Research Article |
Corresponding author: Anatoly Babenko ( lsdc@mail.ru ) Academic editor: Louis Deharveng
© 2020 Anatoly Babenko, Boris Efeykin, Mikhail Bizin.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Babenko A, Efeykin B, Bizin M (2020) Three new and one little-known species of Hypogastruridae (Collembola) from Russia’s northeast. ZooKeys 1005: 1-20. https://doi.org/10.3897/zookeys.1005.54882
|
Three new species, Hypogastrura variata sp. nov., Xenylla aculeata sp. nov., and X. arnei sp. nov., are described based on material from coastal communities of the Sea of Okhotsk, northeast Russia. Taxonomic remarks concerning a little-known species, H. yosii Stach, 1964, found in coastal wrack sediments on Kunashir Island, Kuriles are also given. COI sequences of the above species are analysed, thus allowing for their species statuses to be confirmed.
α-taxonomy, coastal communities, DNA sequencing, East Palaearctic, Hypogastrura, springtails, Xenylla
The first information concerning the collembolan faunas of the Far Eastern regions of Russia was obtained during the expedition of N.A.E. Nordenskjöld aboard the ’Vega’ along the northern coasts of Eurasia to the Commander Islands (1878–1879). The material collected by that expedition on the northern coast of Chukotka was published by
Abd.1–6 abdominal segments;
A1, A7 tenent seta in distal whorl of setae on tibiotarsi;
a-, m-, p-setae setae of anterior, medial, and posterior rows on terga, respectively;
A–E papillae and labial papillae and associated guards on the labial palp, according
a-, b-, d-, e-guards to
Ant.1–4 antennal segments;
L.1–6 maxillary lamellae;
l.p. lateral process on the labial palp;
ms microsensillum/-a;
or organite on antennal tip;
PAO postantennal organ;
S3, S7–S9 antennal sensilla;
VT ventral tube;
U3 unguis of leg 3.
DNA was isolated from specimens fixed in 96% ethanol using Holterman’s technique (
Species used for molecular study, primers, and GenBank accession numbers of the sequences.
Species | Forward primer | Reverse primer | COI sequence number | Sequence size |
---|---|---|---|---|
Hypogastrura variata sp. nov. | colfol-for: tttcaacaaatcataargayatygg | colfol-rev: taaacttcnggrtgnccaaaaaatca | KY066780 KY066781 KY066782 KY066783 | 660 bp |
Hypogastrura yosii Stach, 1964 | colfol-for: tttcaacaaatcataargayatygg | colfol-rev: taaacttcnggrtgnccaaaaaatca | KY066784 KY066785 KY066786 | 660 bp |
Xenylla arnei sp. nov. | LCO1490_t1: tgtaaaacgacggccagtgg tcaacaaatcataaagatattgg | HCO2198_t1: caggaaacagctatgactaaacttc agggtgaccaaaaaatca | KY066787 KY066788 KY066789 | 652 bp |
Holotype Russia, North-East • ♂; Magadan Province, Ola; 59°36.19'N, 151°21.72'E; maritime marsh with Carex subspataceae; July 2017; M. Bizin and B. Efeykin leg.
Paratypes
Russia, North-East • ♀; same data as for holotype • 13 ♀♀, 6 ♂♂ and 10 juveniles; same region, but Tauisk; 59°44.07'N, 149°23.32'E; maritime marsh with Puccinellia phryganodes; July 2017; M. Bizin and B. Efeykin leg. The types are deposited in
A species of the genus Hypogastrura Bourlet, 1839, with four weakly differentiated, curved, sensory setae (one dorsal and three external) on Ant.4, the relatively clearly differentiated dorsal setae, the tridentate retinaculum, the basal lamella on the unguiculus, one tenent seta on all tibiotarsi, the partly reduced furca with four or five posterior setae, and the highly variable shape of the mucro.
Length of males 1.2–1.5 mm, females 1.2–1.8 mm, holotype 1.41 mm long. Colour dark, bluish black, not paler ventrally. Granulations fine and uniform, with 14–18 granules between setae p1 on Abd.5. Ant.4 with a simple apical bulb and four weakly differentiated, curved, sensory setae (one dorsal [S3 ?] and three external [S7, S8, and S9), subapical organite (or) and microsensillum (ms) present as usual (Figs
Dorsal chaetotaxy typical of the genus (Figs
Hypogastrura variata sp. nov. 1 sensorial equipment of Ant.3 and Ant.4 2 tip of Ant.4 3 PAO and nearest ocelli 4 PAO, different specimen 5 labial palp 6 labial papilla E 7 maxillary head 8 furca and retinaculum, lateral view 9 sternum of Abd.4 10–18 mucro, different specimens 19 tip of leg 3. Scale bars: 0.1 mm (9), 0.01 mm (1–8, 10–19).
One of the most characteristic features of the new species is its high-level variability of such important morphological traits as the number of PAO lobes and dental setae, as well as the shape and presence of a mucro (Table
Variation of some important morphological characters in Hypogastrura variata sp. nov.
Number of dental setae | % | presence of a mucro | % | PAO lobes | % | |||
---|---|---|---|---|---|---|---|---|
adults | juveniles | adults | juveniles | adults | juveniles | |||
3+3 | – | 20 | 0+0 | 10 | 20 | 4+3 | 12 | – |
3+4 | 3 | 40 | 1+0 | 47 | 30 | 4+4 | 28 | 70 |
4+4 | 30 | 40 | 1+1 | 43 | 50 | 4+5 | 56 | 30 |
4+5 | 37 | – | 5+6 | 4 | – | |||
5+5 | 27 | – | ||||||
5+6 | 3 | – | ||||||
Number of specimens studied | 30 | 10 | 30 | 10 | 25 | 10 |
The name of the new species is intended to reflect the morphological variability.
Apart from the new species, there are only four congeners known in the world fauna that are characterised by a shortened furca with five or fewer dental setae, coupled with a tridentate retinaculum and only one tenent seta on each leg: H. oreophila Butschek, 1948, H. exigua Gisin, 1958, H. mongolica (Nosek, 1976), and H. magistri Babenko, 1994. The first two species are from high-montane habitats in the European Alps, and both have been recently redescribed (
The two other similar species, H. mongolica and H. magistri, are known from mountainous regions of Central Asia (northern Mongolia and western Tuva). Of these, H. magistri can easily be distinguished due to the presence of six or seven curved sensilla on Ant.4 (vs. four in H. variata sp. nov.) and the presence of additional setae on Abd.4 and Abd.5. As regards H. mongolica, its comparison with H. variata sp. nov. is impossible, because the holotype, the only known specimen, of H. mongolica was immature (
There are another four known Palaearctic congeners which may be related to the above group: H. capitata Cassagnau & Delamare, 1955 (Lebanon), H. verruculata Rusek, 1967 (China), H. ramia Lee & Choe, 1979 (South Korea), and H. pizzoci Fanciulli & Dallai, 2008 (Italy). All of them are also characterised by the presence of a single tenent seta on each leg, and the unguiculus with a basal lamella and a tridentate retinaculum, but they all share a complete, less strongly reduced furca with six posterior setae.
Unfortunately, the GenBank does not contain sequences of any of the above-mentioned species. Therefore, the isolated position of H. variata sp. nov. among fifteen taxonomic units of Hypogastrura present in the GenBank is not particularly surprising and may well serve as an additional confirmation of its independent status. Molecular data have shown that the divergences between all units considered are rather high (Table
K2P distances in Hypogastrura species from GenBank and our sequences, measured in %.
Species | Region | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | H. arctandria | Ontario | ||||||||||||||
2 | H. assimilis | Ontario | 20.2 | |||||||||||||
3 | H. yosii | Kunashir | 22.2 | 25.2 | ||||||||||||
4 | H. concolor | Ontario | 25.6 | 26.3 | 23.8 | |||||||||||
5 | H. distincta | Ontario | 19.2 | 26.1 | 24.2 | 22.5 | ||||||||||
6 | H. helena | Alaska | 25.7 | 28.2 | 28.5 | 23.5 | 21.5 | |||||||||
7 | H. macrotuberculata | Ontario | 22.7 | 29.9 | 29.4 | 29.3 | 21.1 | 28.6 | ||||||||
8 | H. socialis | Estonia | 23.0 | 26.8 | 26.9 | 29.0 | 24.3 | 24.3 | 27.7 | |||||||
9 | H. reticulata | Japan | 30.3 | 34.8 | 34.2 | 32.2 | 26.3 | 28.4 | 28.4 | 31.4 | ||||||
10 | H. sensilis | Ontario | 23.6 | 28.0 | 25.6 | 18.9 | 23.7 | 23.0 | 28.8 | 26.9 | 35.4 | |||||
11 | H. variata sp. nov. | Magadan | 23.0 | 26.8 | 26.9 | 29.0 | 24.3 | 24.3 | 27.7 | 25.2 | 31.4 | 26.9 | ||||
12 | H. subboldorii | France | 21.4 | 28.3 | 23.3 | 23.6 | 24.0 | 24.9 | 24.4 | 26.2 | 34.2 | 22.6 | 26.2 | |||
13 | H. tooliki | Alberta | 26.6 | 28.3 | 27.6 | 25.0 | 28.3 | 26.0 | 28.3 | 27.2 | 28.3 | 25.4 | 27.2 | 26.1 | ||
14 | H. vernalis | France | 27.0 | 24.6 | 25.3 | 26.2 | 26.5 | 27.7 | 23.8 | 28.7 | 36.6 | 23.9 | 28.7 | 27.6 | 27.6 | |
15 | H. viatica | Churchill | 24.2 | 26.2 | 24.8 | 18.1 | 23.4 | 25.3 | 31.4 | 26.6 | 36.4 | 15.9 | 26.6 | 22.7 | 30.0 | 26.0 |
Hypogastrura variata sp. nov. was collected in two neighbouring sites located on the northern shore of the Sea of Okhotsk, both in the vicinity of Magadan. It seems to inhabit a narrow belt of mudflat maritime marshes, i.e., a monodominant plant association Puccinellietum phryganodis, where it achieves very high abundance levels and is the most common collembolan species. Its occurrence in all other types of marsh in the study area was sporadic.
Syn.: Hypogastrura sheyangensis Jiang, Tang & Chen, 2007.
Russia • 3 ♂♂, 9 ♀♀ (slides) and ~ 50 specimens (alcohol); Kuril Islands, Kunashir; 43°42.91'N, 145°33.20'E; wrack beds; August 2017; K. Makarov leg. Several specimens from this material were sequenced (Table
Both recent descriptions (
Holotype
Russia, North-East • ♂; Magadan Province, “Magadan–Ola Road (closer to Ola) [~ 59°35.25'N, 151°08.00'E]; treeless bog with Ledum, Arctostaphylos, Empetrum, and Betula vegetation (sample taken in Carex and moss), 20.07.1979”; V. Behan leg. The type is deposited in
A species of chaetotaxic group VI (b) of the genus Xenylla Tullberg, 1869, characterised by the presence of one sublobal seta on the maxillary outer lobe and a complete reduction of both furca and retinaculum.
Holotype length 0.67 mm. Intravital colour unknown, holotype stored in alcohol for more than 30 years completely lacks dark pigment even on the eye fields. Tegument granulations rather fine and uniform. Ant.4 with a simple apical vesicle and four blunt sensilla (one dorsal and three lateral), rather short and subequal in size, both subapical microsensillum and organite invisible due to the poor condition of the slide. AO typical of the genus, outer sensilla rather short. Ant.1 and Ant.2 with seven and eleven setae, respectively.
Head with 5+5 subequal ocelli, as usual. Buccal cone typical of the genus, not elongate. Setal formula of labrum, 4/554, setae of distal row clearly thickened. Labium with all common papillae (A–E), 9 guards (five long and four short, truncate and papillate) and six proximal setae. Basomedial field of labium (submentum) with four setae, basolateral field (mentum) with five setae, as usual. Maxillary outer lobe simple, with one sublobal seta.
Most dorsal setae stout, finely ciliate and clearly differentiated into finer microsetae and subspiniform macrosetae, sensilla usually long and straight, especially on abdominal tip and laterally on Th.2 and Th.3 (Figs
Ventral tube with 4+4 setae. furca and retinaculum completely absent. Tibiotarsi of legs 1–3 with 19, 19, and 18 setae, respectively; all setae of distal whorls (A+T) more or less clearly clavate (Figs
The name of the new species is derived from the Latin aculeata, meaning spiny, to reflect the shape of the dorsal macrosetae characteristic of X. aculeata sp. nov.
The chaetotaxic pattern of X. aculeata sp. nov. allows us to include it into group VI (b), although a forward position of both p1 and p2 on Th. 2 and Th.3 appears to be unique to the new species. There is only one other species in the group that has neither a furca nor a retinaculum, viz. X. osetica Stebaeva & Potapov, 1994. Yet the latter species can easily be distinguished from X. aculeata sp. nov. by the presence of three sublobal setae on the maxillary outer lobe (vs. one in X. aculeata sp. nov.) and a complete chaetotaxy of Th.2 and Th.3 with setae al1 and m3 being present (absent in X. aculeata sp. nov.). Thus latter character (the absence of setae) seems to point to the relations between X. aculeata sp. nov. and several other congeners of the same group that share a functional furca with one (X. betulae Fjellberg, 1985) or two dental setae (X. corticalis Börner, 1901, X. grisea Axelson, 1900, X. hexagona Fjellberg, 1992, and X. laurisilvae Fjellberg, 1992). Among these species, only X. betulae has hitherto been known from the region under study. It appears to be rather similar to the new species in having an identical dorsal chaetotaxy including such fine characters as short sensilla in p-row on Th.2–Abd.1 and the usual absence of setae p5 from Abd.1 and of setae p7 from Abd.4. Ventral chaetotaxy (the absence of p2 from Abd.2 and of some m-setae from Abd.4, the presence of axial unpaired setae on Abd.3), the rather strong anal spines, and the long stout setae on the abdominal tip are also similar. Apart from the complete absence of a furca, X. aculeata sp. nov. differs from X. betulae in having much finer tegument granulation, coarser and more clearly differentiated dorsal setae, only one sublobal seta on the maxillary outer lobe (vs. two sublobals in X. betulae), p1-setae in an anterior position on Th.2 and Th.3, and numerous clavate setae on tibiotarsi (vs. 2–2–2 in X. betulae). The latter character appears to be unique in the genus, but needs verification based on fresh material.
The only known specimen of X. aculeata sp. nov. was found in a typical swampy association of the region, but a search in similar communities in the same area failed to reveal additional material. Taking this into account, as well as some morphological traits of the new species, namely the complete reduction of a furca and the presence of numerous clavate tibiotarsal setae, X. aculeata sp. nov. can be assumed to rather represent a corticicolous, not hygrophilous, species.
Holotype Russia, North-East • ♂; Magadan Province, Tauisk; 59°43.66'N, 149°21.85'E; coastal meadow; July 2017; M. Bizin and B. Efeykin leg.
Paratypes
Russia, North-East • 5 ♀♀ and 5 ♂♂, same data as for holotype. The types are deposited in
more than 500 specimens (alcohol), mainly from the holotype locality; Several specimens from this material were sequenced (Table
A species from chaetotaxic group II of the genus Xenylla with a general chaetotaxic code of h1rt, characterised by a light brownish colour, non-differentiated dorsal setae, and the absence of a prominent cuticular lobe from the subcoxae of hind legs.
Length 1.4–1.7 mm. Colour rather light, yellow-brown (chamois), with patches of diffuse darker pigmentation, ocular field and antennal tip dark, ventral side usually paler. Tegument granulation fine and almost uniform. Ant.4 with a simple apical vesicle and four blunt sensilla (one dorsal [S3 or S4?] and three lateral [S7–S9]), relatively short and subequal in size, both a subapical microsensillum and an organite are present. AO typical of the genus, outer sensilla thinner than subapical ones, but not especially short (1:1.2–1.8, Fig.
Head with 5+5 subequal ocelli, as usual. Buccal cone typical of the genus, not elongate. Setal formula of labrum, 4/554, setae of distal row clearly thickened. Labium with all common papillae (A–E), 12 guards (eight long and four short, rhabdoid, papillate) and six proximal setae (Fig.
Dorsal setae fine, thin, and barely differentiated (except for those on Abd.6), tergal sensilla clearly longer than ordinary setae (~ 3.2–3.4:1), dorsal and lateral sensilla on Th.2 and Th.3 subequal. Head with a basic set of setae (Fig.
Ventral tube with 4+4 setae. Retinaculum with 3+3 teeth. Furca complete, both dens and mucro thin, long, and clearly separated ventrally. Mucrodens/U3 ratio as 2.6–2.9:1. Dens with two dorsal setae (Fig.
Xenylla arnei sp. nov. 36 dorsal chaetotaxy of head and thorax 37 dorsal chaetotaxy of Abd.4–6 38 labial palp 39 sensorial equipment of Ant.3 and Ant.4 40 maxillary head 41 ventral chaetotaxy of Abd.2 and Abd.3 42 tip of leg 3 43 dens and mucro, lateral view 44 mucro, dorsal view 45 dens and mucro, ventral view. Scale bars: 0.1 mm (36, 37, 41), 0.01 mm (38–40, 42–45).
The new species is named after the famous Norwegian collembologist, Arne Fjellberg, who discovered it in the Magadan Region more than 40 years ago.
Using the most recent key to the Asiatic species of the genus (
K2P distances in Xenylla species from GenBank and our sequences, measured in %.
Species | Region | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | X. humicola | Magadan | |||||||||||||
2 | X. humicola | Vaigach | 0.6 | ||||||||||||
3 | X. humicola | Estonia | 0.9 | 1.2 | |||||||||||
4 | X. betulae | Ontario | 28.0 | 27.9 | 30.1 | ||||||||||
5 | X. boerneri | UK | 25.0 | 25.4 | 23.1 | 28.6 | |||||||||
6 | X. brevisimilis | Ontario | 27.5 | 27.1 | 26.4 | 24.8 | 25.8 | ||||||||
7 | X. canadensis | Ontario | 30.4 | 30.8 | 28.8 | 26.2 | 31.2 | 30.7 | |||||||
8 | X. grisea | Antarctica | 25.7 | 25.4 | 24.0 | 32.3 | 23.7 | 26.1 | 26.7 | ||||||
9 | X. maritima | Ontario | 22.3 | 22.7 | 21.1 | 34.9 | 18.8 | 30.3 | 34.5 | 27.4 | |||||
10 | X. mediterranea | Ontario | 28.1 | 28.5 | 26.2 | 27.9 | 30.4 | 29.1 | 27.2 | 23.9 | 26.3 | ||||
11 | X. pomorskii | Poland | 28.6 | 28.2 | 29.5 | 24.6 | 25.7 | 24.7 | 28.7 | 28.7 | 29.6 | 27.1 | |||
12 | X. szeptyckii | Poland | 22.7 | 23.1 | 24.6 | 30.0 | 23.7 | 28.0 | 33.5 | 24.7 | 22.2 | 28.9 | 28.7 | ||
13 | X. arnei sp. nov. | Magadan | 22.9 | 22.6 | 23.4 | 29.1 | 22.2 | 22.9 | 25.9 | 25.2 | 26.1 | 26.7 | 24.4 | 25.3 | |
14 | X. tullbergi | France | 22.4 | 22.8 | 23.1 | 28.7 | 24.5 | 27.7 | 31.0 | 24.7 | 22.1 | 27.8 | 28.3 | 19.1 | 22.7 |
Xenylla arnei sp. nov., together with the widespread X. humicola and the Japanese X. brevispina Kinoshita, 1916 [h1rtsv], represent the only known Holarctic members of the species group II (
All other species of this group, viz. X. yukatana Mills, 1938 [h1tiqa3a4], X. gamae Cardoso, 1968 [h1tiq], X. nigeriana Gama & Lasebikan, 1976 [h1tiqsoa3], X. brasiliensis Gama, 1978 [h1rtlq], and X. nirae Gama & Oliveira, 1994 [h1rtlqiomu], are characterised by more strongly reduced chaetotaxy patterns and inhabit various tropical regions.
GenBank currently contains COI sequences for only eleven species of the genus (of 140 species known worldwide). The obtained interspecific divergences (Table
Xenylla arnei sp. nov. was collected in two neighbouring sites located on the northern shore of the Sea of Okhotsk, in the vicinity of Magadan. In this region, it was mainly found in various herbaceous meadows at some distance off the coastal line, where its abundance may be very high. Its occurrence in all other types of coastal plat associations in the study area was rather sporadic.
We would like to express our sincere gratitude to D. Berman (IBPN RAS) and N. Petrunina, without whose help our work in the Magadan Region would have been much more difficult. We are also much indebted to K. Makarov (
The paper has been supported through the Programs “Biodiversity and Natural Resources of Russia” and “Biosphere evolution” of the Presidium of the Russian Academy of Sciences.