Research Article
Print
Research Article
A new species of Galleria Fabricius (Lepidoptera, Pyralidae) from Korea based on molecular and morphological characters
expand article infoSeung Jin Roh‡, Haechul Park‡, Seong-Hyun Kim‡, So-Yun Kim‡, Yong-Su Choi‡, Jeong-Hun Song‡
‡ Department of Agricultural Biology, National Institute of Agricultural Sciences, Wanju-gun, South Korea

Corresponding author: Jeong-Hun Song ( jeonghuns@korea.kr )

Academic editor: Colin Plant
© 2020 Seung Jin Roh, Haechul Park, Seong-Hyun Kim, So-Yun Kim, Yong-Su Choi, Jeong-Hun Song.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Roh SJ, Park H, Kim S-H, Kim S-Y, Choi Y-S, Song J-H (2020) A new species of Galleria Fabricius (Lepidoptera, Pyralidae) from Korea based on molecular and morphological characters. ZooKeys 970: 51-61. https://doi.org/10.3897/zookeys.970.54960
ZooBank: urn:lsid:zoobank.org:pub:8069F755-8DF6-4AEB-A1D7-FD20096B4C5C
Open Access

Abstract

The greater wax moth, Galleria mellonella Linnaeus, is well known as a pest of honey bees and for the biodegradation of wax and polyethylene by their larvae. The genus Galleria has long been considered monotypic and found worldwide. A taxonomic study of the genus Galleria is presented based on morphological and molecular characters (COI, CAD, wg). A new species (Galleria similis Roh & Song, sp. nov.) is recognized on the Korean peninsula. The new species is superficially similar to G. mellonella but they can be separated by the structures of hindwing venation and male genitalia. Habitus photographs and illustrations of diagnostic characters are provided.

Keywords

cryptic species, Galleriinae, new species, plastic eating moth, Pyraloidea, wax worms

Introduction

The family Pyralidae is large group of Lepidoptera, placed in the superfamily Pyraloidea consisting of 1055 genera with 5921 described species (van Nieukerken et al. 2011). A molecular phylogeny and revised classification of the Pyralidae recognized five subfamilies, Chrysauginae, Epipaschiinae, Galleriinae, Phycitinae, and Pyralinae (Regier et al. 2012).

Among the Galleriinae, the monotypic genus Galleria Fabricius, 1798 was established with the type species Phalaena cereana Blom, 1764. Galleria mellonella (Linnaeus) is a ubiquitous pest of honey bees, Apis mellifera Linnaeus and A. cerana Fabricius (Ellis et al. 2013; Kwadha et al. 2017). They live on honeycomb in beehives, feeding on honey, beeswax, and the skin of bee pupae (Oldroyd 1999, 2007; Martel et al. 2006; Klein et al. 2007; Kong et al. 2019). Recent studies have shown that the larvae have the ability to biodegrade polyethylene in their guts (Yang et al. 2014; Bombelli et al. 2017; Kong et al. 2019).

The genus Galleria is superficially similar to the genus Achroia Hübner, 1819 (Kwadha et al. 2017), but can be distinguished from the latter by the presence of four stemmata on the head of the larva, concaved in the termen of the forewing, and the Cu vein apparently four-branched from the hindwing (Ellis et al. 2013).

In this paper, we describe Galleria similis Roh & Song, sp. nov. based on morphological and molecular characters, and provide habitus photographs and illustrations of diagnostic characters for identification of the two species of the genus Galleria.

Materials and methods

The material examined in this study is deposited in the Systematic Entomology Laboratory, National Institute of Agricultural Sciences (NAS), Wanju, Korea. Specimens were dissected and examined after mounting on glass slides; male genitalia in 60% Euparal and wing venation based on dried specimens. Photographs of adults and male genitalia were taken using a Dhyana 95 scientific CMOS camera (Tucsen, Fuzhou, China) attached to a Leica DM 2000 LED optical microscope (Leica, Wetzlar, Germany). Terminology for morphological characters of the adult follow Smith (1965).

Genomic DNA from four specimens of Galleria similis and 19 specimens of G. mellonella was extracted from the legs of dried specimens of adults in 100% alcohol using a MagListo 5M Genomic DNA Extraction Kit (Bioneer Corporation, Daejeon, Republic of Korea) according to the manufacturer’s protocol. One mitochondrial protein coding gene, the cytochrome oxidase subunit I gene (COI) (Folmer et al. 1994) and two nuclear protein coding genes, Carbamoyl-phosphate synthetase 2, Aspartate transcarbamylase, and Dihydroorotase (CAD) and Wingless (wg) were sequenced (Haines and Rubinoff 2012) (Table 1). Primers and amplification strategies followed Haines and Rubinoff (2012) and are detailed in Table 2. PCR conditions for amplification followed Haines and Rubinoff (2012), and directly sequenced at Macrogen (Geumcheon-gu, Seoul, Korea). Contigs were assembled in Geneious prime (Kearse et al. 2012). Successful COI, CAD and Wingless sequences were uploaded to GenBank (Table 1).

Table 1.
Download as
CSV
XLSX

Galleria species and their COI barcodes and nuclear protein coding gene sequences with their associated and GenBank accession numbers as used in this study. Dashes indicate missing data.

Species Voucher No. COI CAD wg
Galleria mellonella 15310 MT439336 MT447104 MT447124
15311 MT439337 MT447105 MT447125
15312 MT439338 MT447109 MT447126
15313 MT439349 MT447106 MT447127
15314 MT439350 MT447107 MT447128
15616 MT439351 MT447110 MT447129
15617 – MT447108 MT447130
21361 MT439339 – MT447131
21362 MT439340 MT447111 MT447132
21363 MT439341 MT447115 MT447133
21364 MT439342 MT447114 MT447134
21365 – MT447119 MT447135
21412 MT439343 MT447116 MT447136
21413 MT439352 – –
21414 MT439346 MT447112 MT447137
21415 MT439344 MT447113 MT447138
21416 MT439347 MT447120 MT447139
21417 MT439345 MT447118 MT447140
21418 MT439348 MT447117 MT447141
G. similis 15315 MT447100 MT447121 MT447142
21366 MT447101 MT447122 MT447143
21367 MT447102 MT447123 MT447144
21368 MT447103 – MT447145
Table 2.
Download as
CSV
XLSX

List of primers and amplification strategies used in this study (abbreviations: s = second, min = minute).

Genes Primers Sequences (5' to 3') Amplification strategies
COI LCO1490 GGTCAACAAATCATAAAGATATTGG LCO1490 + HCO2198 (Folmer et al. 1994)
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA
CAD CAD4_Pyr_F GAAGAAGCATTTCAAAAAGC CAD4_Pyr_F + CAD4_Pyr_R (Haines and Rubinoff 2012)
CAD4_Pyr_R CKRTCACTCATGTCRTA
wg LepWg1 GARTGYAARTGYCAYGGYATGTCTGG LepWg1 + LepWg2 (Brower and Desalle 1998)
LepWg2 ACTICGCARCACCARTGGAATGTRCA

* PCR amplifications condition - COI: 5-min 95 °C; 35 cycles: 30-s 95 °C, 25-s 48 °C, 45-s at 72 °C; 5-min 72 °C. - CAD: 2-min 94 °C, 1-min 50 °C, 1-min 72 °C; 34 cycles: 1-min 94 °C, 1-min 50 °C, 1-min at 72 °C; 12-min 72 °C. - wg: 2-min 94 °C, 1-min 56 °C, 1-min 72 °C; 34 cycles: 1-min 94 °C, 1-min 56 °C, 1-min at 72 °C; 12-min 72 °C.

The barcodes were compared to 93 DNA barcodes of the genera Galleria and Achroia downloaded from BOLD systems v4 (BIN numbers: BOLD:AAA0965, BOLD:AAL2955, BOLD:ACO9701). A neighbor-joining analysis (NJ) was performed with MEGA X (Kumar et al. 2018) using the Kimura-2-Parameter (K2P) model (Kimura 1980) for nucleotide substitutions. Bootstrap support values for each node were also evaluated via MEGA X with 1000 replicates. Parsimony analyses (PA) with bootstrap were conducted in TNT 1.5 (Goloboff and Catalano 2016) using search strategies described by Song and Ahn (2018).

Intra- and inter-specific distances in different taxonomic levels were calculated using the uncorrected pairwise distance method (Srivathsan and Meier 2012). To explore molecular diagnostic characters for the Galleria species, we used the “list common synapomorphies” function of TNT and then examined thoroughly listed characters in the alignment file.

Results

Molecular character analysis

A total of 21 new sequences was generated from four specimens of Galleria similis and 17 specimens of G. mellonella (524–650 bp of partial COI barcode region, 613 bp of partial CAD¸ and 432 bp of partial wg gene region). All new sequences were uploaded to GenBank (Table 1). The DNA barcodes (COI) were compared to those of 72 DNA barcodes in 16 countries (G. mellonella), one Australian specimen (Galleria sp.) and seven lesser wax moths (Achroia grisella Fabricius) downloaded from BOLD systems v4 (Fig. 7).

Genetic divergence of COI using uncorrected p-distance among the Galleria and Achroia species ranged from 5.3% to 12.0%, while intraspecific divergence ranged from 0% to 2.2% (Table 3). All four species were strongly supported as a single lineage on both NJ and PA trees (Figs 7, 8). The molecular analyses (p-distance, NJ and PA analyses) revealed that G. mellonella was closely related to G. similis (Table 3; Figs 7, 8). The maximum difference among populations within G. mellonella was 2.2%, and within G. similis was 0% (Table 3). For these two species, it is difficult to correctly delimit each species, due to their extreme similarities in external morphological characters (see taxonomy section below). In contrast to morphological characters, however, genetic divergence strongly supported the separation of G. mellonella and G. similis. The minimum inter-specific difference between the two species (5.3%) was much higher than the maximum intraspecific difference of G. mellonella (2.2%) (Table 3). Furthermore, molecular diagnostic characters for the Galleria species, G. mellonella and G. similis contained 15 characters for COI, one character of CAD and four characters of wg gene regions (Table 4).

Table 3.
Download as
CSV
XLSX

Inter- and intraspecific genetic differences in the two genera Galleria and Achroia species for COI (658 bp) calculated using p-distance.

G. mellonella G. similis Galleria sp. A. grisella
G. mellonella 0–0.022
G. similis 0.053–0.066 0
Galleria sp. 0.112–0.119 0.114 0
A. grisella 0.107–0.116 0.117–0.119 0.116–0.120 0–0.003
Table 4.
Download as
CSV
XLSX

List of 20 molecular diagnostic characters used to determine the genetic distinctiveness of two cryptic species Galleria mellonella and G. similis based on mtDNA partial COI, nuDNA partial CAD and wg gene region. Numbers indicate nucleotide sites in the sequenced 658 bp portion of the COI gene, 613 bp portion of the CAD gene and 432 bp portion of the wg gene. Number position follows G. mellonella: MT439366 (COI), MT447104 (CAD) and MT447124 (wg).

Species Genes
COI
16 34 109 197 232 259 271 274 280 307
G. mellonella T A A T T T T T T T
G. similis C T G C C C C C C C
Species COI CAD wg
385 391 403 424 470 319 129 241 343 379
G. mellonella T T C T T G A T C C
G. similis C C T C C A C C T T

We also found three distinct differences in the amino acid sequences of each protein (Table 5). In particular, the transition from G (guanine) to A (adenine) at the 319 site of CAD protein led to a change from a hydrophobic amino acid (Alanine, A) to a hydrophilic amino acid (Threonine, T), and the transversion from A to C (cytosine) at the 129 site of the wg protein led to a change from a hydrophilic amino acid (Glutamate, E) to a hydrophobic amino acid (A). The molecular characters provided further evidence that new species G. similis was distinct and valid.

Table 5.
Download as
CSV
XLSX

List of three molecular diagnostic characters used to determine the molecular distinctiveness of two cryptic species Galleria mellonella and G. similis based on amino acid sequences of partial COI, CAD, and wg protein region. Numbers indicate amino acid site in the sequenced 201 amino acid (aa) portion of the COI protein, 204 aa portion of the CAD protein and 143 aa portion of the wg protein. Number position follows G. mellonella: the translated amino acid sequences of MT439366 (COI), MT447104 (CAD) and MT447124 (wg).

Species Proteins
COI CAD wg
152 107 43
G. mellonella V A E
G. similis I T A

Taxonomic accounts

Genus Galleria Fabricius, 1798

Galleria Fabricius, 1798: 419, 462. Type species: Phalaena cereana Blom, 1764, by subsequent designation by Latreille (1810: 441).

Cerioclepta Sodoffsky, 1837: 93. Type species: Galleria mellonella Linnaeus, 1758, by original designation.

Vindana Walker, 1866: 1706. Type species: Vindana obliquella Walker, 1866, by monotypy.

Galleria similis Roh & Song, sp. nov.

http://zoobank.org/DD9DF8D5-D3D5-4235-80AE-294C9B731EAB
Figures 2, 4, 6

Type material

Holotype. ♂, Korea: Wanju-gun, 14.xi.2014, 35°49'45.64"N, 127°02'27.20"E, leg. H.S. Shim, genitalia slide no. 15315, DNA barcode GenBank accession no. MT447100 (NAS). Paratypes. 3♂, Korea: Tongyeoung, 17.i.2020, 34°50'58.58"N, 127°26'51.79"E, leg. J.-H. Song, genitalia slide no. 21366–21968, DNA barcode GenBank accession no. MT447101, MT447102, and MT447103 (NAS).

Diagnosis

Galleria similis sp. nov. (Figs 2, 4, 6) is very similar to G. mellonella (Figs 1, 3, 5) but can be distinguished by a square discal cell of its hindwing venation (Fig. 6) and the different shape of male genitalia (Fig. 4, G. similis: valva shorter and wider, concave at outer margin). Galleria similis sp. nov. had 15, one and four diagnostic characters from 658 bp of partial COI, 613 bp of partial CAD and 423 bp of partial wg gene region, respectively (Table 4). Our study showed that morphological and molecular characters can be used to resolve the status of cryptic species, G. mellonella and G. similis. A cryptic species was suggested by the unusually high genetic distances within specimens originally identified as G. mellonella.

Figures 1, 2. 

Adults of Galleria species. 1 Male of G. mellonella 2 male of G. similis, holotype.

Figures 3, 4. 

Male genitalia of Galleria species. 3 G. mellonella (slide no. 21364) 4 G. similis, paratype (slide no. 21367).

Figures 5, 6. 

Male wing venation of Galleria species. 5 G. mellonella 6 G. similis, paratype.

Description

Adult. Male (Fig. 2). Head: vertex densely clothed with gray hair-like scales; labial palpus three-segmented. Thorax: Light brown; notum covered with gray scales. Legs with femora, tibiae, and tarsi clothed with light gray piliform scales; tarsi apical and medial spurs covered dark-brown scales. Wingspan 21.5–32.0 mm. Forewing (Fig. 6) narrow, costa straight at base and gently curved beyond 4/5, termen concave; tornus pointed, 9 separate veins originating at the discal cell; Sc terminating at 4/5 costa; R5 originated at R4, M1 and M2 parallel; M2, M3 originating at distal corner of discal cell; Cu1 and Cu+A1 parallel, ground color yellowish white with gray and some dark overscaling. Hindwing (Fig. 6) discal cell square, L/W ratio 1.72; costa straight, apex straightly curved to termen; Sc straight to 3/5 costa; R1, R2 and R3 present; R1 and R2 terminating at apex; M2 originating at 1/5 M3; CuA1 and CuA2 parallel; A1 originating at 4/5 Cu2. Hindwing covered with dark-brown scales; postmarginal part present with short light brown hairs. Abdomen: Male genitalia (Fig. 4) with uncus concave and hooked; tegumen wide at base; gnathos long; valva short and wide, costa straight, termen relatively concave, small setae present sparsely on outer and inner surface; vinculum narrower than gnathos; juxta heart shaped; saccus very short and slender; phallus slightly short and thick, vesica with short setae, ductus ejaculatorius present.

Female. Unknown.

Distribution

Korea.

Etymology

Named from the Latin similis meaning “similar”, which refers to the similar morphological characters with G. mellonella.

Figure 7. 

Neighbor-Joining tree based on partial COI gene sequences with bootstrap values. Scale bar indicates the expected number of substitutions per site.

Figure 8. 

Strict consensus tree of equally parsimonious cladograms based on partial COI gene sequences with bootstrap values.

Acknowledgements

We thank T. Han (Korea National Park Research Institute, Korea) and S.I. Lee (National Institute of Agricultural Sciences, Korea) for assistance with DNA extraction. This work was carried out with the support of “Cooperative Research Program for Agriculture Science and Technology Development (Project No. PJ01504902)” Rural Development Administration, Republic of Korea.

References

  • Blom CM (1764) Beskrifning pa en liten fjaril, som utoder Bi-Stockar. Kungliga Svenska Vetenskapsakademiens Handlingar 25: 12–18.
  • Brower AVZ, Desalle R (1998) Patterns of mitochondrial versus nuclear DNA sequence divergence among nymphalid butterflies: the utility of wingless as a source of characters of phylogenetic inference. Insect Molecular Biology 7: 73–82. https://doi.org/10.1046/j.1365-2583.1998.71052.x
  • Fabricius JC (1793) Entomologia systematica emendata et aucta. Secundum classes, ordines, genera, species, adiectis synonimis, locis, observationibus, descriptionibus. Vol. Tome III, Pars I, C.G. Proft, Fil. et Soc., Hafniae, 1–488. https://doi.org/10.5962/bhl.title.125869
  • Fabricius JC (1794) Entomologica systematica emendata et aucta. Secundum classes, ordines, genera, species adiectis synonymis, locis, observationibus, descriptionibus. C.G. Proft et C. F. Mohr, Hafniae et Kiliae, 1–349.
  • Fabricius JC (1798) Supplementum Entomologiae Systematicae. Proft et Storch, Hafniae, [i]-[iv], 1–572, 1–52.
  • Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.
  • Goloboff PA, Catalano SA (2016) TNT version 1.5, including a full implementation of phylogenetic morphometrics. Cladistics 32: 221–238. https://doi.org/10.1111/cla.12160
  • Haines WP, Rubinoff D (2012) Molecular phylogenetics of the moth genus Omiodes Guenée (Crambidae: Spilomelinae), and the origins of the Hawaiian lineage. Molecular Phylogenetics and Evolution 65: 305–316. https://doi.org/10.1016/j.ympev.2012.06.021
  • Hübner J (1800–1838) c: Sammlung europäischer Schmetterlinge. Horde 3. Bombyces-Spinner [continued by C. Geyer], Augsburg, 101–154.
  • Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A (2012) Geneious basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. https://doi.org/10.1093/bioinformatics/bts199
  • Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution. 16: 111–120. https://doi.org/10.1007/BF01731581
  • Klein AM, Vaissiere BE, Cane JH, Steffan-Dewenter I, Cunningham SA, Kremen C, Tscharntke T (2007) Importance of pollinators in changing landscapes for world crops. Proceedings Royal Society London B 274: 303–313. https://doi.org/10.1098/rspb.2006.3721
  • Kong HK, Kim HH, Chung JH, Jun JH, Lee S, Kim HM, Jeon S, Park SG, Bhak J, Ryu CM (2019) The Galleria mellonella Hologenome Supports Microbiota-Independent Metabolism of Long-Chain Hydrocarbon Beeswax Cell Reports 26: 2451–2464. https://doi.org/10.1016/j.celrep.2019.02.018
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 35: 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Kwadha CA, Ong’amo GO, Ndegwa PN, Raina SK, Fombong AT (2017) The Biology and Control of the Greater Wax Moth, Galleria mellonella. Insects 733: 49–64. https://doi.org/10.3390/insects8020061
  • Latreille PA (1810) Consid érations g énérales sur l’ordre naturel des animaux composant les classes des crustac és, des arachnides, et des insectes; avec un tableau m éthodique de leurs genres, dispos és en familles. Schoell, Paris, 1–444. https://doi.org/10.5962/bhl.title.13342
  • Linnaeus C (1758) Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis.’ Laurentii Salvii, Holmiae, 1–824. https://doi.org/10.5962/bhl.title.542
  • Nieukerken EJ van, Kaila L, Kitching IJ, Kristensen NP, Lees DC, Minet J, Mitter C, Mutanen M, Regier JC, Simonsen TJ, Wahlberg N, Yen SH, Zahiri R, Adamski D, Baixeras J, Bartsch D, Bengtsson BA, Brown JW, Bucheli SR, Davis DR, De Prins J, De Prins W, Epstein ME, Gentili-Poole P, Gielis C, Hattenschwiler P, Hausmann A, Holloway JD, Kallies A, Karsholt O, Kawahara AY, Koster SJC, Kozlov MV, Lafontaine JD, Lamas G, Landry JF, Lee S, Nuss M, Park KT, Penz C, Rota J, Schitlmeister A, Schmidt BC, Sohn JC, Solis MA, Tarmann GM, Warren AD, Weller S, Yakovlev RV, Zolotuhin VV, Zwick A (2011) Order Lepidoptera Linnaeus, 1758. In: Zhang ZQ (Ed.) Animal biodiversity: an outline of higher-level classification and survey of taxonomic richness. Zootaxa 3148: 212–221. https://doi.org/10.11646/zootaxa.3148.1.41
  • Regier JC, Mitter C, Solis MA, Hayden JE, Landry B, Nuss M, Simonsen TJ, Yen SH, Zwick A, Cummings MP (2012) A molecular phylogeny for the pyraloid moths (Lepidoptera: Pyraloidea) and its implications for higher-level classification. Systematic Entomology 37: 635–656. https://doi.org/10.1111/j.1365-3113.2012.00641.x
  • Smith TL (1965) External morphology of Larva, Pupa, and Adult of the Wax Moth, Galleria mellonella L. Journal of the Kansas Entomological Society 38: 287–310.
  • Song J-H, Ahn K-J (2018) Species trees, temporal divergence and historical biogeography of coastal rove beetles (Coleoptera: Staphylinidae) reveal their early Miocene origin and show that most divergence events occurred in the early Pliocene along the Pacific coasts. Cladistics 34: 313–332. https://doi.org/10.1111/cla.12206
  • Walker F (1866) Supplement 5. List of the Specimens of Lepidopterous Insects in the Collection of the British Museum, London 35: 1535–2040.
  • Yang J, Yang Y, Wu WM, Zhao J, Jiang L (2014) Evidence of Polyethylene Biodegradation by Bacterial Strains from the Guts of Plastic-Eating Waxworms. Environmental Science & Technology 48: 13776–13784. https://doi.org/10.1021/es504038a
login to comment