Research Article |
Corresponding author: Faezeh Yazdani Moghaddam ( faezeh.um@gmail.com ) Academic editor: Nina Bogutskaya
© 2020 Ehsan Damadi, Faezeh Yazdani Moghaddam, Fereshteh Ghassemzadeh, Mehdi Ghanbarifardi.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Damadi E, Moghaddam FY, Ghassemzadeh F, Ghanbarifardi M (2020) Plectorhinchus makranensis (Teleostei, Haemulidae), a new species of sweetlips from the Persian Gulf and the Gulf of Oman. ZooKeys 980: 141-154. https://doi.org/10.3897/zookeys.980.50934
|
Plectorhinchus makranensis sp. nov. is described on the basis of 16 specimens from the Persian Gulf and Gulf of Oman, in the Northwest Indian Ocean. The new species can be distinguished from congeners by a combination of dorsal fin rays XII, 18–20, pectoral-fin rays 16–17, tubed lateral-line scales 55–57, gill rakers count (10–12 on the upper limb and 16–17 on the lower limb), 17–18 scales between the lateral line and the first anal-fin spine, 30–31 circumpeduncular scale rows and color pattern. Plectorhinchus makranensis sp. nov. is distinguished from P. schotaf by having the posterior margin of the opercular membrane grey (vs. red in P. schotaf), fewer circumpeduncular scale rows, and a shorter base of the soft portion of the dorsal fin, 27.6–29.4% of standard length (SL) (vs. 31–32.3% of SL in P. schotaf). The new species resembles P. sordidus but is differentiated from it by having more gill rakers, a smaller orbit diameter 27.5–32.1% of head length (HL) (vs. 35.5–37.2% of HL in P. sordidus), a longer caudal peduncle 19.2–21.3% of SL (vs. 17.1–17.9% of SL in P. sordidus), and the first to third pectoral-fin rays light gray (vs. dark gray in P. sordidus). The new species can also be distinguished from the other species, including P. schotaf and P. sordidus, based on COI and Cyt b molecular markers. The phylogenetic position of this new species indicates that it is a sister taxon of P. schotaf.
Haemulidae, morphology, mtDNA, Northwest Indian Ocean, phylogenetic relationships, Plectorhinchus
Haemulidae Gill, 1885, is one of the 10 largest families of the order Perciformes, with 19 genera and 136 species. Almost half of the world’s haemulid species belong to the genera Plectorhinchus and Pomadasys (
The aims of our study are to use two molecular markers (COI, Cyt b) and morphological characters to confirm the existence of two lineages proposed by the other authors and to describe a new species of Plectorhinchus collected from the Gulf of Oman and the Persian Gulf.
In the present study 16 specimens of Plectorhinchus spp. and 10 specimens of P. schotaf were collected from six localities (Gulf of Oman: Beris, Tis, Pozm, Jask; Persian Gulf: Kangan, Hendijan) by gill netting in the time period from August 2017 to June 2018 (Fig. 1). All specimens are deposited in the Zoological Museum, Ferdowsi University of Mashhad (
Genomic DNA was extracted from 10 specimens of Plectorhinchus, including six Plectorhinchus makranensis sp. nov. and four P. schotaf, following the GeNet Bio kit protocol. Sequences were amplified by PCR using the following primer pairs: cytochrome oxidase subunit 1 (CO1LBC_F: 5’ TCAACYAATCAYAAAGATATYGGCAC 3’; CO1HBC_R: 5’ ACTTCYGGGTGRCCRAARAATCA 3’) and Cytochrome b (GluF: 5’AACCACCGTTGTATTCAACTACAA3; ThrR: 5’ACCTCCGATCTTCGGATTACAAGACCG3), following
All sequence alignments were performed using the MAFFT algorithm. The pairwise DNA sequence differences within and between species of Plectorhinchus were calculated with MEGA 7.0.9 (
We used
This study used sequence data from 21 species of Haemulidae with two outgroups (38 samples) (Fig.
Molecular phylogenetic tree showing P. makranensis sp. nov. and other congeners based on two mitochondrial genes Cyt b and COI (total length 1672 bp). Supporting values of nodes: black circles (ML bootstrap BP ≥ 70% and BI probability PP ≥ 0.95), orange circles on nodes support by ML (BP ≥ 70%) but not by BI (PP ≥ 0.95), gray circles on nodes support by BI (PP ≥ 0.95) but not by ML (BP ≥ 70%). Bar at the side of the tree represents the results of the analyses of species delimitation. Red font: sequences of this study, COI (first), Cyt b (second).
(Fig.
Paratypes
(N = 15).
Plectorhinchus schotaf
(N = 18): Gulf of Oman:
Plectorhinchus sordidus (N = 2): Seychelles: BPBM 21661, 230 mm, Caiman Rocks, 7 Jun. 1977, J.E. Randall; Mozambique: SAIAB 41668, 81 mm, 1 Sep 1948, J.L.B. and M.M. Smith.
Plectorhinchus makranensis sp. nov. can be distinguished from other congeners by the following combination of features: (1) meristic characters: dorsal fin rays XII, 18–20; gill rakers 10–12 + 16–17 (26–29); tubed lateral-line scales 55–57; transverse scale rows above lateral line 10–11; transverse scale rows below lateral line 17–18; circumpeduncular scales 30–31; (2) morphometric characters: base of soft portion of dorsal fin 27.6–29.4% of SL; orbit diameter 25.5–30.1% of HL; caudal peduncle length 19.2–21.3% of SL; (3) Color pattern: head and body unicolor without markings, the posterior part of the opercular membrane grey; uppermost first to third pectoral-fin rays light grey.
Meristic data and morphometric data are given in Suppl. material
Body elongate, moderate deep, its depth 2.8–3.4 in SL, compressed laterally and covered with ctenoid scales; scales on the middle of the body largest; lateral line extends slightly as smaller scales onto the caudal-fin base; scales present on suborbital; snout and chin without scales; predorsal scales extending through interorbital. Head moderately large, head length 3.4–3.7 in SL, upper profile convex; mouth moderately small and terminal, lips fleshy, upper jaw protruding slightly beyond the lower jaw; nostrils small, posterior nostril half diameter of anterior nostril, anterior nostril on horizontal line through the lower margin of eye; orbit diameter 3.3–3.9 in HL; three pores on each side of the chin, but no pit; teeth cardiform, approximately 2 rows laterally and 5 rows anteriorly in the upper jaw, approximately 2 rows laterally and 6 rows anteriorly in lower jaw, approximately 20–24 teeth in the upper jaw on each side and approximately 16–18 in the lower jaw on each side, palatine and vomer without teeth. Opercle with a single, exposed, short and weak spine; preopercle slightly concave and serrate, including few serrae on the posteroventral margin.
Origin of dorsal fin above the pectoral-fin base, first spine shortest, fifth spine longest, first dorsal-fin spine about 1.2 length of fifth, first spine 6.4 (6.1–6.5) in HL, fifth spine 2.6 (2.2–2.7) in HL, 6th and 7th soft dorsal-fin ray longest, 6th and 7th 3.6 in HL, 18th to 20th soft dorsal-fin ray shortest, its length 9.6–9.8 in HL, base of soft portion of dorsal fin 1.1 in base of the spinous portion; anal fin short, with somewhat rounded posterior margin, origin below base of 7th soft dorsal-fin ray, second spine longest, first ray is the longest, anal-fin length 2.5 (2.3–2.6) in HL; posterior margin of caudal fin slightly emarginate, caudal-fin length 1.7–1.8 in HL; pectoral fin reaching vertical between bases of seventh and eighth dorsal-fin spines, pectoral-fin length 1.4–1.5 in HL. Origin of pelvic fins behind pectoral-fin base, its tip reaching vertical at ninth dorsal-fin spine, second ray longest, pelvic-fin length 1.4–1.5 in HL.
(Holotype: Fig.
(paratypes: Fig.
The new species has been observed at six localities along the coast of the Gulf of Oman and the Persian Gulf in the Northwest Indian Ocean. Abundance was greater in the Gulf of Oman compared to the Persian Gulf. All specimens have been collected from shallow rocky and coral areas. Other species of this family which occur sympatrically at the type locality (Beris coast) with Plectorhinchus makranensis sp. nov. include: Diagramma pictum, Plectorhinchus pictus, Pomadasys kaakan, P. maculatus and P. stridens.
The species name is derived from the Makran coast and refers to the coastal land in southeastern Iran and southwestern Pakistan, north of the Gulf of Oman.
The first two Principal Components (PCs) of the meristic and morphological characters accounted for 78.3% and 60% of the variation, respectively (Fig.
The present study adds four species (P. flavomaculatus, P. makranensis, P. caeruleonothus and P. unicolor) to the previous molecular reconstructions (
A combined morphological and molecular approach should be used to distinguish closely related species (
Based on molecular and morphological data (Fig.
Because genetic distances between P. makranensis sp. nov. and deposited sequences in GenBank for P. schotaf and P. sordidus (HQ676736, HQ676791, HQ149904, KU499678, KU317896) are low, these deposited specimens could also represent sequences of P. makranensis (Fig.
The new species is morphologically most similar to P. schotaf and P. sordidus. The coloration of the new species differs from P. schotaf by having the posterior margin part of the opercular membrane grey (Fig.
A Plectorhinchus schotaf
Plectorhinchus makranensis sp. nov. is distinguished from other similar congeners as follows: from P. caeruleonothus by having 10–12 gill rakers on the upper limb (vs. 7–9 in P. caeruleonothus) and 10–11 scales above the lateral line to the base of the first dorsal-fin spine (vs. 15), from P. unicolor by having 17–18 transverse scale rows below lateral line (vs. 19–21), from P. griseus by having 18–20 dorsal-fin rays (vs. 21–23); from P. playfairi in having 55–57 lateral-line tubed scales (vs. 58–60) and 16–17 gill rakers on lower limb (vs. 21–23), from P. chubbi by XII dorsal-fin spines and 16–17 gill rakers on the lower limb (vs. XI spines and 21–23 rakers respectively). The number of dorsal-fin spines is XII in new species vs. XIII in P. chrysotaenia and XIV in P. flavomaculatus, P. ceylonensis, P. gibbosus, P. macrolepis and P. plagiodesmus. Furthermore, the ANOVA analysis reveals that the numbers of dorsal-fin spines and soft rays and scales below the lateral line to the first anal-fin spine, as well as the numbers of circumpeduncular scales and total gill rakers, significantly differ from the other examined species. The molecular and morphological differences mentioned above indicate that the new species is separated from other congeners.
We would like to express our sincere thanks to Dr Sergey V. Bogorodsky for his photograph of Plectorhinchus sordidus and Arnold Y. Suzumoto for their help with providing us with specimens. We would also like to thank the University of Ferdowsi Mashhad in Iran for their invaluable support. We are indebted to local fishermen for their help in collecting specimens. We also thank to Ann Paterson from the University of Arkansas for editing on an early draft of the manuscript.
Funding support for this research was provided by the Iran National Science Foundation (Grant 97009791).
Table S1
Data type: Molecular
Explanation note: Net Sequence divergence obtained for CO1 (below diagonal) and for Cyt b (above diagonal).
Table S2
Data type: Morphological
Explanation note: Meristic and morphometric data for all material examined of Plectorhinchus makranensis sp. nov. (N = 16), P. schotaf (N = 18) and P. sordidus (N = 2) (holotype data for P. schotaf and from