Research Article |
|
Corresponding author: Erik J. van Nieukerken ( nieukerken@naturalis.nl ) Academic editor: Donald Lafontaine
© 2015 Erik J. van Nieukerken, Henk Geertsema.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
van Nieukerken EJ, Geertsema H (2015) A new leafminer on grapevine and Rhoicissus (Vitaceae) in South Africa within an expanded generic concept of Holocacista (Insecta, Lepidoptera, Heliozelidae). ZooKeys 507: 41-97. https://doi.org/10.3897/zookeys.507.9536
|
A grapevine leafminer found recently in table grape orchards and vineyards in the Paarl region (Western Cape, South Africa) is described as Holocacista capensis sp. n. It has also been found on native Rhoicissus digitata and bred on that species in the laboratory. It is closely related to Holocacista salutans (Meyrick, 1921), comb. n. (from Antispila), described from Durban in KwaZulu-Natal, but widespread in southern Africa and a native leafminer of various Vitaceae: Rhoicissus tomentosa, R. digitata, R. tridentata and Cissus cornifolia. Holocacista capensis has been found on Vitis vinifera both in Gauteng and Western Cape, the earliest record being from 1950 in Pretoria. The initial host shift from native Vitaceae to Vitis must have occurred much earlier. The species is sometimes present in high densities, but hitherto no sizeable damage to the crops has been noted. The genus Holocacista Walsingham & Durrant, 1909, previously known from the single European grapevine leafminer H. rivillei (Stainton, 1855), is expanded and redescribed and for the first time reported from Africa, East and South-East Asia and Australia. It comprises seven named species and at least 15 unnamed species. The following species are also recombined with Holocacista: transferred from Antispilina: South-African H. varii (Mey, 2011), comb. n., feeding on Pelargonium, transferred from Antispila: the Indian species H. micrarcha (Meyrick, 1926), comb. n. and H. pariodelta (Meyrick, 1929), comb. n., both feeding on Lannea coromandelica, and H. selastis (Meyrick, 1926), comb. n. on Psychotria dalzelii. We also remove the following from Antispila: Heliozela anna (Fletcher, 1920), comb. n. and H. argyrozona (Meyrick, 1918), comb. n., whereas the following Indian Vitaceae feeding species are confirmed to belong in Antispila s. str.: Antispila argostoma Meyrick, 1916 and A. aristarcha Meyrick, 1916. Holocacista salutans and H. varii are redescribed and diagnosed against H. capensis and other South African Heliozelidae. DNA barcodes are provided for 13 species of Holocacista.
Host shift, leafminers, Vitaceae, viticulture, table grapes, Rhoicissus, Cissus, DNA barcode, genitalia, Holocacista, Antispilina, Antispila, Afrotropics, South Africa, Zimbabwe, India
The occurrence of leafmining Lepidoptera on cultivated grapevine has until recently been a minor economic problem, with just some damage in European viticulture by the native Holocacista rivillei (Stainton, 1855) (
In 1990 some cocoons of an unknown leafminer infesting vines grown on the experimental farm in Roodeplaat, Pretoria, were submitted by Miss S. Marais to HG. Together with moths reared in March 1998 from urban vines in Oudtshoorn (Western Cape), these were examined during a visit in March 1999 by Dr. Vári in Pretoria, who identified them tentatively as a possible species of Antispila Hübner, 1825, on the basis of the type of mine and external features. After Dr J. De Waal (Dow Chemicals) brought some infested vine leaves from a commercial table grape farm near Paarl, a visit by HG showed considerable infestations in local table grape orchards, ranging from Somerset-West to Paarl in the Western Cape. As the presence of the moth, especially on grapes destined for export, could pose serious economic problems, even though the infestation did not yet result in real damage to the crop, its potential future risks required further study of the identity of the leafminer and of its life history and infestation ecology.
The Heliozelidae are a small family of primitive Monotrysian moths, of which most species make leafmines as larvae, with 124 named species globally (
The African fauna of Heliozelidae is virtually unknown, only four species have been named to date, three of which are from South Africa. The fourth, Antispila merinaella Paulian & Viette, 1955, described from Madagascar (
The late Lajos Vári (Pretoria) devoted a large part of his life to the study of leafmining Lepidoptera of southern Africa, which he extensively collected and reared between 1950 and 2007 (
Larvae, cocoons and adults of Holocacista capensis were collected in various table grape orchards, vineyards and weedy growth of grapevine in the Paarl region, several other localities in the Western Cape and at Roodeplaat, north of Pretoria. We selected the Holotype from our recent reared material, so that the name unequivocally refers to the grapevine leafminer, and to couple its morphology with DNA data. Although the description is based on multiple specimens, we refrain from selecting paratypes as they have no name-bearing function (
The extensive collections in the Ditsong Museum of Natural History (formerly Transvaal Museum, Pretoria) formed the basis for most of the present taxonomic studies, together with our newly collected material. The majority of the Pretoria material was collected and reared by Lajos Vári. The material comprises three important sources:
Dry pinned collection of adults. These are usually rather poorly labelled, with only a locality name (often in capitals), sometimes followed by a second indication of the locality, the handwritten date of emergence of the adult, sometimes the name of the collector followed by an Ac. no. [Accession number] followed by a handwritten number. There are no further details, no hostplant names nor original collection dates (unless it has been collected as an adult). In the collection, which is organised in unit trays, often a single example of a leaf with mines is pinned next to the reared moths, usually with a handwritten number on the leaf.
Herbarium of leafmines. The original collection was stored in simple open envelopes with a number, sometimes with a small label inside, but often not. The majority of this collection has later been mounted by collection staff onto herbarium sheets, partly glued to the sheet and mounted with white strips. The Ac. numbers are also written on these sheets, sometimes with additional information.
Notebooks of Lajos Vári. This is an essential source to reconstruct the hostplant data, detailed localities and collection data. They also give insight in Vári’s concepts of the species he collected; he often gave manuscript names, sometimes changed subsequently and referring to earlier numbers when he considered hostplants or moth species to be identical. The Ac. numbers from the labels provide access to the notes; these numbers only refer to Vári’s material and are not a general numbering for the museum.
The data we present under material and in Suppl. material
For understanding the generic composition of the genus Holocacista, we studied several Heliozelidae available to us, and examined a number of Indian species described by Meyrick, that were potential candidates to belong to this genus.
Details on all studied specimens, including those sequenced, are given as an Excel sheet in Suppl. material
ARC-PPRI Agricultural Research Council – Plant Protection Research Institute, Pretoria, South Africa
BMNH Natural History Museum, London, UK [for slides only the abbreviation BM is used]
EvN E.J. van Nieukerken [for slide and rearing numbers]
HG Personal collection of H. Geertsema, Stellenbosch, South Africa
ISAM Iziko South African Museum, Cape Town, South Africa
JCK J.C. Koster [for slide numbers]
MHUB Museum für Naturkunde, Berlin, Germany
RMNH Naturalis Biodiversity Center, Leiden, The Netherlands
TMSA Ditsong National Museum of Natural History (formerly Transvaal Museum), Pretoria, South Africa [for slides only the abbreviation TM is used]
USEC University Stellenbosch Entomology Collection, Stellenbosch, South Africa.
Leaves with active mines were cut to smaller pieces and placed in small plastic containers for rearing. After the shields had been exscinded and the larvae had left the mines, the leaves were removed to avoid moulding, and examples of leafmines were dried in a plant press. Often the larvae in their shields needed some ‘assistance’ with forceps in order to remove them from the leaf fragments, probably because the low turgor pressure in the leaf fragments made it difficult to exit in the natural fashion, where a higher turgor pressure facilitates the release of the shield. The larval shields and the resulting cocoons were kept with some paper tissue in closed containers, and a little moisture added from time to time until emergence of the moths. Emergence from cocoons kept in this way was abundant.
Methods for preparation of the genitalia follow
Morphological terminology follows other recent treatments of Heliozelidae (
Photographs of mounted moths were prepared using an AxioCam digital camera attached to a motorized Zeiss SteREO Discovery V12, using the Module Extended Focus in the Carl Zeiss AxioVision software to prepare a picture in full focus from a Z-stack of about 10 to 25 individual photos. Leafmines and live adults were photographed with a similar camera on a manually operated Zeiss Stemi SV11 stereo-microscope, without extended focus, or with extended focus prepared from just a few exposures. Genitalia and wing slides were photographed with a similar camera on a manually operated Zeiss Axioskop H, usually with just a single exposure. Leafmines were examined and photographed with dark field illumination. Field photographs were taken with a Canon EOS camera.
Photographs were edited with Adobe Photoshop®, avoiding any change to the real object, but backgrounds were cleaned from excess debris; also some protruding scales were digitally removed from the denuded wings in Figs
Host plant names of South African plants follow
DNA was extracted non-destructively from larvae in ethanol 96% or adult abdomens (
A 665 bp or a 658 bp fragment of the mitochondrial CO1 gene, the DNA barcode, was amplified. PCR conditions and primers are described in our earlier studies (
The sequence data generated and used in this study have been deposited in the public BOLD dataset “Holocacista leafminers [DS-HOLOCAC]” [http://dx.doi.org/10.5883/DS-HOLOCAC] and GenBank, they are listed with all details in the table with all studied specimens (Suppl. material
Neighbor joining trees were prepared with the tools provided on the Boldsystems website (
Monthly field visits to the infected vineyard at De Akker (Paarl South) were conducted between February 8 and May 11, 2012, and again from November 2012 to May 2013. From 2013 the vineyard at De Heuvel estate was also visited regularly. At monthly intervals, leaf samples (n = 100) were randomly collected from selected vineyards. Leaves were classified into three size groups, viz. large (older), medium and small (young), and numbers of mines (developing, containing shields or larvae, or holes) were noted to determine any preference for the major table grape cultivars and to determine variation in the population density throughout the grape season.
During 23–25 March 2012, a survey of vineyards between Worcester and Swellendam was carried out, as well as a search for signs of heliozelid leafmines on Rhoicissus Planch. species present on the periphery of indigenous temperate forest in the Swellendam district. Search for those mines was repeated in 2013 and 2014, but no live moths were found or reared.
Moths reared from the grapevine leafmines were compared with other available adult Heliozelidae, and the similarity with European Holocacista rivillei became immediately apparent, particularly by the remarkable curved spine on the phallus, but also by venation and colour pattern. Comparison with the three named South African species also showed similarity to the species Antispila salutans Meyrick, 1921 and Antispilina varii Mey, 2011, and for some time we used the name “Holocacista salutans”. However, a detailed analysis of genitalia and comparison with material reared by Lajos Vári, made it clear that our grapevine feeder was neither of these species, but closely resembled a single population reared by Vári from leafmines on Rhoicissus digitata (L.f.) Gilg. & M.Brandt. On the basis of the morphological similarity with Holocacista rivillei (genitalia and wing venation) and an initial molecular phylogeny (data not presented here), it was clear that the new species belongs to the same clade as H. rivillei and not to the clade that comprises either the type species of Antispila Hübner, [1825] (viz. A. metallella ([Denis & Schiffermüller], 1775) or the clade with the type species of Antispilina Hering, 1941 (A. ludwigi Hering, 1941). Since this clade comprises several moths with similar morphology, we enlarge the genus Holocacista here and describe the grapevine leafminer as a new species. We therefore also redefine the genus Holocacista here and newly combine several species with it.
Holocacista Walsingham & Durrant, in
Holocacista;
Very small moths, wingspan between 3 and 5 mm, usually with a pattern of metallic-silvery spots, but in some species not metallic, typically comprising a dorsal and costal spot at 1/4 sometimes united into a fascia and a postmedial fascia, which also may be broken into two spots. In some species part of this pattern is absent. Males never with androconial scales or hair-pencils. Separated from externally somewhat similar Antispila species by the reduced venation (Figs
Adults. Very small moths, forewing length ca. 1.5–2.5 mm (wingspan ca. 3–5 mm).
Head (Figs
Thorax. Vestiture of appressed lamellar scales, usually concolorous with ground colour of forewings. Foreleg with small but distinct epiphysis of about 36–48 μm in H. rivillei (Fig.
Wings. Male retinaculum a series of 7–12 hook-shaped bristles, arising from a thickened serrate portion of Sc. Frenulum in male a strong curved bristle (e.g., Fig.
Venation in forewing (Figs
Wing pattern (Figs
Pregenital abdomen. Abdominal sclerites weakly sclerotised. Anterior sternum II subtriangular, free.
Male genitalia. Vinculum (S IX) very long, anteriorly often reaching beyond anterior margin of segment VI, almost cylindrical; tegumen (TIX) narrow, usually with a medial posterior process, probably a composite structure with uncus. Gnathos absent. Valva rather narrow, with stalked pectinifer halfway to inner margin, pecten comprising 6–12 blunt sensilla; transtilla typically with medial anterior projection, sublateral processes long. Phallocrypt (manica) with some to many strongly-sclerotised conical spines, often arranged in an asymmetric fashion, or with many smaller spines. Phallus outer tube often with remarkable ventrally-curved appendix on phallus, or appendices of different sizes and shapes. Juxta present and often bilobed or reduced to narrow ventral process.
Female genitalia. SVIII pointed, T VIII deeply indented. Oviscapt with few lateral cusps. Anterior and posterior apophyses subequal in length. Spermathecal papilla usually with circular sclerotisation. Ductus spermathecae with many coils.
Larva. Larvae yellow or whitish, usually with darker head capsule. Larva of H. rivillei described in detail by
Hostplants. Several species feed on Vitaceae and Rubiaceae, a few species on Anacardiaceae, and single species each on Balsaminaceae, Dilleniaceae, Geraniaceae and Plumbaginaceae. A species feeding on Combretaceae is tentatively added, but this requires confirmation.
Life history. Eggs are inserted in leaf tissue, often near a vein or leaf margin. All species construct leafmines (Figs
Mainly Old World tropics and subtropics: Afrotropical, Oriental and Australian regions, north to Taiwan and southern Europe (type species). Some DNA barcodes suggest that the genus also occurs in South and Central America, but no adults have yet been studied from this area.
The species listed in the checklist below, both named ones and unnamed ones, share the external and venation characters described above, and those dissected also the male genitalia characters. Those species that we have been able to sequence form a well-supported clade in a phylogenetic analysis (both Bayesian and Maximum Likelihood) of the Heliozelidae based on four genes (unpublished study in progress), as part of a larger clade of genera with reduced venation (including also Antispilina Hering, 1941, Coptodisca Walsingham, 1895 and the “Antispila” ampelopsifoliella group). While checking several Indian species described by Meyrick, we could also change the following generic assignment: Heliozela anna (Fletcher, 1920), comb. n. (from Antispila, feeding on Myrtaceae) (Figs
In the checklist below we provide the original genus in brackets, type locality, and the hostplant of the types. The species are listed geographically, first the named ones, then the unnamed ones.
Palearctic species
H. rivillei (Stainton, 1855): p. 89 (Elachista)
Malta, Vitis vinifera L. [type species]
African species
H. capensis van Nieukerken & Geertsema, sp. n.
South Africa, Western Cape, Paarl, Vitis vinifera L.
H. salutans (Meyrick, 1921): p. 108, comb. n. (Antispila)
South Africa, [Kwazulu Natal], Durban, [Rhoicissus sp.]
H. varii (Mey, 2011): p. 156, comb. n. (Antispilina)
South Africa, Western Cape, Cape Town, Pelargonium cucullatum (L.) L’Hérit.
Asian species
H. micrarcha (Meyrick, 1926): p. 261, comb. n. (Antispila)
India, [Karnataka], Karwar, Lannea coromandelica (Houtt.) Merr. (=Odina wodier Roxb., Anacardiaceae)
H. pariodelta (Meyrick, 1929): p. 541, comb. n. (Antispila)
India, Bihar, Pusa, Lannea coromandelica (Houtt.) Merr. (=Odina wodier Roxb., Anacardiaceae)
H. selastis (Meyrick, 1926): p. 261, comb. n. (Antispila)
India, [Karnataka], Karwar, Psychotria dalzellii Hook.f. (Rubiaceae)
Unnamed species:
Palearctic species
sp. Dyerophytum_UAE
United Arab Emirates, Fujairah, Dyerophytum indicum (Gibbs ex Wight) Kuntze (Plumbaginaceae)
African species [see also Appendix A]
sp. Rhoicissus_tridentata
South Africa, Rhoicissus tridentata subsp. cuneifolia (Eckl. & Zeyh.) Urton, R. tomentosa (Lam.) Wild & R.B.Drumm. (Vitaceae)
sp. Rhoicissus_tomentosa
South Africa, Rhoicissus tomentosa (Lam.) Wild & R.B.Drumm. (Vitaceae)
sp. Rhoicissus_PundaMilia
South Africa, Rhoicissus digitata (L.f.) Gilg. & M.Brandt (Vitaceae)
sp. Cissus_integrifolia
South Africa, Cissus integrifolia (Baker) Planch. (Vitaceae)
sp. Lannea_SA
South Africa, Lannea discolor (Sond.) Engl. (Anacardiaceae)
sp. Terminalia_SA [placement tentative]
South Africa, Terminalia prunioides M.A. Lawson (Combretaceae)
Asian species
sp. Leea_Borneo
Indonesia, Kalimantan Timur, Leea indica (Burm.f.) Merr. (Vitaceae)
sp. Impatiens_Vietnam
Vietnam, Cuc Phuong NP, Impatiens clavigera Hook. f. (Balsaminaceae)
sp. Lasianthus_Borneo
Indonesia, Kalimantan Timur, Lasianthus Jack sp. (Rubiaceae)
sp. Lasianthus_Sabah
Malaysia, Sabah, Lasianthus Jack sp. (Rubiaceae)
sp. Paedaeria_Taiwan
Taiwan, Paederia foetida L. (Rubiaceae)
Australian species
sp. Psychotria_Australia
Australia, Queensland, Psychotria simmondsiana F.M.Bailey (Rubiaceae)
sp. Morinda_Australia
Australia, Queensland, Morinda jasminoides A.Cunn. (Rubiaceae)
sp. Hibbertia_Australia
Australia, West Australia, Hibbertia Andrews (Dilleniaceae)
Elachista rivillei Stainton, 1855: 89.
Holocacista rivillei;
The type species of Holocacista has recently been diagnosed in the context of a study of European (and North American) Vitaceae miners (
(Fig.
Male genitalia (Fig.
Host plants. Vitaceae: Vitis vinifera, wild and cultivated, possibly also on cultivated Parthenocissus Planch. (new record from Russia, Kalmykiya).
Leafmines (Figs
Widespread in southern Europe, Turkey and Central Asia (
Adults and leafmines: Bulgaria: 1♂, 7 adults [sex not determined], Sliven, 5.iv.1928, P. Tschorbadjiev, Genitalia slide JCK7867 (coll. Natural History Museum Sofia). Italy: 28 adults (4♂, 1♀ dissected), Vicenza, Borghetto, experimental vineyard, leafmines on Vitis vinifera, 2007, emerged i–ii.2009, M. Baldessari (RMNH); 1♂ (dissected), 7♀, many leafmines, larvae, ibidem, 19.viii.2013, EvN2013904, emerged 11.ix–3.x.2013, M. Baldessari (RMNH). Russia: leafmines only, Kalmykiya, Elista, Citypark, 26.ix.2000, leafmines on Parthenocissus, V. Zolotuhin (coll. Zolotuhin).
Antispila sp.
Holotype male, South Africa (Western Cape), Paarl NW, De Heuvel estate, 180 m, 16.i.2013, leafmines on Vitis vinifera cv ‘Regal’, EvN2013004, emerged 27.i.2013, E.J. van Nieukerken & H. Geertsema, Genitalia slide EvN4622, DNA extracted (RMNH.INS.24622) (RMNH).
Externally Holocacista capensis is almost inseparable from other South African Vitaceae-feeding Holocacista species, including H. salutans. Absence or reduction of the first costal spot in the male, however, may be an indication that the specimen might be H. capensis; only study of genitalia allows a firm identification. For differences with H. varii, see there. The only South African Vitaceae-feeding “real” Antispila species is much larger and has more antennal segments (ca. 26). In male genitalia the configuration of the small number of spines on phallocrypt in combination with the ventrally curved phallus appendix is characteristic, otherwise very similar to H. salutans and some of the unnamed Rhoicissus miners. Leafmines characterised by the very contorted first part of the mine, which is straighter or shorter in the other species; currently the only known leafminer on Vitis in South Africa.
Male (Figs
Female (Fig.
Measurements. Male: forewing length 1.8–2.3 mm (2.0 ± 0.1, 20) (1 dwarf of 1.55 mm forewing length excluded), wingspan: 3.9–4.9 mm. Female: forewing length 1.9–2.1 mm (2.0 ± 0.1, 14), wingspan 4.0–4.6 mm.
Male genitalia (Figs
Female genitalia (Figs
Host plants. Vitaceae: Rhoicissus digitata (L.f.) Gilg. & M. Brandt and various South African grown cultivars of Vitis vinifera (e.g., Chardonnay, Chenin Blanc, Red Globe, Régal).
Leafmines (Figs
The moth is multivoltine; the first adults appear during early spring (September to October) and a single generation lasts from three to four weeks; peak numbers are reached during February and March at the height of the grape picking season. Moths are still present in April; the last were seen early May; many cocoons overwinter in leaf litter, dropping to the ground and pupating amongst leaf litter or attached to stems and trellises from April onwards, and yielding moths from September onwards. Larvae are present almost continuously from November to early May when the leaves start to wither and drop. Larvae have only once been collected on Rhoicissus, these in March. When fully grown, larvae descend from the mines to attach their cocoons upon landing on a variety of objects such as other leaves, berries of grape bunches, trellises or on the bark of the vine itself (Fig.
Moths aggregate and mate in the heat of the day (1100–1400 hrs) on exposed vine foliage, but prefer to oviposit in the shaded canopy conditions under which table grapes are grown; wine grapes, grown in an open cultivation system and fully exposed to the sun are rarely, or at least less seriously attacked.
(Fig.
We barcoded eight specimens, including the Holotype. All barcodes belong to Barcode Identification Number (BIN):ACG9027, the largest intraspecific distance is 1.4%, between one specimen collected in Gauteng and the rest, collected in the Western Cape.
DNA-Barcode of Holotype, HELA103-14 (658 basepairs):
AACTTTATATTTTATTTTTGGTATTTGAGCGGGATTAGTAGGAACATCAATAAGTTTATTAATTCGTGCTGAATTAGGAATCCCTGGGTCCTTAATTTCTAATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCGTTAATATTAGGAGCCCCAGATATAGCATTTCCTCGTCTTAATAATATAAGTTTTTGACTCCTTCCCCCATCTTTAACATTATTAATTTCAAGAAGATTAGTTGAAATGGGATCAGGAACTGGATGAACTGTCTATCCACCTTTATCTTCCAATATTGCCCATATGGGAACTTCTGTGGATTTAACTATTTTTTCTTTACATTTGGCTGGAATTTCATCTATTTTAGGAGCTGTAAATTTTATTACAACAATTATTAATATAAAACCAGTTAGAATAATATATAATCAACTTTCTTTATTTGTTTGATCTGTGGGTATTACAGCTTTATTACTATTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCTTTTTTTGACCCTATGGGAGGAGGAGACCCTATTCTATATCAACATTTATTT
The only wild Rhoicissus on which mines of H. capensis were collected, was identified by Vári in his notebook as R. revoilii. The single leaf we studied could belong to this species or to R. digitata, which is very similar. On the basis of the distribution (
Several reared adults were used in 2013 for a rearing experiment on potted plants of Rhoicissus rhomboidea (E.Mey. ex Harv.) Planch., bought in the Netherlands. Although the adults lived for several days, no traces of mines were found. Either the species is unsuitable as a hostplant, or these potted plants contained remnants of insecticides. Later, we were more successful with rearing larval offspring from Vitis-grown adults from Wellington on potted Rhoicissus digitata in the laboratory in Stellenbosch (for resulting leafmines see Fig.
Other live cocoons were sent in 2013 to Lund, Sweden, emerged there, and have been used for pheromone studies (
Adults and leafmines: South Africa, Gauteng: 3♂, Pretoria, Roodeplaat, 1245 m, leafmines Vitis vinifera, emerged 10–12.x.1990, S. Marais, Genitalia slide EvN4264, DNA extracted (RMNH.INS.24264) (HG, RMNH); 3♂, 5♀, same locality, emerged 4–14.iv.2012, D. Visser (HG, RMNH); 2♀ [5 more specimens in TMSA], Pretoria, emerged 2–6.xi.1950, L. Vári, Genitalia slide TM6830, Wing slide TM 2414 (TMSA); 1♀ [1 more specimen in TMSA], 1 herbarium sheet with 6 leafmines on 4 leaves, Pretoria, 8.iii.1953, Ac. no. 660, leafmines on V. vinifera, emerged 10–31.iii.1953, L. Vári (TMSA); 1♂, 1♀, 1 herbarium sheet with ca. 13 leafmines in 4 leaves, Pretoria, in own garden, 21.x.1953, Ac. no. 866, leafmines on V. vinifera, emerged 26.x–3.xi.1953, L. Vári (TMSA); 1♂, larvae and leafmines, Roodeplaat exp. Farm, 1168 m, 23.i.2013, leafmines V. vinifera, EvN2013025–026, E.J. van Nieukerken & S. Richter, 1 larva DNA extracted (RMNH.INS.29586). Northern Cape: 9♂, 14♀ [unmounted], Vaalhartz Research Stn., Jan Kempdorp near Kimberly, 27.ii.1980 [emergence date?], W. v.d. Westhuyzen (TMSA). Western Cape: 2♂, 3♀, Cape Town, Woodstock, cocoons collected on V. vinifera, 26.ii.2012, emerged 5–13.iii.2012, M. Wohlfarter; 1♂, Oudtshoorn, March 1998, on urban vine, H. Geertsema (HG); 81♂, 58♀, Paarl, nr Windmeul, 168 m, leafmines/cocoons on V. vinifera, emerged 1.ii–30.iii.2012, H. Geertsema, Genitalia slides EvN4260♂, 4261♀, 4262♂, 4263♀; complete adults on slide EvN4445♂, 4446♂, 4447♂, DNA extracted (RMNH.INS.24260, 24261, 24262, 24263, 24445, 24446, 24447) (HG, RMNH); 3♂, 2♀, Paarl NW, Nelson estate, 125 m, 15.i.2013, leafmines on Vitis vinifera cv ‘Chenin Blanc’, EvN2013002, emerged 18.i–1.ii.2013, E.J. van Nieukerken & H. Geertsema; 6♂, 10♀, 4 larvae, ibidem, 130 m, leafmines on V. vinifera cv ‘’Chardonnay’, EvN2013003, emerged 24.i–5.ii.2013, Genitalia slide EvN4624♀, DNA extracted (RMNH.INS.24624), larvae RMNH.INS.2956265; 6♂, 11♀, 6 larvae, Paarl NW, De Heuvel estate, 180 m, 16.i.2013, leafmines on V. vinifera cv ‘Regal’, EvN2013004, emerged 20–27.i.2013, E.J. van Nieukerken & H. Geertsema, larvae RMNH.INS.29578–83; 2♂, 3♀, ibidem, leafmines on V. vinifera cv ‘Red globe’, EvN2013005, emerged 26.i–4.ii.2013; 1♂, 3♀, ibidem, 25.i.2013, leafmines on V. vinifera cv ‘Red globe’, EvN2013030, emerged 1–6.ii.2013, E.J. van Nieukerken & H. Geertsema (RMNH, HG); 5 adults, Somerset, 23.ii.2012, cocoons collected on V. vinifera, emerged 27.ii–5.iii.2012, O. Lotter; 1♀, Wellington, emerged 25.xii.2014, leafmines on V. vinifera, L. Torrance (HG). 3♂, 1♀ [8 more specimens in TMSA], 1 leaf with 6 mines, Wilderness, Kaaimans River, 15.iii.1954, Ac. no. 1093, leafmines on Rhoicissus digitata [in notebook Vári as R. revoilii], emerged 4–5.iv.1954, L. Vári, Genitalia slide EvN4381♂, DNA extracted (RMNH.INS.24381) (TMSA).
[leafmines and larvae collected, no adults kept in collection]. South Africa, Western Cape: 11♂, 21♀ [reared from 50 cocoons in Lund, Sweden and used for pheromone studies], Paarl NW, De Heuvel estate, 180 m, 25.i.2013, leafmines on Vitis vinifera cv ‘Regal’, EvN2013029, emerged 2–15.ii.2013, E.J. van Nieukerken & H. Geertsema; several adults, Wellington, emerged xii.2014, ex V. vinifera laboratory bred on R. digitata, L. Torrance (HG).
Antispila salutans Meyrick, 1921: 108. 5 Syntypes ♂♀: South Africa, [KwaZulu Natal], Durban, x.[19]18/19, v.d. Merwe (TMSA, BMNH) [partly examined].
Antispila salutans;
Externally H. salutans hardly differs from H. capensis, but the male usually has a costal spot at 1/3 from base, albeit very small. The only consistent characters to separate it from H. capensis are in the male genitalia: the row of larger spines dorsally on the phallocrypt, whereas H. capensis has a row ventrally and just a single spine ventrally; also the shape of the transtilla H. salutans differs from that in capensis. The leafmines of H. salutans have the gallery mine with wider frass, more clumped and not zigzag as in H. capensis.
Male (Fig.
Female. Antenna with 16 segments. Colour pattern distinct from male: scales almost uniformly dark fuscous with purplish tinge, resulting in darker, velvety wing colour and contrasting silvery-white pattern; first costal and dorsal spots always joined to form a narrow fascia, wider at dorsum; second dorsal and costal spots as in male; fringe line distinct, scales forming cilia line with slightly paler bases. Abdomen almost black, narrowly pointed posteriorly.
Measurements. Male: forewing length 1.7–2.3 mm (2.0 ± 0.2, 6), wingspan: 4.0–5.0 mm. Female: forewing length ca. 2.0 mm (n=3), wingspan ca. 4.5 mm.
Male genitalia (Figs
Female genitalia (Figs
Host plants. Vitaceae: Rhoicissus digitata (L.f.) Gilg. & M. Brandt, R. revoilii Planch., R. tomentosa (Lam.) Wild. & R.B. Drumm. and Cissus cornifolia (Baker) Planch. Records from R. tridentata subsp. cuneifolia (Eckl. & Zeyh.) Urton require confirmation (see below).
Leafmines (Figs
Voltinism. Larvae have been found from March to June, in September and again from December to January; adults usually emerge between 3–8 weeks after collecting of leafmines; probably multiple overlapping generations.
(Fig.
Unfortunately, we have not been able to find information on the rearing and hostplant of van der Merwe’s series. The Accession number 453 on some labels had previously been misinterpreted as a number of Vári, who labelled all his reared material with such numbers [probably following up on Janse’s system, but with new numbers]. The leaf with mines that was pinned in the salutans box belongs to Bridelia cathartica Bert. (Euphorbiaceae), has probable Coleoptera mines, and has Vári’s number 453. Obviously, this has nothing to do with the heliozelid. There are no notebooks of Janse left that could shed light on this number (Martin Krüger, personal communication).
Unfortunately, we did not find recent material of this species and are therefore as yet unable to give the DNA barcode.
Syntypes. South Africa, KwaZulu-Natal: 1♂, “DURBAN / 10.10 / v.d. Merwe 18/ Coll. Janse” [black print, date in hand, black cadre]; “24 / 93” [black print]; “Antispila /salutans /Type No. 109”[hand, red ink, “Type No” in print]. 1♂, “DURBAN / 10.10 / v.d. Merwe 18/ Coll. Janse” [black print, date in hand, black cadre]; “24 / 93” [black print];”Antispila /salutans /Cotype No. 111” [hand, red ink, “Cotype No” in print]. 1 adult, “DURBAN / v.d. Merwe xi.19/ Coll. Janse” [black print, black cadre]; “29/ 28” [black print]; “Antispila /salutans /Cotype No. 110” [hand, red ink, “Cotype No” in print]. 4 specimens including 2 possible Syntypes in London, not examined.
Adults and leafmines: South Africa, Kwazulu-Natal, 2♂, 1♀, Durban, emerged x and xi.1919, van der Merwe [ex coll. Janse], genitalia slide TM4023 (♂), wing slide TM1585 (♀); 5♂, 3♀, 1 leaf with 8 mines, Jozini Dam [Pongolapoortdam], Lebombo Mts., 14.i.1965, Ac. no 2788, leafmines on Rhoicissus tomentosa, emerged 27.i–5.ii1965, L. Vári, genitalia slides EvN4384 (♂),EvN4668 (♀); 1♂, 2♀, Umhlanga Rocks, 9–16.vi.1968, Ac. no 2944, leafmines on Rhoicissus revoilii, emerged 2–5.viii.1968, L. Vári; 1♂, 1♀, Umhlanga Rocks, 25.iii.1975, Ac. no 3342, leafmines on Rhoicissus revoilii, emerged 10–11.iv.1975, L. Vári, genitalia slide EvN4383 (♂); Limpopo: 1♂, 1♀, 1 leaf with 3 mines, Cyprus Farm, nr. Ofcolaco, 20.ix.1960, Ac. no 2247, leafmines on Rhoicissus tomentosa, emerged 11–13.x.1960, L. Vári; 6 leafmines on 6 leaves, Debengeni, De Hoek, Waterfalls, 15.vi.1954, Ac. no. 1329, leafmines on Rhoicissus revoilii, L. Vári; 1♂, 5 mines on 2 leaves, Louis Trichardt, 17.iii.1964, Ac. no 2693, leafmines on Rhoicissus tomentosa, emerged 31.iii–5.iv.1964, L. Vári. Zimbabwe, Masvingo: 2♂, 11 mines on 11 leaves, Lundi, 22.iv.1956, Ac. no 1916, leafmines on Cissus cornifolia, emerged 1–30.vi.1956, L. Vári; genitalia slide EvN4386 (♂) (all TMSA).
Antispilina varii Mey, 2011: 156. Holotype ♂ RSA, Cape Town, 26.3.1954, bred from Pelargonium cucullatum from slopes of the Table Mtn., Vári Ac. No. 1047, leg. 4.3.1954, L. Vári, genitalia slide Mey (TMSA) [not examined].
Holocacista varii is the only species similar to H. capensis that occurs probably commonly in the natural habitats near the grape growing areas of Western Cape and thus could potentially be confused with it. It is distinctly larger, and the forewings are more shining bronze than those of H. capensis. Moreover, the male and female have a complete fascia at 1/3 from forewing base that is not narrower at the costa and the antennae are not ringed. In male genitalia, H. varii lacks the larger spines on the phallocrypt, and has a more developed juxta; further, the dorsal row of spines on the tegumen is characteristic and the shape of the transtilla differs. The female genitalia have more elaborate sclerotisations, and the apophyses are longer.
Male (Fig.
Female (Fig.
Measurements. Male: forewing length 2.4–2.8 mm (2.5 ± 0.1, 6), wingspan: 5.0–5.7 mm. Female: forewing length 2.1–2.6 mm (n=3), wingspan 4.5–5.6 mm.
Male genitalia (Figs
Female genitalia (Figs
Host plants. Geraniaceae; most commonly found on Pelargonium cucullatum (L.) L’Hérit., a common plant in Fynbos of Cape Peninsula and the western part of the Western Cape; single records on P. panduriforme Eckl. & Zeyh., P. hispidum Willd. and P. citronellum J.J.A. Van der Walt.
Leafmines (Figs
Voltinism. Larvae are found between mid-September and April, and are apparently absent in winter; adults usually emerge between 3–6 weeks after collecting the larvae, suggesting there are multiple overlapping generations. The specimen from Worcester (October) is the only record of an adult taken in the wild.
(Fig.
We barcoded four specimens (three from Table Mountain, one from Stellenbosch), with a maximum intraspecific distance of 1.55%, within the same population on Table Mountain. The BIN is BOLD:ACG8941.
In the original description
Many of the specimens listed under material have only been briefly examined by EvN during his visit to the Ditsong Museum, hence the absence of indication of sex.
Eastern Cape: 1 adult, Zuurberg Pass, south slopes, 22.iii.1954, 11 mines, Pelargonium sp., 1 adult emerged 20.iv.1954, L. Vári (TMSA). Western Cape: 5 adults, Bloubergstrand, 3.x.1974, Ac. no. 3308, leafmines on Pelargonium, emerged 26–30.x.1974, L. Vári (TMSA); 2 adults, ibidem, 13.x.1975, Ac. no. 3496, leafmines on Pelargonium, emerged 14.xi.1975, L. Vári (TMSA); 6 adults, Cape of Good Hope Nature Reserve, 26.x.1966, Ac. no. 2851, leafmines on Pelargonium, emerged 21–23.xi.1966, L. Vári (TMSA); 8 adults, ibidem, Ac. no. 288527.x.1967, emerged 20–22.xi.1967, L. Vári (TMSA); 4 adults, Cape Peninsula, Bakoven, 29.x.1975, Ac. no. 3499, leafmines on Pelargonium, emerged 17–19.xi.1975, L. Vári (TMSA); 5 adults, Cape Peninsula, Hout Bay, 11.xi.1954, Ac. no. 1357 leafmines on Pelargonium cucullatum, emerged 7–21.xii.1954, L. Vári (TMSA); 2 adults (paratypes), ibidem, 14.ix.1966, Ac. no. 2846, emerged 21.xi.1966, L. Vári (TMSA); 10 adults (paratypes), Cape Peninsula, nr. Muizenberg, Steenberg, 10.xi.1979, Ac. no. 3764, leafmines on Pelargonium, emerged 15.xi–10.xii.1979, L. Vári (TMSA); 1♂, 1♀, 1 adult (paratypes), Cape Town, Kirstenbosch, 17.xi.1954, Ac. no. 1365, leafmines on Pelargonium cucullatum, emerged 11–14.xii.1954, L. Vári (MHUB, TMSA); 1 adult, ibidem, emerged 5–29.xii.1954, A.J.T. Janse (TMSA); 2 adults (paratypes), ibidem, 14.ix.1962, Ac. no. 2535, emerged 1–17.x.1962, L. Vári (TMSA); 1♂, 1♀, ibidem, 23.xi.2014, leafmines on P. citronelium, emerged 11.xii.2014, L. Torrance & H. Geertsema (USEC); 1♂, 1♀, ibidem, 23.xi.2014, leafmines on P. cucullatum, emerged 11–14.xii.2014, L. Torrance & H. Geertsema (USEC).
6♂, 4♀ (paratypes), 1 adult, Cape Town, slopes Table Mt., 4.iii.1954, Ac. no. 1047, leafmines on Pelargonium cucullatum, emerged 26.iii–3.iv.1954, L. Vári (TMSA); 9 adults, Noordhoek, leafmines on Pelargonium, pupa 10–14.v.1984, emerged 28–31.v.1984, H. Geertsema (TMSA); leafmines, Stellenbosch, Botanical Garden, 122 m, 27.i.2013, EvN2013032, leafmines on Pelargonium panduriforme, E.J. van Nieukerken (RMNH); 1 larva, ibidem, 27.i.2013, EvN2013033, leafmines on Pelargonium hispidum, E.J. van Nieukerken (RMNH); 3 larvae, Stellenbosch, Jonkershoek, 390 m, 18.i.2013, EvN2013017, leafmines on Pelargonium cucullatum, E.J. van Nieukerken & H. Geertsema (RMNH); 3♂, 4♀, 3 larvae, Table mountain NP, Cecilia, nr Klaasenskop, 385 m, 19.i.2013, EvN2013022, leafmines on Pelargonium cucullatum, emerged 11–22.ii.2013, E.J. van Nieukerken (RMNH); 1♂, 1♀, 1 larva, Table mountain NP, Cecilia, parking lot, 180 m, 19.i.2013, EvN2013024, leafmines on Pelargonium cucullatum, emerged 24.i–12.ii.2013, E.J. van Nieukerken & H. Geertsema (RMNH); 1♂, Worcester, Fairy Glen, 15–19.x.1966, L. Vári & Potgieter (TMSA).
Leafmines, observation, Western Cape, Ashton, 2014, L. Torrance & H. Geertsema.
Holocacista species, adult habitus. 1–3 Holocacista capensis: 1 Male holotype, RMNH.INS.24622 2 Female, Western Cape, Paarl, RMNH.INS.24624 3 Male, Western Cape, Wilderness, reared from Rhoicissus digitata, Genitalia slide EvN4381 4 H. salutans, male, Kwazulu-Natal, Umhlanga Rocks, reared from R. revoilii, Genitalia slide EvN 4383. Scales 1 mm.
Holocacista species, adult habitus. 5, 6 H. varii, Western Cape, Table mountain NP 5 Male, RMNH.INS.24623 6 Female RMNH.INS.24625 7 H. sp. Rhoicissus_tridentata, male, Zimbabwe, Mt. Selinda, Genitalia slide EvN4385 8 H. sp. Cissus_integrifolia, male, Zimbabwe, Lundi, Genitalia slide EvN4387 9 H. rivillei, male, Italy, Borghetto, RMNH.INS.24626 10 H. micrarcha, male 11 H. selastis, male 12 H. Leea_Borneo, male, Indonesia, Kalimantan Timur, Gunung Lumut, RMNH.INS.24158. Scales 1 mm.
Heliozelidae species, adult habitus. 13 Holocacista sp. Dyerophytum_UAE, Male, UAE, Fujairah, RMNH.INS.24628 14 H. sp. Psychotria_Australia, male, Australia, Queensland, RMNH.INS.24367 15 H. sp. Lasianthus_Borneo, female, Indonesia, Kalimantan Timur, Gunung Lumut, RMNH.INS.24159 16 H. sp. Impatiens_Vietnam, male, Vietnam, Cuc Phuong NP, RMNH.INS.24361 17 Antispila sp. Rhoicissus_SA, male, South Africa, Limpopo, Louis Trichard, Genitalia slide EvN4379 18 A. argostoma, male, India 19 A. aristarcha, female, India 20 Heliozela anna, female, India. Scales 1 mm.
Heliozelidae species, details of adult morphology. 21 Holocacista rivillei, male, denuded head, RMNH.INS.24300 22 H. capensis, male, denuded head, RMNH.INS.24445 23 H. rivillei, male, detail mouthparts, RMNH.INS.24443 24 H. rivillei, male, head and antenna, showing 15 segments, RMNH.INS.24300 25–28 Male foretibia with or without epiphysis: 25 H. capensis, small epiphysis, RMNH.INS.24445 26 H. rivillei, small epiphysis, RMNH.INS.24443 27 Heliozela sericiella, large epiphysis, RMNH.INS.24451 28 Antispilina ludwigi, epiphysis absent, RMNH.INS.24448.
Heliozelidae species, wing venation 31 Holocacista micrarcha, male, BM34300 32 H. selastis, male, BM34299 33 H. sp. Psychotria_Australia, male, RMNH.INS.24367 34 H. sp. Impatiens_Vietnam, female, RMNH.INS.24368 35 Antispila argostoma, male, BM34298 36 Heliozela anna, female, BM34301. Scales 0.5 mm.
Holocacista varii, male genitalia. 59 ventral view, photographed in glycerin, Genitalia slide EvN4388 60–64 details, RMNH.INS.24623 60, 61 tegumen, respectively more ventrally and dorsally focussed 62 phallus and juxta in lateral view 63 valvae in ventral view 64 transtilla ventral view, focussed more dorsally.
Holocacista capensis, life history. 76 Trunk of Vitis with many cocoons with exuviae, De Anker, Paarl, 14 February 2013 77 grapes with fresh cocoons attached, Paarl, 25 January 2013 78 larva in cocoon, going down on silken thread, Paarl, 16 January 2013 79 Leafmines in Rhoicissus digitata, reared in laboratory from adults that originated on Vitis from Wellington, 2014 80–82 Live adult males, reared from Vitis vinifera, from Paarl 80 EvN2013004, 28 January 81 Windmeul, reared in Leiden, 23 February 2012 82 EvN2013005, 4 February.
Holocacista species, leafmines on Vitaceae. 83 H. sp. Rhoicissus_tomentosa, fresh mine, larva cutting out shield, Swellendam, EvN2014901, larva RMNH.INS.30313 84 H. sp. Rhoicissus_tridentata, dried mines, Vari 1225 85 H. salutans on Rhoicissus tomentosa, dried mines, Vari 2788 86 H. salutans on Rhoicissus digitata, dried mines, Vari 3342 87, 88 H. rivillei, fresh mines with larvae on Vitis vinifera, in 87 two larvae next to each other, one in cocoon, EvN2013904.
Holocacista species, leafmines on various plants 89 H. varii, fresh mine with larva on Pelargonium, EvN2013033 90 H. varii, dried mine on Pelargonium cucullatum, EvN2013021 91 H. sp. Leea_Borneo, dried mines on Leea indica, EvN2005252 92 H. sp. Lasianthus_Borneo, dried mine on Lasianthus sp., EvN2005255 93 H. sp. Paederia_Taiwan, dried mine on Paederia, EvN2012314.
Holocacista species, male phallus in lateral view, scales 100 μm. 101 H. sp. Rhoicissus_tridentata, Genitalia slide EvN4380 [mirrored] 102 H. sp. Rhoicissus_PundaMilia, Genitalia slide EvN4382 103 H. sp. Cissus_integrifolia, Genitalia slide EvN4387 104 H. varii, Genitalia slide EvN4623 105 H. rivillei, Genitalia slide EvN4443 [mirrored] 106 H. sp. Dyerophytum_UAE, Genitalia slide EvN4628. 104 and 105 on the same scale.
We sequenced eight specimens of H. capensis and compared those with 24 sequences of other Holocacista species and several other heliozelid barcodes, sequenced for previous studies (
Most Holocacista barcodes group together in the NJ tree, but a few Asian ones cluster at different parts of the tree.
Since its initial discovery in 2011 on table grape vines in Paarl, the moth is now reported from Cape Town, Somerset-West, Stellenbosch and Wellington; in all cases reports were in conjunction with damage reported on the foliage of table grape or wine grapevines. Various cultivars have been affected, but no single preference for a particular cultivar was obvious. Infestations, as indicated by the number of mines per leaf or descending larvae from the canopy, range from small to extensive. Thus far, no reports have been received of its presence in the Hex River Valley, the major table grape producing region of South Africa, although a report has been received from Robertson, close to that region.
The very first record of its presence on vines now appears to be that of Dr Lajos Vári, breeding the moth from an urban grape vine in his own garden in Pretoria. In 1980, moths were bred in Northern Cape, Vaalhartz Research Station and later, infested vine leaves from Roodeplaat yielded moths in 1990. The first records from the Western Cape were moths, bred from infested urban vine foliage collected in March 1998 from Oudtshoorn. Although it was first noticed in commercial table grape vines in 2011 in the Western Cape, field observations indicate that it must have occurred much earlier in the region on grape vines. All collections made of leafmines in 2011 to date, have yielded larval or pupal parasites, an indication of a longer presence of the moth. Reports from field workers indicated that they had noticed the scale-like larval or cocoon shields earlier on grape vines, but were then of the opinion that these were either discarded scale insect exuviae or plant debris.
At present, the moth is widespread in the grape vine regions of the Western Cape, but mainly restricted to that region south of the Cape Fold Mountain range, although one record is known from Robertson, north of that range. In the northern part of South Africa, it occurs in high population numbers in the table grape region at Brits, east of Pretoria. Records also exist of its occurrence in the Vaalhartz region (Northern Cape) and in Oudtshoorn (Western Cape).
The effect of the leafmines on the grape vine itself appears to be limited. At the height of the moth season, most table grape vines are under irrigation and lost leaf growth is quickly replaced with new foliage throughout the growing season. Collateral damage by the larvae, when at high population numbers, may be more serious, especially when larvae descend from the vine canopy to form a dense curtain of suspended larvae. This not only harasses the harvesters themselves and contaminates the grape bunches, but in some cases, the radiators of tractors collecting the grape bunches became completely blocked by this curtain (in one case, this occurred in a distance of less than 200 m), requiring constant removal of the larvae.
As in previous studies on unexpected infestations of grapevine and walnuts by Heliozelidae (
While redescribing the genus Holocacista, we could also assign various other South African, Asian and Australian species to the genus. This further showed that also in those areas the family Heliozelidae has been poorly studied.
Unfortunately, the failure of amplifying DNA from the South African collection specimens has prevented a comparative usage of DNA barcodes. Our research has also shown that still many unnamed species exist, and additional revisionary taxonomic work on this fauna and on other leafminers, including fieldwork, is highly important, where the possibility exists that this and other economic important plants could become infested.
In our study we were only able to associate the new species with a single population feeding on native Rhoicissus digitata. Up to now we do not have any match yet of DNA barcodes of native Rhoicissus feeders, of which we sequenced two possible (new) species. Interestingly, the only Rhoicissus-feeding population of Holocacista capensis has been found in the Western Cape, from where also the majority of the grapevine miner records originate. This could be an indication that the host shift from Rhoicissus to Vitis may have taken place in the Western Cape. We assume that in the past the natural vegetation with Rhoicissus was much more widespread and more often close to vineyards, making such a shift far easier. However, this would mean that the shift may have taken place more than a century ago or even longer. Grapevine has been grown in the Western Cape since the Dutch settled at the Cape in the 17th century (http://en.wikipedia.org/wiki/History_of_South_African_wine). If that is the case, the miner has apparently been able to occur in low densities without being spotted before Lajos Vári recorded it first from his own garden in Pretoria in 1950 (this study). The occurrence in Gauteng and the Northern Cape could in that scenario be explained by a later infestation from the Western Cape. The Paarl-Wellington region is the major cultivation area of vine nursery stock in South Africa. Major cultivars are propagated and dispatched in large quantities to commercial farms and nurseries throughout the country. Rootstock in the form of hardwood cuttings, harvested during late autumn and winter, is obtained from a variety of sources before being grafted with the desired cultivar. This may explain the infestation of other areas with the moth. Visits to home garden nurseries in the Western Cape detected many grape vines being infested with the leafminer.
The 1.4% barcode difference between the single sequenced Gauteng specimen and the Paarl specimens could be an indication for a genetic variation between the Gauteng and Western Cape populations, although the genetic variation in a single population of H. varii that we observed is in fact larger. Still, genetic variation could have been caused by repeated host shifts from Rhoicissus to Vitis from genetically different populations. The fact that we easily could rear offspring of Vitis reared adults onto Rhoicissus digitata also supports this hypothesis. This would mean that the barcode variation represents the original variation of this species on its native hosts. This is not so unlikely, since several of the Vitaceae-feeding Heliozelidae appear to have wider host ranges than a single genus, and may occur on e.g., both Vitis and Parthenocissus, such as Antispila oinophylla (
Another case of host shift by a heliozelid is the recent infestation of walnut in Italian orchards by the North American Coptodisca lucifluella (
Where the origin of the grapes planted in South Africa is almost universally European (http://en.wikipedia.org/wiki/History_of_South_African_wine), it is not very likely that H. capensis originated somewhere other than in South Africa. Its close relationship to several other South African Vitaceae miners makes it very plausible that H. capensis indeed is a native South African insect. For tracing the origin of the host shift, a larger scale inventory of South African Vitaceae miners with detailed DNA analysis is required.
There are only few other insects known that feed both on Rhoicissus and Vitis, but at least two hawk moths (Sphingidae) are reported from both genera: Hippotion celerio (Linnaeus, 1758), that is more polyphagous (in the Western Cape during the winter months its larvae feed on Zantedeschia aethiopica (L.) Spreng.), and Theretra capensis (Linnaeus, 1764), that seems to be specialised on Vitaceae (
It is apparent that Holocacista capensis, as shown by the presence of larval and pupal parasites, must have been present for some time in the vineyards in this region. Only when moth densities reached alarmingly high numbers, was identification called for. Although damage by the larvae to the grapevine foliage itself is limited, the reported collateral damage by the larvae can be serious. Also, contamination of grapes with cocoons is cumbersome, since they need to be removed manually before the grapes can be sold or exported.
A first step needed to control the insects is assessing its density, by measuring the number of mines per leaf, infested leaves per vine, and particularly by setting out pheromone traps (
Control of the moth itself appears to be difficult. It appears that all cultivars of table grapes, especially those grown under a dense canopy cover, are attacked; wine grape cultivars are not that seriously affected and the mines are of little concern to the wine producer, but the moth can maintain populations in the vineyards that could infest table grape plantations. Moth densities are highest at the time of table grape harvest, with the result that no chemical control is feasible. Larvae are well protected within the leaf itself, ruling out the use of a systemic insecticide at the time when grape berries are developing and ripening. Although parasitoids are present, their numbers are low and only reach higher numbers near the end of the grape season. Ants could be efficient predators, but their numbers are controlled by the vine farmers. In two cases, numbers of moths were drastically reduced when insecticides were applied for the control of some other pests during October-November, the start of the vine growing season; investigations on this aspect are at present being carried out. Another measure that resulted in much lower densities was manual removal of cocoons from trellises and trunks during winter, but this is a time consuming method. Further research is also needed to see if mating disruption with pheromones is a serious possibility.
We thank Camiel Doorenweerd, Ruben Vijverberg, Kevin Beentjes, Julian van der Hogen (Naturalis, Leiden) and Welma Pieterse (Directorate Inspection services, Stellenbosch) for molecular analyses. Martin Krüger (Ditsong Museum, Pretoria) was very helpful with loans, various queries and during EvN’s visit to Pretoria. Several people in South Africa assisted us during our fieldwork, and we would like to thank them all: Vivienne Uys and Ros Urban (Biosystematics, ARC-Plant Protection Research Institute, Roodeplaat), J. H. Venter (Plant Health Early Warning Division, Department of Agriculture, Forestry and Fisheries, Pretoria). Michael Stiller (Biosystematics, ARC-Plant Protection Research Institute, Roodeplaat) kindly sent us some larvae that he collected on Rhoicissus. Thanks also to Leigh Torrance, Department of Conservation Ecology and Entomology, University of Stellenbosch, for general assistance and collection of material in 2014. Further we are grateful to the growers of the various table grape vineyards for allowing us to collect and study leafmines on their respective properties. Kees van den Berg (Naturalis, Leiden) assisted with rearing, mounting moths and other preparatory work, Sjaak Koster (Losser, Netherlands) made several genitalia preparations, Els Baalbergen (Naturalis, Leiden) made several photographs of moths, Niko Korenhof (Naturalis, Leiden) assisted with image editing and composing plates, whereas Inge van Noordwijk (Naturalis, Leiden) transformed sketches of genitalia into publishable drawings. For the loan of comparative material and information on collections we thank Kevin Tuck and Jurate De Prins (Natural History Museum, London), Douglas Hilton (Walter+Eliza Hall, Institute of Medical Research, Parkville), Toshiya Hirowatari (Entomological Laboratory, Kyushu University) and Shigeki Kobayashi (Entomological laboratory, Osaka Prefecture University). The South African Table Grape Industry (SATI) subsidised travel and publication costs. Mrs Tarryn Wettergreen of SATI kindly gave some linguistic comments. We are grateful for comments by reviewers Don Davis and Doug Hilton and editor Don Lafontaine that helped us improving the manuscript.
Southern African Heliozelidae
The following tentative checklist and short diagnoses are based on the collections in the Ditsong Museum in Pretoria, mostly gathered during extensive rearing of leafmines by Lajos Vári and a few other records, including our own. For most Vitaceae feeders some genitalia have been dissected, and for all taxa adults and leafmines have been examined. In all, 12 species are recognized, but differences in mines and variation in genitalia suggest there are more. Additionally, even more may be expected in parts of southern Africa where Vári rarely collected. A revision of this group should preferably include collecting of new material and molecular analyses.
Genus Heliozela Herrich-Schäffer, 1853
Heliozela argyrozona (Meyrick, 1918), comb. n.
Antispila argyrozona Meyrick, 1918: 35. Holotype ♂: South Africa, [KwaZulu Natal], Eshowe, 4.i.[19]16, A.J.T. Janse; “29 51”; Type No. 108 (TMSA) [examined].
Wingspan ca. 4.0–4.5 mm. Uniformly dark bronze, male with a white medial costal spot, female with a medial fascia and usually a small costal spot at 1/3. A typical Heliozela, with distinct epiphysis and complex venation. Assignment of the reared series to H. argyrozona is tentative and based on external resemblance of the females with the holotype; no genitalia have been examined.
Hostplant. Syzygium cordatum Hochst. ex Krauss (Myrtaceae). Mine a sinuous gallery on leaf upperside, gradually becoming wider.
Distribution. Kwazulu-Natal, Limpopo.
Material examined. South Africa: 34 adults, mines on 10 leaves, Limpopo, Louis Trichardt, 6–8.v.1953, Ac. no. 740, 743, leafmines on Syzygium cordatum, emerged 2.vi.–4.ix.1953, L. Vári, Genitalia slide TM3825; 1 adult, KwaZulu-Natal, Umdoni park, 15.v.1974, Ac. no. 3286, leafmines on Syzygium, emerged 17.vii.1974, L. Vári.
Heliozela sp. 2
Resembles H. argyrozona, but has two fasciae.
Hostplant. unknown.
Distribution. Limpopo.
Material examined. South Africa: 1 ♀, Limpopo, Woodbush, 14–16.ix.1960, van Son & Vári.
Genus Antispila Hübner, 1825
Antispila sp.
This is the largest South African heliozelid with a wingspan of 7–7.5 mm and large yellowish fascia and spots (Fig.
Hostplant. Rhoicissus rhomboidea (Vitaceae). Mines are conspicuous large blotches and have a large cut out of about 6 mm long, which separates them easily from the Holocacista mines.
Distribution. Eastern Cape, Limpopo. Only three specimens and three herbarium sheets in TMSA.
Material examined. South Africa: 1 moth, 1 sheet with mines, Eastern Cape, Grahamstown, 2.xii.1954, Ac. no. 1471, leafmines on Cissus rhomboideus, emerged 30.xii.1954, L. Vári; 1♂, 1♀, 2 sheets with mines, Limpopo, Louis Trichardt, 2.v.1953, Ac. no. 674, leafmines on Cissus rhomboideus, emerged 14.vii–30.viii.1953, L. Vári, Genitalia slide ♂ EvN4379.
Genus Holocacista Walsingham & Durrant, 1909
Holocacista capensis van Nieukerken & Geertsema, sp. n.
See above.
Holocacista salutans (Meyrick, 1921), comb. n.
See above.
Holocacista varii (Mey, 2011), comb. n.
See above.
Holocacista sp. Rhoicissus_tridentata
Wingspan ca. 4.0–4.8 mm. Differs from H. capensis and H. salutans by smoother bronze scaling, costal and tornal spots about same size, antennae hardly ringed, fringe line not pronounced. In male genitalia very long phallus, without spines, but a folded sleeve (Fig.
Hostplant. Rhoicissus tridentata subsp. cuneifolia (Vitaceae). Possibly also on R. rhomboidea, and R. tomentosa, but this needs to be verified. Mines characterised by long initial linear gallery filled with frass (Fig.
Distribution. Gauteng, KwaZulu-Natal, North West, Zimbabwe: Harare.
Remarks. The majority of specimens reared from R. tridentata leafmines, as listed below are probably this species as characterised by the described externals, phallus and leafmine, but at least H. salutans, or a closely related species and H. Rhoicissus_PundaMilia, also occur on this host and there may be more hidden in this material. Vári used at least three manuscript names in his notebooks for specimens from this host, indicating he also considered not all to belong to one species: “Antispila denticola,” “A. cuneifoliella” and “A. hartwigi”. We associate tentatively the two DNA barcodes with this species, but this requires confirmation.
Material examined. South Africa, Gauteng: 7 adults, 2 sheets with mines, Pretoria, Wonderboom Zuid, 1.iv.1950, Ac. no. 298, leafmines on Rhoicissus tridentata, emerged 12.x–30.xi.1950, L. Vári, Genitalia slides ♂ TM6767, ♀ TM6769; 12 adults, 1 sheet with mines, ibidem, 16.xii.1950, Ac. no. 298, emerged 29.xii.1950–10.i.1951; 26 adults, 2 sheets with mines [mixed with mines of H. cf. salutans, Pretoria, Meintjeskop, 7.vi.1951, Ac. no. 339, 340, 341, leafmines on R. tridentata, emerged 19.ix–9.x.1951, L. Vári, Genitalia slides TM6768, TM6770, ♀ TM6829, ♂ TM10347; 17 adults, ibidem, 27.v.1953, Ac. no. 833, emerged 27.ix–6.xi.1953; 1♂, 1♀, Suikerbosrand, 21–24.x.1975, Ac. no 3472, leafmines on Rhoicissus sp., emerged 24.x–10.xi.1975, M.J. Scoble. KwaZulu-Natal: 4 adults, 1 envelope with leafmines, Mt. Edgecombe, 31.iii.1954, Ac. no. 1225, leafmines on R. tridentata, emerged 21–26.iv.1954, L. Vári, Genitalia slide ♂ EvN4380. North-West: 2 larvae (RMNH.INS.29658, 29659), Kgaswane Nature Reserve, Rustenburg, 27.i.2013, EvN2013901, leafmines on R. tridentata, M. Stiller. Zimbabwe, Harare: 1♂, Mt. Selinda, 8.iv.1956, Ac. no. 1784, leafmines on R. tridentata, emerged 29.iv.1956, L. Vári, Genitalia slide EvN4385.
Holocacista sp. Rhoicissus_tomentosa
We have no adults that we can associate with certainty with the distinctive mine of this species. We barcoded two larvae (RMNH.INS.29566, 30313). The samples with leafmines from the Vári collection often show several mine types, apart from this species also including H. salutans and possibly the previous species or others. Further work is needed to differentiate these taxa.
Hostplant. Rhoicissus tomentosa (Vitaceae). Mine a gallery, first filled with frass, later an elongate gallery-like blotch with central clumped frass (Fig.
Distribution. Limpopo, Western Cape, Zimbabwe: Harare.
Material examined. South Africa, Limpopo: ??? adults, 2 sheets with mines (mixed), Louis Trichardt, 17.iii.1964, Ac. no. 2694, leafmines on Rhoicissus tomentosa, adults emerged 7–10.iv.1964, L. Vári. Western Cape: 1 larva, RMNH.INS.29566, leafmines, Swellendam E, Zuurbraak, 17.i.2013, EvN2013007, leafmines on R. tomentosa, E.J. van Nieukerken & H. Geertsema; 1 larva, RMNH.INS.30313, leafmines, ibidem, 16.vi.2014, EvN2014009, H. Geertsema. Zimbabwe, Harare: 1 adult?, 1 sheet with mines, Mt. Selinda, 8.iv.1956, Ac. no. 1783, leafmines on R. tomentosa, emerged 4.v.1956, L. Vári. Zimbabwe, Masvingo: 1 sheet with mines, Vumba, Mareh, 7.iii.1964, Ac. no. 2649, L. Vári.
Holocacista sp. Rhoicissus_PundaMilia
Wingspan 3.0–4.0 mm, very small species. Externally inseparable from H. salutans. Male genitalia characterised by very different, recurved phallus appendage (Fig.
Hostplant. Rhoicissus digitata and R. tridentata subsp. cuneifolia (Vitaceae). Mines a narrow gallery with medial linear frass, gradually enlarging into a wide gallery, rather different from those of H. capensis and salutans on R. digitata.
Distribution. Gauteng, Limpopo.
Material examined. South Africa, Gauteng: 1♂, Pretoria, Meintjeskop, 7.vi.1951, Ac. no. 339, leafmines on Rhoicissus tridentata, emerged 8.x.1951, L. Vári, Genitalia slide TM6828. Limpopo: 2 adults, Punda Milia, K.N.P. Survey [Kruger National Park Survey], 23.xi.1961, Ac. no. 2362, leafmines on Rhoicissus digitata, emerged 11.xii.1961, L. Vári; 5 adults, 1 sheet with 10 mines, ibidem, 4.xii.1964, Ac. no. 2712, leafmines on R. digitata, emerged 21.xii.1964, Genitalia slide EvN4382.
Holocacista sp. Cissus_integrifolia
Wingspan 3.5–4.0 mm, small species. Externally similar to H. sp. Rhoicissus_tridentata, with bronze wings, and antennae not ringed. Male genitalia characterised by the phallus appendage that is not curved backwards, but sinuous (Fig.
Hostplant. Cissus integrifolia (Vitaceae). Mines very compact, start with spiral gallery, later becoming an elongate blotch with frass in zigzag pattern.
Distribution. Zimbabwe: Masvingo.
Material examined. Zimbabwe, Masvingo: 11 adults, 1 sheet with 15 mines, Lundi, Lundi river, 4.iii.1964, Ac. no. 2646, leafmines on Cissus integrifolia, emerged 21–25.iii.1964, L. Vári, Genitalia slide ♂ EvN4387.
Holocacista sp. Lannea_SA
Wingspan 4–5 mm. Wings bronze fuscous with shining fascia and costal and tornal spots, rather similar to H. sp. Rhoicissus_tridentata. Antennae not ringed. Genitalia not examined.
Hostplant. Lannea discolor, Lannea sp. (Anacardiaceae). Mine very compact, somewhat resembling those of H. capensis. Initial gallery with zigzag turns, closely to each other, later completely enclosed in blotch.
Distribution. Gauteng.
Remarks. Vári gave the manuscript name “Antispila lanneivora”.
Material examined. South Africa, Gauteng: 1♂, Pretoria, behind garden Prof. J[anse], 16.i.1951, Ac. no. 317, leafmines on Lannea discolor, emerged 2.ii.1951, L. Vári; 4 adults, 1 sheet with 12 mines, Pretoria, above Pierneef St., 16.i.1951, Ac. no. 618, leafmines on L. discolor, emerged 9–12.ii.1951, L. Vári; 5 adults, Pretoria, Magalies Mountain, 26.xii.1953, Ac. no. 1016, leafmines on Lannea sp., emerged 8–11.i.1951, L. Vári.
Holocacista sp. Terminalia_SA
Wingspan 3.0–3.7 mm, very small moths. Wings greyish or brown with narrow medial fascia. Venation extremely reduced, forewing with 4 veins only, Rs, R+M, CuA and A.
Hostplant. Terminalia prunioides (Combretaceae). Mine a narrow gallery, suddenly enlarging into a roundish blotch.
Distribution. Namibia: Erongo
Remarks. Placement in Holocacista is tentative.
Material examined. Namibia, Erongo: 2 adults, 2 leaves with 2 mines, Karabib, 20.v.1959, Ac. no. 2108, leafmines on Terminalia prunioides, emerged 15.vi.1959, L. Vári, Genitalia slide ♂ EvN4387.
All material examined and used for DNA barcoding
Data type: Excel spreadsheet (xlsx).
Explanation note: The dataset comprises all material examined and identified to a certain extent for this study. All specimens used for the descriptions of genus and listed species are included, as are all DNA barcoded specimens, including those that were published earlier.