogomezi is named to honor Sr. Luis Diego Gomez (RIP) for his strong biopolitical support of Janzen and Hallwachs in the initiation of their Costa Rican biodiversity research adventures in the 1960s–1970s.

Figure 91. 

Ascogaster luisdiegogomezi, holotype.

Chelonus Panzer, 1806

Chelonus is worldwide in distribution with ca. 1000 described species and many more undescribed. Hosts include a wide range of lepidopterous families. Here we follow Kittel et al. (2015) and include Microchelonus in Chelonus. Papp (2016) described 25 species of Microchelonus and included a key to the species occurring in central and South America. Of these, all but one occurs in Costa Rica or Honduras, and it is likely that some of the species described below may turn out to be junior synonyms; which we will discover when, and if, the holotypes are barcoded. Judging by the similarly sized revision of Leptodrepana by Dadelahi et al. (2018), synonyms would be few. The species descriptions in Papp (2016) lack photographic images, and although the line drawings and descriptions are detailed, they do not provide enough diagnostic power for accurate identification. Though the types could be borrowed, this would dramatically retard the rate of description and still result in uncertainty. The types of Papp’s species are deposited in the following collections: Department of Entomology, Utah State University, Logan (USA); Hungarian Natural History Museum, Budapest (Hungary); USNM = United States National Museum of Natural History, Washington (USA); and Zoological Institute and Museum, The University, Lund (Sweden).

Chelonus alejandrozaldivari Sharkey, sp. nov.

Figure 92

Diagnostics

BOLD:ACO0288. Consensus barcode. TACATTATATTTTATTTTTGGTATTTGATCTGGAATATTTGGTTTATCTTTAAGTTTACTTATTCGAATAGAATTAAGGATAGGAGGTAGATTATTATTAAATGATCAATTATATAATAGTTTAGTAACATTRCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTGTTATAATTGGAGGYTTTGGTAATTGATTAATTCCTTTAATATTAGGATTACCTGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGGTTATTAATTCCTTCATTAACTTTATTAATTTTAAGGGGATTTATTAATATAGGGGTAGGTACAGGTTGAACTGTTTATCCTCCTTTATCTTCTTTAATTGGTCATGGAGGAATTTCTGTTGATTTATCTATTTTTTCTTTACATTTAGCAGGAGCTTCTTCTATTATAGGCGCAATTAATTTTATTGTTACTATTTTAAATACTTGAATATTAAGTAAATATTTAGATAAGTTTCCTTTATTTTCATGATCTGTTTTTATTACTGCTATTTTATTATTATTATCATTRCCAGTATTAGCYGGTGCAATTACTATATTATTAAGAGATCGTAATTTAAATACTAGATTTTTTGATCCTTCTGGTGGAGGRGAYCCTGTTTTATATCAACATTTATTT.

Holotype ♂

Guanacaste, Pailas Dos, PL12-3, 10.7631, -85.3344, 820 meters, 05-18/xii/2014, Malaise trap PL12-3A. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG44692-B02.

Paratypes

BIOUG43804-H09, BIOUG44551-E11. Depository: CNC.

Etymology

Chelonus alejandrozaldivari is named to honor Dr. Alejandro Zaldivar-Riveron for his research in braconid phylogeny and taxonomy.

Figure 92. 

Chelonus alejandrozaldivari, holotype.

Chelonus gustavogutierrezi Sharkey, sp. nov.

Figure 93

Diagnostics

BOLD:AAA6603. Consensus barcode. AATATTATATTTTATATTTGGAATTTGATGTGGRATAATAGGATTGTCATTAAGAGTAWTAATTCGTATAGAATTAAGAAGAGTAATAAGATTATTTTATAATGATCAATTATATAATAGAATTGTTACTATGCATGCTTTTATTATAATTTTTTTTATAGTTATACCATTAATAATTGGTGGATTTGGRAATTGATTAATTCCACTAATATTAGGATTATCAGATATAATTTTTCCTCGAATAAATAATATAAGATTTTGATTGTTACTACCTTCAATTATTTTATTAATTATAGGTGGATTTGTTAATATAGGAGCAGGTACAGGATGAACAGTTTATCCACCTTTATCATTATTAATAGGTCATAGAGGAATCTCAGTAGATTTATCTATTTTTTCTTTACATTTAGCTGGTATATCTTCAATTATAGGTTCAATTAATTTTATTGTTACTATTATTAATACATGATTAAATATAAAATATATGGATAAATATCCTTTATTTGTTTGATCAGTATTTATTACTACTATTTTATTATTATTATCTTTGCCAGWTTTGGCTGGAGCAATTACTATATTATTAAGTGATCKAAATTTAAATACTAGTTTTTTTGATCCTTCAGGTGGTGRTGATCCAGTATTATATCAACAYTTATTT.

Holotype ♂

Alajuela, Sector Rincon Rain Forest, Flecha, 10.947, -85.315, 491 meters, caterpillar collection date: 15/ix/2009, wasp eclosion date: 27/ix/2009. Depository: CNC.

Host data. Omiodes cuniculalis (Crambidae) feeding on Gliricidia sepium (introduced) (Fabaceae), and a variety of other woody species.

Caterpillar and holotype voucher codes. 09-SRNP-80021: DHJPAR0037990.

Paratypes

Host = Omiodes cuniculalis, Pyralidae 09-SRNP-71481: DHJPAR0037185, DHJPAR0037164, DHJPAR0029095, DHJPAR0029096, DHJPAR0029097, DHJPAR0029099, DHJPAR0029100, DHJPAR0029084, DHJPAR0029083, DHJPAR0029081, DHJPAR0029080, DHJPAR0029092, DHJPAR0029091, DHJPAR0029090, DHJPAR0029089, DHJPAR0029101, DHJPAR0037985. Depository: CNC.

Etymology

Chelonus gustavogutierrezi is named to honor Dr. Gustavo Gutierrez of the Universidad de Costa Rica for his enthusiastic Universidad de Costa Rica support for BioAlfa development.

Figure 93. 

Chelonus gustavogutierrezi, holotype.

Chelonus gustavoinduni Sharkey, sp. nov.

Figure 94

Diagnostics

BOLD:ADA0356. Consensus barcode. GTATTATATTTTATTTTTGGTATTTGATCTGGAGTTTTAGGATTATCATTAAGATTAATTTTACGAATAGAATTAAGAGTGTTAGGAAGGTTATTAAAAAATGATCAATTATATAATAGGGTAGTTACTTTACATGCTTTTGTAATAATTTTTTTTATGGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGATTACCAGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGGTTATTAATTCCTTCATTAATAATGTTATTATTGAGAAGATTTGTAAATATAGGTGTAGGTACAGGATGAACGGTTTATCCACCATTATCTTCATTAATAGGACATGGTGGTATTTCAGTAGATTTATCAATTTTTTCTTTACATTTAGCAGGTGCATCTTCTATTATGGGGGCAATTAATTTTATTGTAACGGTAATAAATACTAATTTTAAGATTGGGTTTATAGATAAATTTCCATTATTTGTTTGATCAGTTTTAATTACGGCTATTTTATTATTATTATCATTGCCAGTATTAGCCGGTGCTATTACTATATTATTA.

Holotype ♂

Guanacaste, Sector San Cristobal, Estación San Gerardo, 10.8801, -85.389, 575 meters, 22‒29/vi/2015, Malaise trap. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28148-H10.

Paratypes

None.

Etymology

Chelonus gustavoinduni is named to honor Sr. Gustavo Induni of SINAC for his enthusiastic SINAC support for BioAlfa development.

Figure 94. 

Chelonus gustavoinduni, holotype.

Chelonus harryramirezi Sharkey, sp. nov.

Figure 95

Diagnostics

BOLD:AAE2698. Consensus barcode. AATATTATATTTTATTTTTGGAATTTGATGKGGAATGTTAGGTTTATCATTAAGAGTTATAATTCGTATAGAATTAAGAAGGACATTAAGTTTATTCTATAATGATCAATTATATAATAGAATTGTTACTATACATGCTTTTATTATAATTTTTTTTATAGTTATACCATTAATAATTGGAGGGTTTGGAAATTGATTAATTCCTTTAATATTAGGTTTATCAGATATAATTTTTCCTCGTATAAATAATATAAGATTTTGATTATTAATTCCTTCAATTATTTTATTAATTATAGGGGGTTTTGTAAATACAGGGGCAGGTACAGGATGAACAGTTTATCCTCCTTTATCATTATTGATAGGTCATAGAGGGGTATCAGTAGATTTATCAATCTTTTCTTTACATTTAGCTGGAGCATCATCTATTATGGGTTCTATTAATTTTATTGTAACTATTATTAATACTTGGTTGAATATAAAATATATAGATAAATATCCTTTATTTGTTTGATCTGTTTTTATTACCACAATTTTGTTATTATTATCTTTACCAGTTTTAGCTGGGGCAATTACTATATTATTAAGAGATCGAAATTTAAATACTAGATTTTTTGATCCTTCAGGGGGTGGAGAYCCAGTATTATATCAACATTTATTT.

Holotype ♂

Alajuela, Sector Rincon Rain Forest, Quebrada Bambu, 10.93, -85.252, 109 meters, caterpillar collection date: 14/ii/2013, wasp eclosion date: 01/iii/2013. Depository: CNC.

Host data. Omiodes humeralis (Crambidae) feeding on Inga sapindoides (Fabaceae).

Caterpillar and holotype voucher codes. 13-SRNP-75542, DHJPAR0051927.

Paratypes

Hosts = Omiodes humeralis. DHJPAR0023700, DHJPAR0020624, DHJPAR0020623, DHJPAR0020802, DHJPAR0038012, DHJPAR0038013, DHJPAR0038014, DHJPAR0020804, DHJPAR0046938, DHJPAR0051326, DHJPAR0051328, DHJPAR0051330, DHJPAR0055229, DHJPAR0054564, DHJPAR0054938. Depository: CNC.

Etymology

Chelonus harryramirezi is named to honor Sr. Harry Ramirez of GDFCF and ACG for his many decades as a dedicated inventory parataxonomist, Malaise and mouse live-trapper, and specimen processor for ACG.

Figure 95. 

Chelonus harryramirezi, holotype.

Chelonus hartmanguidoi Sharkey, sp. nov.

Figure 96

Diagnostics

BOLD:AAD1994. Consensus barcode. AATATTATATTTTATTTTTGGAATTTGGTGTGGAATAATAGGATTATCCTTAAGAGTTATGATTCGTATAGAGTTAAGAAGAACAATAAGATTATTTTGTAATGATCAATTATATAATAGAATTGTTACTATACATGCTTTTATTATAATTTTTTTTATAGTTATACCATTAATAATTGGGGGGTTTGGAAATTGATTAATYCCTTTAATATTAGGTTTATCAGATATAATTTTTCCTCGTATAAATAATATAAGATTTTGATTATTAATCCCTTCAATTATTTTATTAATTATAGGAGGATTTGTAAATATAGGTGCAGGTACAGGATGAACAATTTATCCGCCTTTATCATTATTAATAGGTCATAGTGGGATTTCAGTAGATTTATCAATTTTTTCTTTACATTTAGCTGGGGCATCATCTATTATAGGTTCAATTAATTTTATTGTGACTATTATTAATACTTGATTAAATATAAAGTATATGGATAAATATCCTTTATTTGTTTGATCTGTTTTTATTACTACAATTTTATTATTATTATCTTTRCCTGTTTTAGCTGGGGCAATTACTATACTATTAAGAGATCGAAATTTAAATACTAGATTTTTTGATCCTTCAGGGGGTGGGGACCCAGTATTATACCAACATTTATTT.

Holotype ♀

Alajuela, Sector Rincon Rain Forest, Palomo, 10.962, -85.28, 96 meters, caterpillar collection date: 19/i/2011, wasp eclosion date: 10/ii/2011. Depository: CNC.

Host data. Omiodes Janzen05 (Crambidae) feeding on Entada gigas (Fabaceae).

Caterpillar and holotype voucher codes. 11-SRNP-67022, DHJPAR0042543.

Paratypes

Hosts = Omiodes Janzen03, spiloBioLep01 BioLep577, Piletosoma thialis, Omiodes Janzen05, Phostria cyrisalis. DHJPAR0029154, DHJPAR0029166, DHJPAR0035222, DHJPAR0035307, DHJPAR0035308, DHJPAR0035312, DHJPAR0035313, DHJPAR0036398, DHJPAR0046801, DHJPAR0046947, DHJPAR0052896, DHJPAR0053677, DHJPAR0053686, DHJPAR0054439, DHJPAR0054570, DHJPAR0054571, DHJPAR0056957, DHJPAR0056958, DHJPAR0056963, DHJPAR0056968, DHJPAR0056969. Depository: CNC.

Etymology

Chelonus hartmanguidoi is named to honor Sr. Hartman Guido of ICE for his years of crucial support for the ACG-ICE-GDFCF bioinventory project of PL12 geothermal site at Pailas II on the boundary of ACG.

Figure 96. 

Chelonus hartmanguidoi, holotype.

Chelonus hazelcambroneroae Sharkey, sp. nov.

Figure 97

Diagnostics

BOLD:AAE9128. Consensus barcode. TATATTATATTTTATTTTTGGAGTTTGAAGTGGGATAATAGGTTTATCATTAAGAGTTATAATTCGTATAGAATTAAGGAGTGTTATAAGATTATTTAGTAATGATCAGTTATATAATAGGATTGTTACAATACATGCCTTTGTAATAATTTTTTTTATAGTTATACCTTTAATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGATTATCTGATATAATTTTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCACTTATTTTATTAATTATAGGTGGATTTGTTAATATAGGTGCTGGGACAGGATGAACAGTTTATCCTCCTTTATCATTATTAATAGGTCATAGAGGAATTTCAGTAGATTTATCTATTTTTTCTTTACATTTAGCTGGAATATCATCAATTATAGGTTCAATTAATTTTATTGTTACTATTATAAATACTTGATTACATGTAAAATATATAGATAAATATCCATTATTTGTTTGATCTGTATTTATTACAACTATTTTATTATTGTTATCATTGCCAGTTTTAGCAGGAGCAATTACTATATTATTAAGTGATCGAAATTTAAATACAAGATTTTTTGATCCATCAGGTGGAGGTGATCCAGTATTATATCAACATTTATTT.

Holotype ♀

Alajuela, Sector San Cristobal, Sendero Huerta, 10.93, -85.372, 527 meters, caterpillar collection date: 27/vii/2012, wasp eclosion date: 25/viii/2012. Depository: CNC.

Host data. Crambidae: Prenesta scyllalisDHJ02 (Crambidae) feeding on Allomarkgrafia plumeriiflora (Apocynaceae).

Caterpillar and holotype voucher codes. 12-SRNP-3201, DHJPAR0049930.

Paratypes

Host = Prenesta scyllalisDHJ02: DHJPAR0030990, DHJPAR0030989, DHJPAR0030988, DHJPAR0022199. Depository: CNC.

Etymology

Chelonus hazelcambroneroae is named to honor Sra. Hazel Cabronero for her many years as a as a dedicated inventory parataxonomist and specimen preparer in BioLep for the ACG bioinventory.

Figure 97. 

Chelonus hazelcambroneroae, holotype.

Chelonus iangauldi Sharkey, sp. nov.

Figure 98

Diagnostics

BOLD:AAD4709. Consensus barcode. AATATTATATTTTATTTTTGGAGTTTGAAGAGGRATAATAGGGTTATCTTTAAGAGTAATAATTCGTATAGAATTAAGAAGAGTAATAAGATTATTTTATAATGATCAATTATATAATAGAATTGTAACGATACATGCTTTTATTATAATTTTTTTTATAGTTATACCATTAATAGTAGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGATTATCTGATATAATTTTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCAATTATTTTATTAATTATAGGTAGATTTGTTAATATAGGAGCTGGAACAGGGTGAACAGTATATCCTCCATTATCATTATTAGTAAGACATAGAGGAATTTCTGTAGATTTATCTATTTTTTCTTTACATTTAGCTGGAATATCATCAATTATAGGTTCAATTAATTTTATTGTTACTATTTTAAATACTTGAATATATAAAAAATATATAGATAAATATCCATTATTTGTGTGATCTATTTTTATTACAACAATTTTATTATTATTATCATTACCAGTTTTGGCTGGTGCAATTACTATATTATTAAGTGATCGAAATTTAAATACAAGATTTTTTGATCCATCAGGAGGAGGAGATCCAGTATTATACCAACATTTATTT.

Holotype♀

Alajuela, Sector San Cristobal, Quebrada Garcia, 10.861, -85.426, 495 meters, caterpillar collection date: 20/vii/2009, wasp eclosion date: 11/x/2009. Depository: CNC.

Host data. Prenesta scyllalisDHJ01 (Crambidae) feeding on Forsteronia spicata (Apocynaceae).

Caterpillar and holotype voucher codes. 09-SRNP-4322, DHJPAR0037165.

Paratypes

Host = Prenesta scyllalisDHJ01: DHJPAR0037160, DHJPAR0037183, DHJPAR0036726, DHJPAR0037168, DHJPAR0037175, DHJPAR0037169, DHJPAR0040017. Depository: CNC.

Etymology

Chelonus iangauldi is named to honor Dr. Ian Gauld (RIP) for his decades of highly enthusiastic support for all things taxonomic and bioinventory of Costa Rica in general and ACG specifically, with special emphasis on wasps in the family Ichneumonidae.

Figure 98. 

Chelonus iangauldi, holotype.

Chelonus isidrochaconi Sharkey, sp. nov.

Figure 99

Diagnostics

BOLD:AAC8260. Consensus barcode. AATATTATATTTTGTATTTGGAATTTGAAGAGGTATAATTGGGYTATCATTAAGAGTTATAATTCGTATAGAATTAAGTAGGGTAATAAGATTATTTTCTAAYGATCAATTGTATAATAGAATTGTGACTATACATGCTTTTATTATAATTTTTTTTATAGTAATACCTTTRATAATTGGRGGTTTTGGAAATTGGYTAATTCCTTTAATATTAGGATTATCTGATATAATTTTTCCTCGAATAAATAATATAAGATTTTGGTTATTAATTCCTTCAATTATTTTATTAATTATAGGCGGATTTGTAAATATAGGAGCTGGGACAGGATGAACAGTGTATCCYCCTTTATCTTTATTAATAGGTCATAGAGGGGTGTCAGTTGATTTATCTATTTTTTCTTTACATTTAGCTGGGGCTTCATCAATTATAGGKTCAATTAATTTTATTGTTACTATTATAAATACTTGGTTACATATTAAGTATATAGATAAATAYCCATTATTTGTTTGATCTGTATTTATTACAACTATTCTTTTATTATTATCATTACCAGTTTTAGCTGGAGCAATTACTATATTATTAAGTGATCGAAATTTAAATACAAGATTTTTTGAYCCTTCAGGAGGGGGRGAYCCTGTATTGTATCAACATTTATTT.

Holotype ♀

Alajuela, Sector San Cristobal, Estación San Gerardo, 10.88, -85.389, 575 meters, caterpillar collection date: 26/v/2012, wasp eclosion date: 16/vi/2012. Depository: CNC.

Host data. Parastenia retractalis (Crambidae) feeding on Trichostigma octandrum (Phytolaccaceae).

Caterpillar and holotype voucher codes. 12-SRNP-2158, DHJPAR0049008.

Paratypes

Host = Parastenia retractalis: DHJPAR0037159, DHJPAR0037174, DHJPAR0037181, DHJPAR0037166, DHJPAR0037172, DHJPAR0037173, DHJPAR0037162, DHJPAR0037176, DHJPAR0037179, DHJPAR0048983, DHJPAR0048984, DHJPAR0048986, DHJPAR0048987, DHJPAR0048988. Depository: CNC.

Etymology

Chelonus isidrochaconi is named to honor Sr. Isdro Chacon of BioAlfa for his decades of dedicated support and action for the taxonomy and biodiversity of Costa Rica in general and specifically INBio, Costa Rica’s Instituto Nacional de Biodiversidad and the Museo Nacional de Costa Rica.

Figure 99. 

Chelonus isidrochaconi, holotype.

Chelonus janecheverriae Sharkey, sp. nov.

Figure 100

Diagnostics

BOLD:AAL5555. Consensus barcode. GTAATAGGCTTATCTTTAAGTGTAATAATTCGTATAGAATTAAGAAGTGTAATAAGATTATTTTATAATGATCAATTATATAATAGAATTGTAACTATACATGCTTTTATTATAATTTTTTTTATAGTTATGCCTTTAATAATTGGGGGGTTTGGAAATTGATTAATTCCTTTAATGTTAGGTTTATCTGATATAATTTTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCAATTATTTTATTAATTATAGGAGGATTTGTTAATATAGGGGCTGGCACAGGATGAACAGTTTATCCGCCATTATCATTATTAATAGGTCATAGTGGTGTTTCAGTAGATTTATCTATTTTTTCTTTACATTTGGCAGGAGCCTCATCTATTATAGGTTCAATTAATTTTATTGTGACTATTATAAATACTTGGATGTATTATAAATACATAGATAAATATCCATTATTTGTTTGATCAGTATTTATTACAACTATTTTATTATTATTATCATTACCAGTTTTAGCTGGTGCAATTACTATATTATTAAGAGACCGAAATTTGAACACAAGATTTTTTGATCCATCAGGGGGGGGGGG.

Holotype ♀

Alajuela, Sector Rincon Rain Forest, San Lucas, 10.918, -85.303, 320 meters, caterpillar collection date: 02/ii/2010, wasp eclosion date: 20/ii/2010. Depository: CNC.

Host data. crambidJanzen01 Janzen27 (Crambidae) feeding on Calathea lutea (Marantaceae).

Caterpillar and holotype voucher codes. 10-SRNP-40463, DHJPAR0039179.

Paratypes

None.

Etymology

Chelonus janecheverriae is named to honor Sra. Jane Echeverri for her lifetime support of Sr. Gustavo Echeverri in their high-quality management of Costa Rican farms and their financial support for decades of ACG’s Programa de Educación Biológica for the school children in the schools surrounding ACG.

Figure 100. 

Chelonus janecheverriae, holotype.

Chelonus jeffmilleri Sharkey, sp. nov.

Figure 101

Diagnostics

BOLD:ACF0845. Consensus barcode. AATATTATATTTTTTATTTGGAATTTGAAGTGGGATAATAGGTTTATCTTTAAGTGTAATAATTCGTATAGAATTAAGAAGTGTAATAAGATTATTTTATAATGATCAATTATATAATAGAATTGTAACTATACATGCTTTTATTATAATTTTTTTTATAGTTATGCCTTTAATAATTGGGGGATTTGGAAATTGATTAATCCCTTTAATATTAGGATTATCTGATATAATTTTTCCTCGAATAAATAATATAAGATTTCGATTATTAATTCCTTCAATTATTTTATTAATTATAGGAGGATTCGTTAATATAGGGGCTGGTACGGGATGAACAGTTTATCCTCCATTATCATTATTAATAGGTCATAGTGGAGTTTCAGTAGATTTATCTATTTTTTCTTTACATTTGGCAGGGGCTTCATCTATTATAGGTTCAATTAATTTTATTGTGACTATTATAAATACTTGGTTACATTATAAATATATAGATAAATATCCATTATTTGTTTGATCAGTATTTATTACAACTATTTTATTATTATTATCATTACCAGTTTTAGCTGGTGCAATTACTATATTATTAAGAGATCGAAATTTAAATACAAGATTTTTTGATCCATCAGGGGGAGGAGACCCAGTATTATATCAGCATTTATTT.

Holotype ♂

Guanacaste, Sector Del Oro, Quebrada Trigal, 11.027, -85.495, 290 meters, caterpillar collection date: 04/viii/2009, wasp eclosion date: 18/viii/2009. Depository: CNC.

Host data. Phostria oajacalis (Crambidae) feeding on Merremia umbellata (Convolvulaceae).

Caterpillar and holotype voucher codes. 09-SRNP-22201, DHJPAR0040375.

Paratypes

Host = Eulepte Solis15: DHJPAR0042859, DHJPAR0042862. Depository: CNC.

Etymology

Chelonus jeffmilleri is named to honor Dr. Jeff Miller for his enthusiastic and productive interest in bringing the ACG caterpillars and their moths and butterflies into public view through book publications and public presentations.

Figure 101. 

Chelonus jeffmilleri, holotype.

Chelonus jennyphillipsae Sharkey, sp. nov.

Figure 102

Diagnostics

BOLD:ACL6996. Consensus barcode. AATGTTATATTTTTTATTTGGAATTTGGAGTGGGATAATAGGTTTATCTTTGAGTGTAATAATTCGTATAGAATTAAGAAGTGTAATAAGATTATTTTATAATGATCAATTATATAATAGAATTGTAACTATACATGCTTTTATTATAATTTTTTTTATAGTTATGCCTTTAATAATTGGGGGATTTGGGAATTGGTTAATCCCTTTAATATTAGGATTATCTGATATAATTTTTCCTCGAATAAATAATATAAGATTTTGGTTACTAATTCCTTCAATTATTTTATTAATTATAGGAGGATTTGTTAATATGGGGGCTGGTACGGGATGAACAGTTTATCCTCCATTATCATTATTAATAGGTCATAGTGGAGTTTCAGTAGATTTATCTATTTTTTCTTTACATTTGGCAGGGGCTTCATCTATTATAGGTTCAATTAATTTTATTGTGACTATTATAAATACTTGATTGCATTTTAAATATATAGATAAATATCCATTATTTGTTTGATCAGTATTTATTACAACTATTTTATTATTATTATCATTACCAGTTTTAGCTGGTGCAATTACTATATTATTAAGAGATCGAAATTTAAATACAAGATTTTTTGATCCATCAGGGGGAGGGGATCCAGTATTATACCAGCATTTATTT.

Holotype ♀

Alajuela, Sector Rincon Rain Forest, Malaguenya, 10.956, -85.284, 221 meters, caterpillar collection date: 14/x/2013, wasp eclosion date: 30/x/2013. Depository: CNC.

Host data. Eulepte Janzen12 (Crambidae) feeding on Vitex cooperi (Lamiaceae).

Caterpillar and holotype voucher codes. 13-SRNP-79751, DHJPAR0053682.

Paratypes

None.

Etymology

Chelonus jennyphillipsae is named to honor Dr. Jenny Phillips of BioAlfa for her decades of enthusiastic taxonomic and administrative support of INBio, parataxonomists, and all matters biodiversity of Costa Rica coupled with intensely developing BioAlfa of Costa Rica.

Figure 102. 

Chelonus jennyphillipsae, holotype.

Chelonus jeremydewaardi Sharkey, sp. nov.

Figure 103

Diagnostics

BOLD:AAB1653. Consensus barcode. AATATTATATTTTTTATTTGGGATTTGAAGTGGAATAATAGGTYTATCTTTAAGTGTAATAATTCGTATAGAATTAAGAAGTGTAATRAGATTATTTTATAATGATCAATTATATAATAGAATTGTAACTATACATGCTTTTATTATAATTTTTTTTATAGTTATGCCTTTAATAATTGGGGGATTTGGAAATTGATTAATCCCTTTAATATTAGGATTATYTGATATAATTTTTYCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCAATTATTTTATTAATTATAGGAGGATTTGTTAATATAGGGGCTGGWACAGGGTGAACAGTTTATCCYCCATTATCATTATTAATAGGTCATAGTGGAGTTTCAGTAGATTTATCTATTTTTTCTTTACATTTGGCAGGGGYTTCATCTATTATAGGTTCAATTAATTTTATTGTGACTATTATAAATACTTGRYTACATTATAAATATATAGATAAATATCCGTTATTTGTTTGGTCAGTATTTATTACAACTATTTTATTATTATTATCATTACCAGTTTTAGCTGGTGCAATTACTATATTATTAAGAGATCGAAAYTTAAATACAAGATTTTTTGATCCATCAGGGGGAGGAGAYCCAGTATTATATCAGCATTTATTT.

Holotype ♂

Guanacaste, Sector Pitilla, Bullas, 10.987, -85.385, 440 meters, caterpillar collection date: 29/v/2014, wasp eclosion date: 15/vi/2014. Depository: CNC.

Host data. Syllepis marialis (Crambidae) feeding on Allophylus psilospermus (Sapindaceae).

Caterpillar and holotype voucher codes. 14-SRNP-70940, DHJPAR0055376.

Paratypes

Hosts = Crambidae: Asturodes fimbriauralis, Asturodes junkoshimurae, Ceratocilia sixolalis, Desmia benealisDHJ02, Desmia Janzen03, Desmia ploralisDHJ10, Desmia Solis100, Eulepte Solis15, Herpetogramma salbialis, Herpetogramma Solis10, Leucochromodes melusinalisDHJ02, Microthyris prolongalisDHJ02, Omiodes fulvicauda, Patania Solis03, Patania Solis04, Phostria cyrisalis, Psara obscuralisDHJ01, Salbia cassidalis, spiloBioLep01 BioLep311, spiloJanzen01 Janzen14DHJ02, Syllepis marialis. DHJPAR0029069, DHJPAR0029070, DHJPAR0029117, DHJPAR0035309, DHJPAR0035311, DHJPAR0035315, DHJPAR0036400, DHJPAR0037182, DHJPAR0037862, DHJPAR0037979, DHJPAR0037981, DHJPAR0037982, DHJPAR0037989, DHJPAR0039121, DHJPAR0039502, DHJPAR0040364, DHJPAR0040368, DHJPAR0042084, DHJPAR0042093, DHJPAR0042096, DHJPAR0042857, DHJPAR0042860, DHJPAR0045402, DHJPAR0045403, DHJPAR0045408, DHJPAR0046798, DHJPAR0046935, DHJPAR0048091, DHJPAR0048092, DHJPAR0048093, DHJPAR0048094, DHJPAR0048097, DHJPAR0048104, DHJPAR0048169, DHJPAR0048973, DHJPAR0050072, DHJPAR0051337, DHJPAR0052887, DHJPAR0052891, DHJPAR0053674, DHJPAR0053681, DHJPAR0055370, DHJPAR0056949, DHJPAR0058149, DHJPAR0062180, DHJPAR0062181, DHJPAR0062182, DHJPAR0062183, DHJPAR0062184, DHJPAR0062185, DHJPAR0062186, DHJPAR0062187, DHJPAR0062188, DHJPAR0062189, DHJPAR0062190, DHJPAR0062191. Depository: CNC.

Other material

A specimen registered in BOLD (NHM749343) from Belize shares the same BIN and is likely conspecific. It was not examined and is not part of the type series.

Etymology

Chelonus jeremydewaardi is named to honor Dr. Jeremy deWaard for his many years laboring in execution and administration of the field and laboratory actions performed by the Centre for Biodiversity Genomics to rapidly and accurately DNA barcode tens of thousands of Costa Rican insects.

Figure 103. 

Chelonus jeremydewaardi, holotype.

Chelonus jessiehillae Sharkey, sp. nov.

Figure 104

Diagnostics

BOLD:AAW4588. Consensus barcode. TATATTATATTTTATATTTGGAATTTGATGTGGGATATTAGGGTTATCTTTAAGATTAATGATTCGTATGGAATTAAGAAGAGTAATAAGTTTATTTTTTAATGATCAATTATATAATAGAATTGTTACTATACATGCTTTTGTAATAATTTTTTTTATAGTAATACCAGTAATAATTGGGGGGTTTGGTAATTGATTAGTTCCTTTAATATTAGGGTTATCTGATATAATTTTTCCACGAATGAATAACATAAGTTTTTGGTTATTAATTCCTTCAATTATTTTATTAATTATAGGAGGATTTGTAAATATAGGGGCAGGTACTGGGTGGACAGTTTATCCACCATTATCTTTATTAATAGGTCATAGAGGGGTATCTGTTGATTTATCAATTTTTTCTTTACATTTAGCAGGTATATCATCAATTATAGGTTCAATTAATTTTATTGTTACTATTGTTAATACATGATTATTAATTAATTATATAGATAAATATCCTTTATTTGTATGGTCAGTGTTTATTACTACAATTTTATTATTATTATCTTTACCGGTTTTAGCTGGTGCAATTACTATATTATTAAGAGATCGTAATTTAAATACTAGATTTTTTGATCCTTCAGGAGGAGGGGATCCAGTTTTATACCAACATTTATTT.

Holotype ♂

Alajuela, Sector Rincon Rain Forest, Sendero Albergue Crater, 10.849, -85.328, 980 meters, caterpillar collection date: 10/viii/2010, wasp eclosion date: 31/viii/2010. Depository: CNC.

Host data. gelJanzen01 Janzen349 (Gelechiidae) feeding on Mikania banisteriae (Asteraceae).

Caterpillar and holotype voucher codes. 10-SRNP-4459, DHJPAR0042088.

Paratypes

None.

Etymology

Chelonus jessiehillae is named to honor Mrs. Jesse Hill for her decades of support for ACG in general and specifically the Parataxonomist Program conducting the field aspects of the bioinventory of all of ACG.

Figure 104. 

Chelonus jessiehillae, holotype.

Chelonus jesusugaldei Sharkey, sp. nov.

Figure 105

Diagnostics

BOLD:ABY3312. Consensus barcode. TATAATATATTTTGTATTTGGAATTTGATGTGGGATATTAGGTTTATCTTTGAGATTAATAATTCGTATAGAATTAAGAAGAGTAATAAGTTTATTTTATAATGATCAATTATATAATAGAATTGTTACTATACATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGTTTATCAGATATAATTTTTCCTCGAATAAATAATATAAGATTTTGATTATTACTTCCTTCAATTATTTTATTAATTATAGGAGGATTTGTAAATATAGGAGCAGGTACTGGTTGAACAGTTTATCCACCATTATCTTTATTAATAGGTCATAGTGGAATTTCTGTTGATTTATCAATTTTTTCTTTACATTTAGCAGGTATATCTTCTATTATAGGTTCAATTAATTTTATTGTTACTATTATTAATACATGAATATTAATAAATTATATAGATAAATATCCTTTATTTGTATGATCAGTATTTATTACTACAATTTTATTATTATTATCTTTACCAGTTTTGGCTGGTGCTATTACAATGTTATTAAGAGATCGAAATTTAAATACAAGATTTTTTGATCCATCAGGAGGAGGTGATCCAGTGTTATATCAACATTTATTT.

Holotype ♂

Guanacaste, Sector El Hacha, Estación Los Almendros, 11.032, -85.528, 290 meters, caterpillar collection date: 01/iv/2011, wasp eclosion date: 08/v/2011. Depository: CNC.

Host data. Herpetogramma phaeopteralis (Crambidae) feeding on Scleria latifolia (Cyperaceae).

Caterpillar and holotype voucher codes. 10-SRNP-4459, DHJPAR0048100.

Paratypes

None.

Etymology

Chelonus jesusugaldei is named to honor Sr. Jesus Ugalde for his many years of dedicated administrative support to the national biodiversity inventory under way by INBio, the National Biodiversity Institute of Costa Rica, the collection from which now resides in the Museo Nacional de Costa Rica.

Figure 105. 

Chelonus jesusugaldei, holotype.

Chelonus jimlewisi Sharkey, sp. nov.

Figure 106

Diagnostics

BOLD:AAF2610. Consensus barcode. TATATTATATTTTTTATTTGGAATTTGATCAGGCATATTAGGATTATCTTTAAGTTTAATAATTCGTATAGAACTAAGTAGGGTTATAAGATTATTTTATAATGATCAGTTATATAATAGGATTGTAACTATACATGCATTTGTAATAATTTTTTTTATAGTTATACCAGTAATAATTGGTGGATTTGGRAATTGATTAATTCCTTTAATATTAGGCTTATCTGATATAATTTTCCCTCGAATAAATAACATAAGATTTTGATTATTATTACCTTCAATTTTTTTATTAATTATAGGAGGATTTGTTAATATGGGGGCAGGAACTGGTTGAACRGTTTATCCACCATTATCTCTAATAATGGGACATAGGGGAATTTCTGTAGATTTATCAATTTTTTCTTTACATTTAGCAGGCATATCTTCAATTATAGGATCAATTAATTTTATTGTAACTATTATTAATACTTGATTGATTTATAATTATATGGATAAATATCCTTTATTTGTATGATCAGTATTTATTACTACAATTTTATTATTATTATCTTTACCAGTATTAGCTGGGGCTATTACTATATTATTAAGAGATCGAAATTTAAATACTAGGTTTTTTGATCCTTCAGGGGGAGGAGACCCAGTTTTATATCAACATTTRTTT.

Holotype ♀

Alajuela, Sector Rincon Rain Forest, Palomo, 10.962, -85.28, 96 meters, caterpillar collection date: 16/x/2012, wasp eclosion date: 01/xi/2012. Depository: CNC.

Host data. Neoleucinodes Janzen02 (Crambidae) feeding on Heliconia irrasa (Heliconiaceae).

Caterpillar and holotype voucher codes. 12-SRNP-68630, DHJPAR0051336.

Other material

Several specimens that were not examined but that are in BOLD (e.g., DHJPAR0054551) and in the Janzen and Hallwachs database are recorded from Neoleucinodes alegralis (Crambidae). Depository: CNC.

Etymology

Chelonus jimlewisi is named to honor Dr. Jim Lewis for his years of dedicated taxonomic and curational support, especially with Hemiptera, of the INBio collection now deposited in the Museo Nacional de Costa Rica.

Figure 106. 

Chelonus jimlewisi, holotype.

Chelonus jimmilleri Sharkey, sp. nov.

Figure 107

Diagnostics

BOLD:ADM8275. Consensus barcode. TATATTATATTTTTTATTTGGAATTTGATCTGGTATATTAGGATTATCTTTAAGATTAATAATTCGTATAGAATTAAGAAGAGTAATAAGATTATTTTATAATGATCAATTATATAATAGTATTGTTACTATACATGCATTTGTAATAATTTTTTTTATGGTTATACCAGTAATAATTGGGGGATTTGGGAATTGGTTAGTTCCTTTAATATTAGGATTATCTGATATAATTTTTCCTCGAATAAATAATTTAAGATTTTGGTTGTTAGTGCCTTCAATTATTTTATTAATTATAGGTGGATTTGTAAATATGGGTGCAGGAACTGGTTGAACAGTTTATCCTCCATTATCTTTATTAATAGGTCATAGAGGAATTTCTGTTGATTTATCAATTTTTTCTTTACATTTGGCTGGTATATCTTCAATTATAGGTTCAATTAATTTTATTGTAACTATTATTAATACTTGATTAATAATTAATTATATAGATAAATATCCTTTATTTGTATGATCAGTATTTATTACTACAATTTTATTATTATTATCTTTACCAGTGTTAGCTGGTGCTATTACAATATTATTAAGAGATCGTAATTTAAATACTAGATTTTTTGATCCTTCAGGAGGGGGAGATCCAGTTTTATATCAGCATTTATTT.

Holotype ♀

Alajuela, Sector Rincon Rain Forest, Palomo, 10.9619, -85.2804, 96 meters, caterpillar collection date: 02/xi/2017, wasp eclosion date: 07/xii/2017. Depository: CNC.

Host data. Antaeotricha Janzen78 (Depressariidae) feeding on Hylaeanthe hoffmannii (Marantaceae).

Caterpillar and holotype voucher codes. 17-SRNP-46525, DHJPAR0062576.

Paratypes

Host = Antaeotricha Janzen78: DHJPAR0062577, DHJPAR0062578. Depository: CNC.

Etymology

Chelonus jimmilleri is named to honor Dr. Jim Miller of the American Museum of Natural History for his years of enthusiasm for taxonomic and biodiversity support for understanding the Notodontidae of Costa Rica and those also working on its taxonomy.

Figure 107. 

Chelonus jimmilleri, holotype.

Chelonus jimwhitfieldi Sharkey, sp. nov.

Figure 108

Diagnostics

BOLD:ACC1273. Consensus barcode. TATATTATATTTTATATTTGGAATATGATGTGGGATTTTAGGTTTATCTTTAAGATTGATGATTCGGATAGAGTTAAGAAGTGTAATGAGTTTATTTTCTAATGATCAATTATATAATAGGATTGTCACTATACATGCTTTTGTAATAATTTTTTTTATGGTTATACCAATTATAATTGGCGGATTTGGAAATTGGTTAATTCCATTAATATTAGGATTATCAGATATGATTTTTCCTCGGATAAATAATATAAGATTTTGATTATTGGTTCCTTCAATTATATTATTAATTATAAGAGGATTTGTGAATATGGGAGCAGGGACTGGGTGGACTGTGTATCCTCCTTTGTCGTTGTTGATAGGTCATAGAGGTATTTCAGTAGATTTATCTATTTTTTCTTTGCATTTGGCAGGAGTTTCTTCAATTATAGGCTCAATTAATTTTATTGTAACTATTGTTAGTACTTGAATAAGTTTAAAATATATAGATAAATATTCGTTATTTGTTTGATCTGTGTTTATTACTACTATTTTATTATTATTATCTTTACCAGTGTTAGCTGGGGCAATTACTATATTATTAAGTGATCGAAATTTAAATACAAGTTTTTTTGATCCTTCTGGTGGGGGAGATCCTGTATTATATCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Pitilla, Medrano, 11.016, -85.381, 380 meters, caterpillar collection date: 22/viii/2012, wasp eclosion date: 13/ix/2012. Depository: CNC.

Host data. Prenesta scyllalis (Crambidae) feeding on Forsteronia spicata (Apocynaceae).

Caterpillar and holotype voucher codes. 12-SRNP-72051, DHJPAR0050070.

Paratype

Host = Prenesta scyllalisDHJ01: DHJPAR0050073. Depository: CNC.

Etymology

Chelonus jimwhitfieldi is named to honor Dr. Jim Whitfield of the University of Illinois for his decades of mentorship to DHJ about Braconidae taxonomy and stimulus for their collection and rearing from ACG, while carrying out many braconid taxonomic projects for ACG specimens.

Figure 108. 

Chelonus jimwhitfieldi, holotype.

Chelonus johanvalerioi Sharkey, sp. nov.

Figure 109

Diagnostics

BOLD:AAF2611. Consensus barcode. TATATTATATTTTATATTTGGAATTTGGKSCGGCATATTAGGYTTATCATTAAGATTAATAATTCGTATAGAATTAAGAAGTGTAATAAGATTATTTTATAATGATCAATTGTATAATAGAATTGTAACAATACATGCTTTTGTTATAATTTTTTTTATAGTTATGCCAGTGATAATTGGAGGATTTGGTAATTGGTTGGTTCCTTTAATATTAGGGTTATCAGATATAATTTTTCCTCGTATAAATAATATAAGATTTTGGTTACTAATTCCTTCAATTATTTTATTAATTATGGGTGGTTTTGTAAATATAGGGGCAGGTACAGGTTGGACAGTTTATCCACCTTTATCTCTATTAAGAAGACATAGAGGAATTTCGGTGGATTTATCTATTTTTTCTTTGCATTTAGCAGGGGCTTCTTCAATTATAGGGTCTATTAATTTTATTATTACTATTATTAATACATGGATAGTGTTAAGTAACATAGATAAATATTCTTTATTTGTTTGATCTGTTTTTATTACAACAATTTTATTGTTATTATCTTTGCCTGTTTTAGCAGGGGCTATYACTATATTATTAAGTGACCGAAATTTAAATACTAGTTTTTTTGATCCTTCTGGAGGGGGTGAYCCAGTGTTGTACCAACATTTATTT.

Holotype ♂

Guanacaste, Sector San Cristobal, Tajo Angeles, 10.865, -85.415, 540 meters, caterpillar collection date: 19/viii/2010, wasp eclosion date: 13/ix/2010. Depository: CNC.

Host data. Ceratocilia Janzen02 (Crambidae) feeding on Cosmibuena grandiflora (Rubiaceae).

Caterpillar and holotype voucher codes. 10-SRNP-4589, DHJPAR0042090.

Paratypes

Hosts = Ceratocilia Janzen02, Phostria latiapicalis, Pilocrocis purpurascens (all Crambidae). DHJPAR0029142, DHJPAR0036388, DHJPAR0036728, DHJPAR0039119, DHJPAR0042087, DHJPAR0042092, DHJPAR0048106, DHJPAR0052096, DHJPAR0055381, DHJPAR0055397, DHJPAR0055398, DHJPAR0055951, DHJPAR0056967, DHJPAR0057408, DHJPAR0057409. Depository: CNC.

Etymology

Chelonus johanvalerioi is named to honor Sr. Johan Valerio of ICE for his many years of mentorship of DHJ for the ACG-ICE-GDFCF project to biomonitor PL12 in Pailas II and the new ICE road crossing Sector Mundo Nuevo of ACG.

Figure 109. 

Chelonus johanvalerioi, holotype.

Chelonus johnburnsi Sharkey, sp. nov.

Figure 110

Diagnostics

BOLD:ACJ4065. Consensus barcode. AATATTATATTTTATTTTTGGTATATGGGCAGGTATAATAGGTTTATCATTAAGAATAATGATTCGAATGGAATTAAGAAGTGTTATGAGATTATTTTTTAGGGATCAATTATATAATAGATTAGTAACTATACATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGGTTGGTGCCATTGATATTGGGTTTATCAGATATAATTTTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTATTTTTATTAATTATAGGTGGATTTGTAAATACAGGGGCTGGTACAGGATGAACTGTTTATCCTCCATTATCTTTATTAATAGGTCATGGAGGAGTTTCAGTTGATTTATCAATTTTTTCTTTACATTTAGCTGGTGCATCATCTATTATAGGATCTATAAATTTTATTGTTACTATTTTAAATACATGAATAAAATTAAAGTATATAGATAAATTTTCATTATTTATTTGGTCAGTATTAATTACTACTATTTTATTACTTTTGTCATTGCCTGTATTAGCTGGGGCAATTACAATATTGTTAAGAGATCGTAATTTAAATACTAGATTTTTTGATCCTTCAGGAGGGGGGGACCCTGTATTATATCAACATTTATTT.

Holotype ♂

Alajuela, Sector Rincon Rain Forest, Palomo, 10.962, -85.28, 96 meters, caterpillar collection date: 02/i/2013, wasp eclosion date: 05/ii/2013. Depository: CNC.

Host data. Spilomela pantheralis (Crambidae) feeding on Celtis iguanaea (Ulmaceae).

Caterpillar and holotype voucher codes. 13-SRNP-67036, DHJPAR0051324.

Paratypes

None.

Etymology

Chelonus johnburnsi is named to honor Dr. John Burns of the Smithsonian Institution for his decades of taxonomic projects and mentorship of DHJ and WH about the Hesperiidae of ACG, as well as happily accepting their DNA barcoding as part of their taxonomic discovery.

Figure 110. 

Chelonus johnburnsi, holotype.

Chelonus johnnoyesi Sharkey, sp. nov.

Figure 111

Diagnostics

BOLD:ACF7386. Consensus barcode. AATATTATATTTTATTTTTGGTATTTGATGTGGAGTTTTAGGTTTATCTTTAAGTTTATTAATTCGTATGGAATTAAGAAGGGTAATAAGTTTATTTATAAATGATCAATTGTATAATAGAGTTGTTACTATGCATGCTTTTGTAATAATTTTTTTTATGGTTATACCAGTTATAGTTGGTGGGTTTGGAAATTGATTAGTACCTTTAATATTAGGGCTATCTGATATAATTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTATTTCCTTCAATTATTTTATTAGTTATAGGTGGATTTATTAATATGGGGGTTGGAACAGGGTGAACTGTTTATCCCCCATTATCTTTAATGATGGGTCATAGGGGGATTTCCGTTGATTTATCAATTTTTTCTTTACATTTGGCTGGGATATCGTCAATTATAGGTTCTATTAATTTTATTGTTACAACAATTAATACATGATTAAAGGTTACTTATATAGATAAATATTCATTATTTATTTGATCTATTTTTATTACTACAATTTTATTGTTATTATCTTTACCTGTCTTAGCTGGGGCAATTACTATATTATTAAGTGATCGAAATTTAAATACTAGATTTTTTGATCCTTCAGGAGGAGGAGA--------.

Holotype ♀

Guanacaste, Sector Santa Rosa, Bosque San Emilio, 10.8438, -85.6138, 300 meters, 11-18/vi/2012, Malaise trap. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG05181-G09.

Paratypes

None.

Etymology

Chelonus johnnoyesi is named to honor Dr. John Noyes of The Natural History Museum, London, for his decades of enthusiastic support and actions with the taxonomy of Encyrtidae wasps of Costa Rica in general, and specifically for INBio and ACG.

Figure 111. 

Chelonus johnnoyesi, holotype.

Chelonus jorgebaltodanoi Sharkey, sp. nov.

Figure 112

Diagnostics

BOLD:ACK4767. Consensus barcode. AATTCTTTATTTCATTTTTGGGATTTGATCTGGTGTAATAGGGTTATCTTTAAGTTTATTAATTCGTATGGAAYTAAGGAGAGTAATAAGATTAYTTATAAATGATCAATTATATAATAGTATTGTTACTATACATGCTTTTATTATAATTTTTTTTATGGTTATACCTGTAATAGTTGGGGGATTCGGAAATTGATTAATTCCTTTAATATTAGGTTTATCTGATATAATTTTTCCTCGTATAAATAATTTAAGATTTTGATTACTGATTCCATCAATTATTTTATTAYTATTAGGAGGYTTTACTAATACAGGGGCTGGAACAGGATGAACTGTGTATCCTCCATTATCTTTAATAATAGGACATAGAGGAATTTCAGTTGATTTGTCAATYTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATAGGATCTATTAATTTTATTGTAACAACAATTAATACATGATTAAAAATAACTAAYATAGATAAATATTCTTTATTTGTATGATCTATTTTTATCACTACAATTTTACTTTTATTATCTTTACCAGTTTTAGCYGGGGCAATTACTATATTATTAAGAGATCGAAATTTAAATACTAGGTTTTTTGATCCTTCTGGTGGTGGGGACCCTGTATTATACCAGCATTTATTT.

Holotype ♀

Guanacaste, Pailas Dos, PL12-2, 10.7634, -85.335, 824 meters, 10‒17/iv/2014, Malaise trap PL12-2A. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG30966-F11.

Paratypes

Both Malaise-trapped. BIOUG08913-A09, BIOUG28821-H05. Depository: CNC.

Etymology

Chelonus jorgebaltodanoi is named to honor Sr. Jorge Baltodano (RIP) for his many years as a neighboring collaborator with ACG and for accepting the challenge of being the first President of the Comité Local for ACG; part of his ranch is now a permanent part of ACG thanks to his foresight and spirit for conservation.

Figure 112. 

Chelonus jorgebaltodanoi, holotype.

Chelonus jorgehernandezi Sharkey, sp. nov.

Figure 113

Diagnostics

BOLD:ADB2931. Consensus barcode. ATTCTTTATTTCATTTTTGGGATTTGATCTGGTRTAATAGGGTTATCTTTAAGTTTACTAATTCGTATGGAACTAAGAAGAGTAATAAGGTTACTTATAAATGATCAATTATATAATAGTATCGTTACTATGCATGCTTTTATTATAATTTTTTTTATGGTTATGCCTGTAATAGTTGGTGGATTTGGTAATTGATTAATTCCTTTAATATTAGGTTTATCTGATATAATTTTCCCCCGTATAAATAATTTAAGATTTTGATTATTGATTCCGTCAATTATTTTATTATTATTAGGAGGTTTTATTAATAYAGGGGCTGGAACAGGATGAACTGTGTATCCTCCATTATCTTTAATAATAGGACATAGAGGAATTTCAGTTGATTTGTCAATTTTTTCTTTGCATTTAGCTGGAGYTTCTTCTATTATAGGATCTGTTAATTTTATTGTAACAACAATTAATACATGATTAAAAATAACTAATATAGATAAATATTCTTTATTTGTATGATCTATTTTTATTACCACAATTTTACTTTTATTATCTTTACCAGTTTTAGCTGGGGCAATCACTATATTATTAAGAGACCGAAATTTAAATACTAGGTTTTTT.

Holotype ♀

Guanacaste, Pailas Dos, PL12-3, 10.7631, -85.3344, 820 meters, 05‒12/xii/2013, Malaise trap PL12-3A. Depository: CNC.

Host data. None.

Holotype voucher codes: BIOUG29282-F08.

Paratype

Malaise-trapped. BIOUG29803-C11. Depository: CNC.

Etymology

Chelonus jorgehernandezi is named to honor Sr. Jorge Hernandez of GDFCF and ACG for his many years as a dedicated inventory parataxonomist for ACG.

Figure 113. 

Chelonus jorgehernandezi, holotype.

Chelonus josealfredohernandezi Sharkey, sp. nov.

Figure 114

Diagnostics

BOLD:ADC6444. Consensus barcode. AATTCTTTATTTTATTTTTGGAATTTGATCTGGTATAATAGGGTTATCTTTAAGTTTATTAATTCGTATGGAATTA---AGAAGAGTAACAAGGTTATTTATAAATGATCAATTATATAATAGTATTGTTACTATACATGCTTTTGTAATAATTTTTTTTATAGTTATACCTGTAATAGTAGGTGGATTTGGAAATTGATTAATTCCTTTAATATTAGGTTTGTCCGATATAATTTTTCCTCGTATGAATAATTTAAGATTTTGATTATTGATTCCATCAATTATTTTATTAATAATAGGAGGTTTTATTAATATAGGGGCTGGAACGGGATGAACTGTTTATCCCCCATTATCATTAATAATAGGACATAGGGGAATTTCAGTTGATTTATCAATTTTTTCTTTACATTTAGCTGGGGCTTCTTCTATTATAGGGTCAATTAATTTTATTGTTACAGTGATTAATACATGATTAAAAATAACTAATATAGATAAATATTCTTTATTTGTTTGATCTATTTTTATCACTACAATTTTACTTTTATTATCTTTACCAGTTTTAGCTGGAGCTATTACAATATTATTAAGAGACCGAAATTTAAATACTAGATTTTTTGATCCTTCGGGTGGGGGAGATCC-------.

Holotype ♀

Guanacaste, Pailas Dos, PL12-9, 10.76, -85.3341, 809 meters, 15‒22/v/2014, Malaise trap PL12-9A. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG29216-H07.

Paratypes

None.

Etymology

Chelonus josealfredohernandezi is named to honor Sr. Jose Alfredo Hernandez of CONAGEBIO for his deep understanding and advising for the Costa Rican government permits for BioAlfa bioinventory.

Figure 114. 

Chelonus josealfredohernandezi, holotype.

Chelonus josefernandeztrianai Sharkey, sp. nov.

Figure 115

Diagnostics

BOLD:ACJ1335. Consensus barcode. AATTTTGTATTTTATTTTTGGAATATGATCAGGGATAATAGGATTATCATTAAGGTTATTAATTCGAATAGAATTAAGTATTGTGGGTAGATTATTTATAAATGATCAGTTATATAATAGAATTGTAACAATACATGCATTTATTATAATTTTTTTTATAGTCATACCAATTATAATTGGTGGTTTTGGGAATTGATTAATTCCTTTAATATTAGGATTACCAGATATAATTTTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCAATTATTTTATTAATTATAGGGGGATTTGTAAATATAGGAGTTGGAACTGGTTGAACTGTATATCCACCTTTATCTTTATTAATAAGACATAGAGGTATTTCAGTAGATTTATCAATTTTTTCTTTGCATTTAGCTGGGATATCTTCAATTATAGGGTCTATTAATTTTATTGTTACAATTTTAAATACATGAATAAATAAAAAAATGATAGATAAATTTCCTTTATTTGTTTGATCAGTATTTATTACAACAATTTTATTATTATTATCTTTACCAGTTTTAGCTGGAGCAATTACAATGTTGTTAAGTGATCGAAATTTAAATACAAGATTTTTTGATCCTTCTGGTGGAGGAGATCCAGTATTATATCAACATTTATTT------.

Holotype ♂

Guanacaste, Sector Santa Rosa, Bosque San Emilio, 10.8438, -85.6138, 300 meters, 02‒09/iv/2012, Malaise trap. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG07458-A09.

Paratypes

None.

Etymology

Chelonus josefernandeztrianai is named to honor Dr. José Fernandez-Triana for his many years of mentoring and taxonomic applications to the bioinventory of the Microgastrinae, Braconidae, of ACG.

Figure 115. 

Chelonus josefernandeztrianai, holotype.

Chelonus josehernandezcortesi Sharkey, sp. nov.

Figure 116

Diagnostics

BOLD:ACR6579. Consensus barcode. ATATTATATTTTATTTTTGGTATATGATCTGGAATATTAGGTTTATCATTAAGTTTATTAATTCGAATAGAATTAAGAATTACGGGTAGATTATTTATAAATGATCAATTATATAATAGAATTGTAACTATACATGCTTTTATTATAATTTTTTTTATGGTTATACCAATTATAATTGGTGGTTTTGGGAATTGACTAATTCCACTAATATTAGGTTTACCTGATATGATTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATACCTTCGTTATTATTGTTATTATTAGGAGGATTTGTAAATATAGGAGTAGGAACAGGTTGAACAGTTTATCCACCATTATCTTTATTAATAGGTCATAGTGGAATTTCAGTTGATTTATCAATTTTTTCTTTACATTTAGCTGGGGCATCTTCAATTATAGGATCAATTAATTTTATTGTAACAATTATTAATACATGAATAAATAATAAATTTATAGATAAATTTCCATTATTTGTTTGATCAGTATTTATTACTACAATTTTGTTATTATTATCTTTACCAGTATTAGCTGGTGCAATTACAATATTATTAAGTGATCGAAATTTAAAT.

Holotype ♀

Guanacaste, Pailas Dos, PL12-3, 10.7631, -85.3344, 820 meters, 13‒20/ii/2014, Malaise trap PL12-3A. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG29681-C10.

Paratype

Malaise-trapped. BIOUG17842-H09. Depository: CNC.

Etymology

Chelonus josehernandezcortesi is named to honor Sr. José Hernandez of GDFCF and ACG for his many years as a dedicated inventory parataxonomist for ACG.

Figure 116. 

Chelonus josehernandezcortesi, holotype.

Chelonus josemanuelperezi Sharkey, sp. nov.

Figure 117

Diagnostics

BOLD:ACZ8757. Consensus barcode. AATATTATATTTTTTATTTGGTTTATGAAGAGGAATTTTAGGTTTGTCATTAAGTTTGTTAATTCGTATAGAATTAAGAATAGTTGGTAGATTATTTATAAATGATCAGCTATATAATAGAATTGTAACTATACATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGGTTATCAGATATAATTTTTCCACGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCTATTTTGTTATTAATTATAGGAGGATATGTGGGAACAGGGGTAGGTACTGGTTGAACTGTTTATCCACCTTTATCTTTATTAATTGGCCATAGTGGAATTTCTGTAGATTTATCTATTTTTTCTTTACATTTAGCTGGAGTATCATCAATTATGGGATCTGTAAATTTTATTGTTACTATTATAAATACTTGAATAGAAAAAATAAACATGGATAAATATTCTTTATTTATTTGATCTGTTTTTATTACTACTATTTTATTATTATTATCTTTACCTGTGTTAGCAGGTGCTATTACTATATTATTAAGTGATCGTAATTTGAATACAAGATTTTTTGATCCTTCAGGTGGGGGGGATCCAGTATTATATCAACATTTATTT.

Holotype ♀

Guanacaste, Sector San Cristobal, Estación San Gerardo, 10.88, -85.389, 575 meters, 29/xii/2014‒05/i/2015, Malaise trap. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28039-F05.

Paratypes

All Malaise-trapped. BIOUG27759-B05, BIOUG28037-E12, BIOUG28039-G01. Depository: CNC.

Etymology

Chelonus josemanuelperezi is named to honor Sr. Jose Manuel Perez of GDFCF and ACG for his many years as a dedicated inventory parataxonomist for ACG.

Figure 117. 

Chelonus josemanuelperezi, holotype.

Chelonus josephinerodriguezae Sharkey, sp. nov.

Figure 118

Diagnostics

BOLD:ADG0772. Consensus barcode. ATATTATATTTCATTTTTGGTTTATGAAGCGGAATTTTAGGTTTATCATTAAGTTTATTAATTCGAATAGAATTAAGAATAGTAGGAAGTTTATTTTTAAATGATCAATTATATAATAGAATTGTAACAATACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGGAATTGATTAGTTCCATTAATATTAGGATTATCTGATATAATTTTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTATTATTAATTTTAGGAAGATATGTAGGTACTGGAGCAGGAACAGGATGAACTGTATATCCACCATTATCTTTATTAATAGGTCATAGAGGAATATCTGTAGATTTATCAATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATTATAGGTTCAATTAATTTTATTGTGACAATTATAAATACTTGAATATTAAAAAAAAATATAGATAAATATTCATTATTTATTTGATCTGTTTTTATTACAACTATTTTATTGTTATTATCTTTACCTGTATTAGCTGGTGCAATTACAATATTATTAAGTGATCGTAAT----------------------------.

Holotype ♀

Guanacaste, Sector Cacao, Derrumbe, 10.9292, -85.4643, 1220 meters, 25/xii/2014‒01/i/2015, Malaise trap. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG31680-G05.

Paratypes

None.

Etymology

Chelonus josephinerodriguezae is named to honor Dr. Josephine Rodriguez of the University of Virginia’s College at Wise, for her intense collaboration and taxonomy of ACG Microgastrinae as part of the ACG ongoing Biodiversity Inventory.

Figure 118. 

Chelonus josephinerodriguezae, holotype.

Chelonus juanmatai Sharkey, sp. nov.

Figure 119

Diagnostics

BOLD:ABY3313. Consensus barcode. AATATTATATTTTTTATTTGGTTTATGAAGAGGAATTTTAGGTTTGTCATTAAGTTTGTTAATTCGTATAGAATTAAGAATAGTTGGTAGATTATTTATAAATGATCAGCTATATAATAGAATTGTAACTATACATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGGTTATCAGATATAATTTTTCCACGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCTATTTTGTTATTAATTATAGGAGGATATGTGGGAACAGGGGTAGGTACTGGTTGAACTGTTTATCCACCTTTATCTTTATTAATTGGCCATAGTGGAATTTCTGTAGATTTATCTATTTTTTCTTTACATTTAGCTGGAGTATCATCAATTATGGGATCTGTAAATTTTATTGTTACTATTATAAATACTTGAATAGAAAAAATAAACATGGATAAATATTCTTTATTTATTTGATCTGTTTTTATTACTACTATTTTATTATTATTATCTTTACCTGTGTTAGCAGGTGCTATTACTATATTATTAAGTGATCGTAATTTGAATACAAGATTTTTTGATCCTTCAGGTGGGGGGGATCCAGTATTATATCAACATTTATTT.

Holotype ♂

Alajuela, Sector San Cristobal, Finca San Gabriel, 10.878, -85.393, 645 meters, caterpillar collection date: 13/viii/2011, wasp eclosion date: 29/viii/2011. Depository: CNC.

Host data. immidjanzen01 Janzen23 (Immidae) feeding on Pentagonia donnell-smithii (Rubiaceae).

Caterpillar and holotype voucher codes. 11-SRNP-3192, DHJPAR0048103.

Paratypes

None.

Etymology

Chelonus juanmatai is named to honor Sr. Juan Mata for his outstanding laboratory photography contributions to the INBio, MN, and BioAlfa taxonomy publications from BioAlfa and his interest in Mantodea.

Figure 119. 

Chelonus juanmatai, holotype.

Chelonus junkoshimurae Sharkey, sp. nov.

Figure 120

Diagnostics

BOLD:AAF2633. Consensus barcode. AATATTATATTTTATTTTTGGTATATGATGTGGTATACTTGGATTATCATTAAGTATATTAATTCGAATAGAATTAAGTATAGTTTCAAGTTTATTAATAAATGATCAATTATATAATAGAATTGTTACAATACATGCATTTGTAATAATTTTTTTTATGGTTATACCARTTATAATTGGTGGATTTGGGAATTGGTTAATTCCATTAATATTAGGATTATCAGATATAATATTTCCACGAATAAATAATATAAGATTTTGATTGTTAGTACCGTCAATTATATTATTAATTTTAAGAGGTTTTATTAATACTGGTGTTGGAACTGGATGAACAGTTTATCCCCCATTATCTTTATTAATAGGTCATGGGGGAATTTCTGTAGATTTATCAATTTTTTCTTTACATTTAGCAGGGGCTTCATCAATTATAGGTTCAATTAATTTTATTGTTACAGTAATAAATTCTTGAATAAAATTAAGTTATATAGATAAATTTGCTTTATTTGTTTGATCAGTTTTTATTACAACAATTTTATTATTATTATCTTTACCGGTATTAGCAGGAGCTATTACTATATTATTAAGGGATCGAAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGAGATCCTGTATTATATCAACATTTATTT.

Holotype ♂

Guanacaste, Sector Orosi, Maderos, 11.005, -85.475, 510 meters, caterpillar collection date: 19/vi/2010, wasp eclosion date: 07/vii/2010. Depository: CNC.

Host data. Diaphania hyalinataDHJ02 (Crambidae) feeding on Gurania makoyana (Cucurbitaceae).

Caterpillar and holotype voucher codes. 10-SRNP-21385, DHJPAR0040366.

Paratypes

Hosts = Diaphania hyalinataDHJ01, Diaphania hyalinataDHJ02. BIOUG17755-H07, DHJPAR0021626, DHJPAR0029175, DHJPAR0029176, DHJPAR0039504, DHJPAR0040367, DHJPAR0040373, DHJPAR0040374. Depository: CNC.

Etymology

Chelonus junkoshimurae is named to honor Sra. Junko Shimura of the Convention for Biological Diversity for her biopolitical support of BioAlfa and conservation of tropical biodiversity.

Figure 120. 

Chelonus junkoshimurae, holotype.

Chelonus kateperezae Sharkey, sp. nov.

Figure 121

Diagnostics

BOLD:ACR8387. Consensus barcode. TATTTTATGTTTGGTATATGATCAGGTATATTAGGTTTATCTTTAAGATTAATTATTCGAATAGAATTAGGAACTTTAAAAACTTTATTGTTTAATGATCAATTATATAATAGATTAGTTACTTTACATGCTTTTGTAATAATTTTTTTTATGGTTATGCCAGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGTTTATCAGATATATTATTTCCACGTATAAATAATATAAGTTTTTGATTATTAGTGCCATCAATGATTTTATTATTAATAAGTGGTTTTGTAAATGTTGGAGTTGGTACAGGTTGAACGGTTTATCCTCCTTTATCTTCTTTAATTGGTCATAGGGGTGTATCGGTTGATATATCGATTTTTTCTTTACATTTAGCAGGGATATCATCAATTATGGGAGCAATTAATTTTATTGTAACTGTTATAAATACTTGATTAAAATATAATTTTATAGATAAATTTCCTTTATTTGTTTGATCAGTGTATATTACAGCTATTTTATTATTATTGTCTTTACCAGTTTTAGCAGGGGCTATTACTATATTGTTAAGGGAT---------------------------------------------------.

Holotype ♀

Guanacaste, Sector Santa Rosa, Bosque San Emilio, 10.8438, -85.6138, 300 meters, 04‒11/vi/2012, Malaise trap. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG17967-C10.

Paratypes

None.

Etymology

Chelonus kateperezae is named to honor Ms. Kate Perez for her many years laboring in execution and administration of the field and laboratory actions performed by the Centre for Biodiversity Genomics to rapidly and accurately DNA barcode tens of thousands of Costa Rican insects from Malaise traps installed by ACG and BioAlfa.

Figure 121. 

Chelonus kateperezae, holotype.

Chelonus luciariosae Sharkey, sp. nov.

Figure 122

Diagnostics

BOLD:ACM2853. Consensus barcode. TACTTTATATTTAATTTTTGGTATATGATCAGGTATATTTGGTTTATCTTTAAGTTTATTAATTCGTTTAGAATTAAGTGGATTAATAAGATTTTTTAATAATGATCAATTATATAATAGAATAATTACTTTACATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATAGGTGGTTTTGGAAATTGATTAATTCCAATAATATTGGGTTTAATAGATATAGCTTTTCCTCGATTAAATAATTTAAGGTTTTGATTATTAATTCCTTCAATTATATTATTAGTTATAAGTAGATTTGTAAATAGTGGTTCTGGTACAGGTTGAACAGTTTATCCTCCATTATCTTCATTAATAGGTCATGGGGGGGTATCAGTAGATATAACTATTTTTTCTTTACATTTAGCAGGTGTGTCTTCAATTTTAAGATCAATTAATTTTATTGTAACTATTTTAAATAGTTGAATAAATGTAAAGTATATAGATAAATTTCCTTTATTTATTTGATCTGTTTTTCTTACAGCAATTTTATTATTATTATCTTTACCTGTATTAGCAGGGGCAATTACTATATTATTAAGAGATCGAAATATAAATACTAGATTTTTTGATTCTTCAGGAGGAGGTGATCCTATTTTGTATCAGCATTTATTT.

Holotype ♂

Alajuela, Sector San Cristobal, Jardin Estrada, 10.865, -85.397, 722 meters, caterpillar collection date: 30/xii/2013, wasp eclosion date: 24/i/2014. Depository: CNC.

Host data. chryBioLep01 BioLep174 (Pyralidae) feeding on Mansoa hymenaea (Fabaceae).

Caterpillar and holotype voucher codes. 13-SRNP-7596, DHJPAR0054557.

Paratypes

Host = chryBioLep01: BioLep174, DHJPAR0054549, DHJPAR0054550, DHJPAR0054552, DHJPAR0054555, DHJPAR0054559, DHJPAR0054561, DHJPAR0054563, DHJPAR0054567, DHJPAR0054782. Depository: CNC.

Etymology

Chelonus luciariosae is named to honor Sra. Lucia Rios of GDFCF and ACG for her many years as a dedicated inventory parataxonomist for ACG.

Figure 122. 

Chelonus luciariosae, holotype.

Chelonus luzmariaromeroae Sharkey, sp. nov.

Figure 123

Diagnostics

BOLD:AAM1444. Consensus barcode. GACATTATATTTTTTATTTGGTATATGATCAGGGTTTTTTGGTTTATCATTAAGAATATTAATTCGTATAGAATTAAGTTCTTTAGGTAGATTATTAATAAATGATCAATTGTATAATAGAATTGTAACTATGCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGGATAGTTCCTTTAATGTTAGGTATATGTGATATAATATTTCCTCGAATAAATAATATAAGATTTTGGATATTAATACCTTCTTTAATAATATTAATTTTAGGAAGGTTAGTAAATATGGGTGTTGGGACAGGATGAACAGTTTATCCTCCTTTATCTTTATTAATAGGACATGGGGGGATYTCTTTAGATTTATCAATTTTTTCTTTACATTTAGCAGGGATTTCTTCAATTTTAGGTTCTATTAATTTTATTGTAACTATTTTAAATACTTGRATAGAAAAAAAATTTTTGGATATATTTCCTTTATTTATTTGATCAGTATTTATTACAACAATTTTATTATTATTATCATTACCAGTATTAGCTGGCGCAATTACTATACTTTTAAGTGATCGTAATTTAAATACAAGATTTTTTGATCCTGCTGGTGGAGGGGATCCTGTATTATATCAACATTTATTT.

Holotype ♂

Alajuela, Sector San Cristobal, Tajo Angeles, 10.865, -85.415, 540 meters, caterpillar collection date: 12/viii/2011, wasp eclosion date: 28/viii/2011. Depository: CNC.

Host data. Dichomeris Janzen703 (Gelechiidae) feeding on Koanophyllon hylonoma (Asteraceae).

Caterpillar and holotype voucher codes. 11-SRNP-3178, DHJPAR0048167.

Paratypes

Hosts = Dichomeris Janzen703, Dichrorampha Janzen322. DHJPAR0037974, DHJPAR0037975. Depository: CNC.

Etymology

Chelonus luzmariaromeroae is named to honor Sra. Luz Maria Romero for her decades of conducting and developing the ACG Biological Education Program, followed by more than a decade of mentoring the parataxonomists as to how to better manage and polish their field databases and their Species Pages on the ACG web site.

Figure 123. 

Chelonus luzmariaromeroae, holotype.

Chelonus manuelpereirai Sharkey, sp. nov.

Figure 124

Diagnostics

BOLD:ACP7116. Consensus barcode. AACATTATATTTTTTATATGGAATATGATCTGGATTTTTTGGTCTATCACTAAGTATATTAATTCGAATAGAATTAAGATCTTTAGGAAGATTTTTATTAAATGATCAATTATATAATAGAATTGTTACAATACATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAGTAGGTGGTTTTGGAAATTGAATAGTTCCTATAATATTAGGTTTACCAGATATAATTTTTCCACGAATAAATAATTTAAGATTTTGATTATTAATTCCATCATTAATTTTATTAATTTTAAGTAGTTTAGTTAATTCAGGAGTTGGTACAGGTTGAACCGTTTATCCACCTTTATCATTATTAATAGGTCATAGAGGAATTTCAGTTGATTTATCAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTTTAGGATCAATTAATTTTATTGTAACTACATTAAATACTTGAATAAAAAAAAATATTATAGATACTTATCCATTATTTATTTGATCAATTTTTATTACTACAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCAATTACAATATTATTAAGAGATCGAAATTTAAATACAAGATTTTTTGACCCAGCAGGTGGGGGAGATCCTGTACTTTATCAACATTTATTT.

Holotype ♂

Alajuela, Sector Rincon Rain Forest, Sendero Juntas, 10.907, -85.288, 400 meters, caterpillar collection date: 30/iv/2014, wasp eclosion date: 12/v/2014. Depository: CNC.

Host data. gelJanzen01 Janzen501 (Gelechiidae) feeding on Gouania polygama (Rhamnaceae).

Caterpillar and holotype voucher codes. 14-SRNP-42146, DHJPAR0055499.

Paratypes

None.

Etymology

Chelonus manuelpereirai is named to honor Sr. Manuel Pereira of GDFCF and ACG for his many years as a dedicated inventory parataxonomist for ACG.

Figure 124. 

Chelonus manuelpereirai, holotype.

Chelonus manuelzumbadoi Sharkey, sp. nov.

Figure 125

Diagnostics

BOLD:ACW6597. Consensus barcode. GTTTTATATTTTATTTTTGGAATATGGAGGGGGGTTTTGGGTTTGTCTTTAAGATTAATTTTACGAATAGAATTAAGTGTTTTAGGTAGATTAATTAAAAATGATCAATTATATAATAGTGTAGTAACTATACATGCTTTTGTAATAATTTTTTTTATGGTTATACCAGTTATAATTGGTGGTTTTGGATTAGTTCCATTAATGTTGGGTTTGCCAGATATAGCATTTCCTCGAATGAATAATATAAGATTTTGATTATTAATTCCTTCATTATTATTATTATTATTAGGGGGGTTTATTAATAGAGGAGTGGGAACAGGGTGAACTGTATATCCTCCATTATCGTCATTAATTGGTCACGGTGGAATTTCTGTAGATTTATCAATTTTTTCTTTACATTTAGCAGGGATATCTTCAATTATAGGAGCTATTAATTTTATTGTAACAGTAATAAATATAAGTTTTGATTTAAAATGTATAGATAAATATTCATTATTTGTATGGTCAGTTTTGATTACAGCGGTTTTATTGTTGTTATCATTACCTGTTTTGGCTGGTGCAATTACTATATTATTAAGTGAT.

Holotype ♀

Guanacaste, Sector San Cristobal, Estación San Gerardo, 10.8801, -85.3889, 575 meters, 23‒30/xii/2013, Malaise trap. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG23153-E04.

Paratypes

None.

Etymology

Chelonus manuelzumbadoi is named to honor Sr. Manuel Zumbado as an outstanding parataxonomist turned curator of Diptera in the INBio-MN insect collection and now part of the BioAlfa national biodiversity inventory.

Figure 125. 

Chelonus manuelzumbadoi, holotype.

Chelonus marianopereirai Sharkey, sp. nov.

Figure 126

Diagnostics

BOLD:ADC0083. Consensus barcode. TTTATTTTTGGAATTTGAGCAGGAGTTTTAGGTTTATCTTTAAGATTAATTTTACGAATAGAATTAAGTGTATTAGGAAGCTTATTAAAAAATGATCAATTATATAATAGTGTGGTTACTATACATGCTTTTGTAATAATTTTTTTTATGGTGATACCAATTATGATTGGGGGATTTGGTAATTGATTAATTCCATTAATATTAGGATTACCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTAATATTATTGTTATTAAGAAGATTTGTAAATACAGGTGTAGGAACTGGATGAACAGTTTATCCACCATTATCATCATTAATAGGTCATGGAGGAATTTCCGTGGATTTATCAATTTTTTCTTTACATTTAGCAGGTATATCTTCAATTATAGGAGCAATTAATTTTATTGTTACAGTTTTAAATACAAATTTTGATATAAATTATATAGACAAATTTCCATTATTTGTATGATCTGTATTAATTACAGCAATTTTATTATTATTGTCATTACCTGTTTTAGCTGGTGCAATTACTATA------------------------------------------------------------------.

Holotype ♀

Guanacaste, Pailas Dos, PL12-3, 10.7631, -85.3344, 820 meters, 06‒13/xi/2014, Malaise trap PL12-3A. Depository: CNC.

Host data. None.

Holotype voucher codes: BIOUG30255-D09.

Paratypes

None.

Etymology

Chelonus marianopereirai is named to honor Sr. Mariano Pereira formerly of GDFCF and ACG for his many years as a dedicated inventory parataxonomist for ACG.

Figure 126. 

Chelonus marianopereirai, holotype.

Chelonus maribellealvarezae Sharkey, sp. nov.

Figure 127

Diagnostics

BOLD:AAM1066. Consensus barcode. AGTATTATATTTTATTTTTGGKATATGATCGGGGGTTTTGGGTTTATCTYTAAGGTTAATAATTCGTATAGAATTRAGTATATTAGGTAGTATATTTATAAATGATCAATTATATAATAGAATTGTTACTATACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGTTTACCAGATATAATTTTTCCTCGAATAAATAATATAAGATTTTGATTAYTAATTCCTTCTTTATTATTATTAATTATAAGAAGTTTYGTAAATACAGGTGTAGGAACTGGATGAACAGTTTATCCTCCATTATCTTTATTAATAGGTCATAGGGGTATTTCAGTAGATTTATCAATTTTTTCTTTACATTTAGCAGGTATRTCTTCAATTATRGGGTCAATTAATTTTATTGTTACTGTYTTAAATACATGAATAAATAATAAATTAATAGATAARTTTTCTTTATTTGTTTGATCRATTTTTATTACAACAATTTTATTATTGTTATCTTTACCTGTTTTAGCGGGRGCTATTACTATATTAYTAAGGGATCGAAATTTAAATACTAGATTTTTTGATCCTTCTGGAGGGGGGGATCCTATTTTATATCAACATTTATTT.

Holotype ♂

Guanacaste, Sector Mundo Nuevo, Vado Miramonte, 10.772, -85.434, 305 meters, caterpillar collection date: 18/xii/2009, wasp eclosion date: 31/xii/2009. Depository: CNC.

Host data. Antaeotricha Janzen221 (Depressariidae) feeding on Desmodium procumbens (Fabaceae).

Caterpillar and holotype voucher codes. 09-SRNP-58092, DHJPAR0038214.

Paratype

Host = elachJanzen01 Janzen38: DHJPAR0051929.

Etymology

Chelonus maribellealvarezae is named to honor Sra. Maribelle Alvarez of CONAGEBIO for her collaboration and support with the entire biodiversity permitting needs for BioAlfa and other ACG Biodiversity inventory.

Figure 127. 

Chelonus maribellealvarezae, holotype.

Chelonus markmetzi Sharkey, sp. nov.

Figure 128

Diagnostics

BOLD:AAA4444. Consensus barcode. TATATTATATTTTATKTTTGGTATATGGGCTGGATTTTTGGGATTATCATTAAGATTATTAATTCGGATAGAATTGAGAGTGCTAGGYAGAGTATTTACTAATGAYCAATTATATAATAGAATTGTAACTATACATGCTTTTGTAATAATTTTTTTTATGGTTATACCAATTATGATTGGTGGATTTGGRAATTGGTTGGTACCTTTGATATTAGGATTACCGGATATAATTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCATCTTTAATATTATTAATATTAGGGGGATTTGTCAATATAGGGGTAGGTACTGGTTGAACAGTTTACCCCCCATTATCTTTATTAATAGGTCATAGAGGAGTTTCTGTTGATTTATCAATTTTTTCTTTACATATAGCGGGAGTYTCATCTATTATAGGATCRGTAAATTTTATTGTAACTATTTTAAATACTTGAATAAAAAATGATTTTATAGATAAATTTCCTTTATTTATTTGATCTGTATTTATTACTACTATTTTATTATTATTATCGTTACCWGTATTAGCAGGGGCTATTACTATATTATTAAGTGAYCGTAATTTAAATACAAGATTTTTTGATCCATCAGGTGGGGGGGATCCAATTTTATATCAACATTTATTT.

Holotype ♀

Guanacaste, Sector Mundo Nuevo, Estación La Perla, 10.767, -85.433, 325 meters, caterpillar collection date: 18/v/2011, wasp eclosion date: 31/v/2011. Depository: CNC.

Host data. Herpetogramma phaeopteralis (Crambidae) feeding on Axonopus fissifolius (Poaceae).

Caterpillar and holotype voucher codes. 11-SRNP-5549, DHJPAR0045350.

Paratypes

Hosts = Herpetogramma phaeopteralis. DHJPAR0045335, DHJPAR0045355, DHJPAR0055996, DHJPAR0055997, DHJPAR0056052, BIOUG17653-H06, BIOUG18660-H04. Depository: CNC.

Other material

Specimens from Mexico (BIOUG19755-A08, BIOUG20526-D01) share the same BIN on BOLD and may be conspecific. They were not examined.

Etymology

Chelonus markmetzi is named to honor Dr. Mark Metz of the Smithsonian Institution and USDA for his open-mindedness in exploring and conducting the biopolitics of micromoth taxonomy and patronyms for ACG and BioAlfa.

Figure 128. 

Chelonus markmetzi, holotype.

Chelonus markshawi Sharkey, sp. nov.

Figure 129

Diagnostics

BOLD:ACL6642. Consensus barcode. GATACTTTATTTTATTTTTGGTATTTGATCAGGAATATTAGGTTTATCTTTGAGAATAATTATTCGTTTAGAGTTAATTTATGTTGGGAGATTTTTAACAAATGATCAGTTATATAATAATATTGTAACTATACATGCATTTATTATAATTTTTTTTATAGTAATGCCAGTAATAATTGGGGGGTTTGGAAATTGATTGGTTCCTTTAATATTAGGATTATCAGATATATCTTTTCCTCGTATAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTAATAATGTTAATAAGGGGGTTTGTAAATATGGGTGCAGGAACTGGATGAACAGTGTATCCTCCTTTATCTTTAAGTATGGGTCATAGTGGTATTTCTGTAGATATAGTAATTTTTTCTTTACATTTAGCTGGGATATCTTCTATTATGGGTGCTATTAATTTTATTACTACTGTAATGAATACTTGAATAAATGTAAAATTAATAGATAAATTTCCTCTATTTATTTGATCTGTTTATATTACAGCAATTTTATTATTGTTATCATTGCCTGTGTTGGCAGGAGCAATTACTATATTATTAAGAGATCGTAATATAAATACAAGATTTTTTGATTCATCTGGTGGTGGAGATCCTGTATTATATCAACATTTATTT.

Holotype ♀

Alajuela, Sector Rincon Rain Forest, Quebrada Escondida, 10.899, -85.275, 420 meters, caterpillar collection date: 01/vii/2013, wasp eclosion date: 04/ix/2013. Depository: CNC.

Host data. Stenoma Janzen142 (Depressariidae) feeding on Calyptrogyne trichostachys (Arecaceae).

Caterpillar and holotype voucher codes. 13-SRNP-42923, DHJPAR0053672.

Paratypes

None.

Etymology

Chelonus markshawi is named to honor Dr. Mark Shaw of National Museums Scotland for his many decades of exploring the natural history and taxonomy of European parasitic Hymenoptera.

Figure 129.