Research Article |
|
Corresponding author: Jeong-Hun Song ( jeonghuns@korea.kr ) Academic editor: Colin Plant
© 2020 Seung Jin Roh, Haechul Park, Seong-Hyun Kim, So-Yun Kim, Yong-Su Choi, Jeong-Hun Song.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Roh SJ, Park H, Kim S-H, Kim S-Y, Choi Y-S, Song J-H (2020) A new species of Galleria Fabricius (Lepidoptera, Pyralidae) from Korea based on molecular and morphological characters. ZooKeys 970: 51-61. https://doi.org/10.3897/zookeys.970.54960
|
The greater wax moth, Galleria mellonella Linnaeus, is well known as a pest of honey bees and for the biodegradation of wax and polyethylene by their larvae. The genus Galleria has long been considered monotypic and found worldwide. A taxonomic study of the genus Galleria is presented based on morphological and molecular characters (COI, CAD, wg). A new species (Galleria similis Roh & Song, sp. nov.) is recognized on the Korean peninsula. The new species is superficially similar to G. mellonella but they can be separated by the structures of hindwing venation and male genitalia. Habitus photographs and illustrations of diagnostic characters are provided.
cryptic species, Galleriinae, new species, plastic eating moth, Pyraloidea, wax worms
The family Pyralidae is large group of Lepidoptera, placed in the superfamily Pyraloidea consisting of 1055 genera with 5921 described species (van
Among the Galleriinae, the monotypic genus Galleria Fabricius, 1798 was established with the type species Phalaena cereana Blom, 1764. Galleria mellonella (Linnaeus) is a ubiquitous pest of honey bees, Apis mellifera Linnaeus and A. cerana Fabricius (
The genus Galleria is superficially similar to the genus Achroia Hübner, 1819 (
In this paper, we describe Galleria similis Roh & Song, sp. nov. based on morphological and molecular characters, and provide habitus photographs and illustrations of diagnostic characters for identification of the two species of the genus Galleria.
The material examined in this study is deposited in the Systematic Entomology Laboratory, National Institute of Agricultural Sciences (NAS), Wanju, Korea. Specimens were dissected and examined after mounting on glass slides; male genitalia in 60% Euparal and wing venation based on dried specimens. Photographs of adults and male genitalia were taken using a Dhyana 95 scientific CMOS camera (Tucsen, Fuzhou, China) attached to a Leica DM 2000 LED optical microscope (Leica, Wetzlar, Germany). Terminology for morphological characters of the adult follow
Genomic DNA from four specimens of Galleria similis and 19 specimens of G. mellonella was extracted from the legs of dried specimens of adults in 100% alcohol using a MagListo 5M Genomic DNA Extraction Kit (Bioneer Corporation, Daejeon, Republic of Korea) according to the manufacturer’s protocol. One mitochondrial protein coding gene, the cytochrome oxidase subunit I gene (COI) (
Galleria species and their COI barcodes and nuclear protein coding gene sequences with their associated and GenBank accession numbers as used in this study. Dashes indicate missing data.
| Species | Voucher No. | COI | CAD | wg |
|---|---|---|---|---|
| Galleria mellonella | 15310 | MT439336 | MT447104 | MT447124 |
| 15311 | MT439337 | MT447105 | MT447125 | |
| 15312 | MT439338 | MT447109 | MT447126 | |
| 15313 | MT439349 | MT447106 | MT447127 | |
| 15314 | MT439350 | MT447107 | MT447128 | |
| 15616 | MT439351 | MT447110 | MT447129 | |
| 15617 | – | MT447108 | MT447130 | |
| 21361 | MT439339 | – | MT447131 | |
| 21362 | MT439340 | MT447111 | MT447132 | |
| 21363 | MT439341 | MT447115 | MT447133 | |
| 21364 | MT439342 | MT447114 | MT447134 | |
| 21365 | – | MT447119 | MT447135 | |
| 21412 | MT439343 | MT447116 | MT447136 | |
| 21413 | MT439352 | – | – | |
| 21414 | MT439346 | MT447112 | MT447137 | |
| 21415 | MT439344 | MT447113 | MT447138 | |
| 21416 | MT439347 | MT447120 | MT447139 | |
| 21417 | MT439345 | MT447118 | MT447140 | |
| 21418 | MT439348 | MT447117 | MT447141 | |
| G. similis | 15315 | MT447100 | MT447121 | MT447142 |
| 21366 | MT447101 | MT447122 | MT447143 | |
| 21367 | MT447102 | MT447123 | MT447144 | |
| 21368 | MT447103 | – | MT447145 |
List of primers and amplification strategies used in this study (abbreviations: s = second, min = minute).
| Genes | Primers | Sequences (5' to 3') | Amplification strategies |
|---|---|---|---|
| COI | LCO1490 | GGTCAACAAATCATAAAGATATTGG | LCO1490 + HCO2198 ( |
| HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA | ||
| CAD | CAD4_Pyr_F | GAAGAAGCATTTCAAAAAGC | CAD4_Pyr_F + CAD4_Pyr_R ( |
| CAD4_Pyr_R | CKRTCACTCATGTCRTA | ||
| wg | LepWg1 | GARTGYAARTGYCAYGGYATGTCTGG | LepWg1 + LepWg2 ( |
| LepWg2 | ACTICGCARCACCARTGGAATGTRCA |
The barcodes were compared to 93 DNA barcodes of the genera Galleria and Achroia downloaded from BOLD systems v4 (BIN numbers: BOLD:AAA0965, BOLD:AAL2955, BOLD:ACO9701). A neighbor-joining analysis (NJ) was performed with MEGA X (
Intra- and inter-specific distances in different taxonomic levels were calculated using the uncorrected pairwise distance method (
A total of 21 new sequences was generated from four specimens of Galleria similis and 17 specimens of G. mellonella (524–650 bp of partial COI barcode region, 613 bp of partial CAD¸ and 432 bp of partial wg gene region). All new sequences were uploaded to GenBank (Table
Genetic divergence of COI using uncorrected p-distance among the Galleria and Achroia species ranged from 5.3% to 12.0%, while intraspecific divergence ranged from 0% to 2.2% (Table
Inter- and intraspecific genetic differences in the two genera Galleria and Achroia species for COI (658 bp) calculated using p-distance.
| G. mellonella | G. similis | Galleria sp. | A. grisella | |
| G. mellonella | 0–0.022 | |||
| G. similis | 0.053–0.066 | 0 | ||
| Galleria sp. | 0.112–0.119 | 0.114 | 0 | |
| A. grisella | 0.107–0.116 | 0.117–0.119 | 0.116–0.120 | 0–0.003 |
List of 20 molecular diagnostic characters used to determine the genetic distinctiveness of two cryptic species Galleria mellonella and G. similis based on mtDNA partial COI, nuDNA partial CAD and wg gene region. Numbers indicate nucleotide sites in the sequenced 658 bp portion of the COI gene, 613 bp portion of the CAD gene and 432 bp portion of the wg gene. Number position follows G. mellonella: MT439366 (COI), MT447104 (CAD) and MT447124 (wg).
| Species | Genes | |||||||||
| COI | ||||||||||
| 16 | 34 | 109 | 197 | 232 | 259 | 271 | 274 | 280 | 307 | |
| G. mellonella | T | A | A | T | T | T | T | T | T | T |
| G. similis | C | T | G | C | C | C | C | C | C | C |
| Species | COI | CAD | wg | |||||||
| 385 | 391 | 403 | 424 | 470 | 319 | 129 | 241 | 343 | 379 | |
| G. mellonella | T | T | C | T | T | G | A | T | C | C |
| G. similis | C | C | T | C | C | A | C | C | T | T |
We also found three distinct differences in the amino acid sequences of each protein (Table
List of three molecular diagnostic characters used to determine the molecular distinctiveness of two cryptic species Galleria mellonella and G. similis based on amino acid sequences of partial COI, CAD, and wg protein region. Numbers indicate amino acid site in the sequenced 201 amino acid (aa) portion of the COI protein, 204 aa portion of the CAD protein and 143 aa portion of the wg protein. Number position follows G. mellonella: the translated amino acid sequences of MT439366 (COI), MT447104 (CAD) and MT447124 (wg).
| Species | Proteins | ||
| COI | CAD | wg | |
| 152 | 107 | 43 | |
| G. mellonella | V | A | E |
| G. similis | I | T | A |
Galleria Fabricius, 1798: 419, 462. Type species: Phalaena cereana Blom, 1764, by subsequent designation by
Cerioclepta Sodoffsky, 1837: 93. Type species: Galleria mellonella Linnaeus, 1758, by original designation.
Vindana Walker, 1866: 1706. Type species: Vindana obliquella Walker, 1866, by monotypy.
Holotype. ♂, Korea: Wanju-gun, 14.xi.2014, 35°49'45.64"N, 127°02'27.20"E, leg. H.S. Shim, genitalia slide no. 15315, DNA barcode GenBank accession no. MT447100 (NAS). Paratypes. 3♂, Korea: Tongyeoung, 17.i.2020, 34°50'58.58"N, 127°26'51.79"E, leg. J.-H. Song, genitalia slide no. 21366–21968, DNA barcode GenBank accession no. MT447101, MT447102, and MT447103 (NAS).
Galleria similis sp. nov. (Figs
Adult. Male (Fig.
Female. Unknown.
Korea.
Named from the Latin similis meaning “similar”, which refers to the similar morphological characters with G. mellonella.
We thank T. Han (Korea National Park Research Institute, Korea) and S.I. Lee (National Institute of Agricultural Sciences, Korea) for assistance with DNA extraction. This work was carried out with the support of “Cooperative Research Program for Agriculture Science and Technology Development (Project No. PJ01504902)” Rural Development Administration, Republic of Korea.