Research Article |
|
Corresponding author: Jinwook Back ( b.jinwook@gmail.com ) Academic editor: Kai Horst George
© 2020 Byung-Jin Lim, Hyun Woo Bang, Heejin Moon, Jinwook Back.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Lim B-J, Bang HW, Moon H, Back J (2020) Integrative description of Diosaccus koreanus sp. nov. (Hexanauplia, Harpacticoida, Miraciidae) and integrative information on further Korean species. ZooKeys 927: 1-35. https://doi.org/10.3897/zookeys.927.49042
|
A new species of Diosaccus Boeck, 1873 (Arthropoda, Hexanauplia, Harpacticoida) was recently discovered in Korean waters. The species was previously recognized as D. ezoensis Itô, 1974 in Korea but, here, is described as a new species, D. koreanus sp. nov., based on the following features: 1) second inner seta on exopod of fifth thoracopod apparently longest in female, 2) outer margin of distal endopodal segment of second thoracopod ornamented with long setules in male, 3) caudal seta VII located halfway from base of rami (vs. on anterior extremity in D. ezoensis), and 4) sixth thoracopod with three setae in female (vs. 2 setae in D. ezoensis). In addition, there is also a mitochondrial COI sequence difference of more than 19.93% with D. ezoensis registered in NCBI. A key to Diosaccus species of the world is also provided, and new morphological features and DNA sequences are presented for two other harpacticoid species, Parathalestris verrucosa Itô, 1970 and Peltidium quinquesetosum Song & Yun, 1999. In order to clearly identify harpacticoids at the species level, both morphological and DNA sequence characteristics should be considered.
Key, mitochondrial cytochrome c oxidase subunit I, Parathalestris verrucosa, Peltidium quinquesetosum, taxonomy, 18S ribonucleic acid
Harpacticoids (Arthropoda, Hexanauplia, Harpacticoida) are a group of benthic metazoans that are diverse in terms of both species and ecology. To date, ca 150 species of marine harpacticoids have been reported in Korean waters (
In contrast to morphology-based taxonomy, recent advances in the cost and ease DNA sequencing and in the availability of public DNA sequence databases has facilitated the identification of numerous cryptic animal species (
The samples were all collected from Korean waters which is part of the north-western Pacific Ocean (Table
| Species | Date | Locality | Gear (depth) | Specimen nos. |
|---|---|---|---|---|
| Diosaccus koreanus sp. nov. | 25–07–2017 | 37°31'36.56"N, 130°49'41.77"E | hand net (0.5 m) | CR00247255 |
| CR00247256 | ||||
| 27–04–2018 | 35°18'39.0"N, 129°16'10.6"E | Grab (5 m) | CR00247257 | |
| CR00247258 | ||||
| CR00247259 | ||||
| CR00247260 | ||||
| Parathalestris verrucosa | 19–07–2017 | 36°42'36.63"N, 129°28'31.69"E | light trap (2 m) | All specimens |
| Peltidium quinquesetosum | 19–07–2017 | 36°42'36.63"N, 129°28'31.69"E | light trap (2 m) | All specimens |
Each specimen was rinsed in distilled water for 15 min to remove ethanol and then transferred, using a sterilized pipette tip or dissection needle, to a 1.5-mL tube that contained 20 mL Proteinase K and 180 mL ATL buffer for non-destructive DNA extraction (DNeasy Blood and Tissue Kit, Qiagen, Hilden, Germany). After the specimens were incubated for 3 h in a thermoshaker (350 rpm, 56 °C), the 200 mL of lysis buffer (Proteinase K + ATL buffer) was moved to new 1.5-mL tubes under a stereomicroscope. Each 1.5-mL specimen tube was then filled with 70% ethanol to preserve the specimens for subsequent morphological identification and description, and DNA was isolated from the buffer samples following the protocol of the DNeasy Blood and Tissue Kit.
Both COI and 18Sr RNA sequences were amplified from the sample DNAs using an AccuPower HotStart PCR PreMix (Bioneer, Daejeon, South Korea), gene-specific primers (Table
| Gene | References | Primer name | Primer sequence | PCR condition | Product size | Species |
|---|---|---|---|---|---|---|
| mt COI |
|
LCO1490 (universal) | GGTCAACAAATCATAAAGATATTGG | 94 °C, 300 s; 40 cycles × (94 °C, 60 s; 46 °C, 120 s; 72 °C, 180 s; 72 °C, 600 s) | 658 | D. koreanus sp. nov |
| 658 | Pa. verrucosa | |||||
| HCO2198 (universal) | TAAACTTCAGGGTGACCAAAAAATCA | |||||
| 661 | Pe. quinquesetosum | |||||
| 18S rRNA |
|
18SF1 (universal) | TACCTGGTTGATCCTGCCAG | 94 °C, 300 s; 40 cycle × (94 °C, 30 s; 50 °C, 30 s; 72 °C, 60 s); 72 °C, 420 s | 1,756 | D. koreanus sp. nov |
| 18SR9 (universal) | GATCCTTCCGCAGGTTCACCTAC | 1,761 | Pa. verrucosa | |||
| 18SF2 (internal) | CCTGAGAAACGGCTRCCACAT | These primers were used for primer walking to sequence over 1700 bp | 1,763 | Pe. quinquesetosum | ||
| 18SF3 (internal) | GYGRTCAGATACCRCCSTAGTT | |||||
| 18SF4 (internal) | GGTCTGTGATGCCCTYAGATGT | |||||
| 18SR6 (internal) | TYTCTCRKGCTBCCTCTCC | |||||
| 18SR7 (internal) | GYYARAACTAGGGCGGTATCTG | |||||
| 18SR8 (internal) | ACATCTRAGGGCATCACAGACC |
After processing for molecular analysis, each specimen was dissected on several slides using lactophenol as a mounting medium and then observed using a Leica DM2500 microscope that was equipped with a drawing tube. Descriptive terminology was adopted from
Abbreviations used in the text are: A1: antennule; A2: antenna; ae: aesthetasc; exp-1(2, 3): proximal (middle, distal) exopod; enp-1(2, 3): proximal (middle, distal) endopod; P1–P6: first to sixth thoracopod; seg-1(-5): first (to fifth) segment; benp: baseoendopod; mxp: maxilliped.
Holotype. Republic Of Korea ∙ Ulleungdo Island; 37°31'36.56"N, 130°49'41.77"E; 25 July 2017; B. Jinwook leg.; hand net, 0.5 m ∙ 1 ♀ (MABIK CR00247255) was dissected on 14 slides (Table
Female. Body (Figs
Caudal rami
(Fig.
A1
(Fig.
A2
(Fig.
Mandible
(Fig.
Maxillule
(Fig.
Maxilla
(Fig.
Mxp
(Fig.
Swimming legs
(Figs
P1
(Fig.
P2
(Fig.
P3–P4
(Fig.
Armature formulae as follows:
| Exopod | Endopod | |
|---|---|---|
| P1 | 0.1.112 | 1.1.120 |
| P2 | 0.1.222 | 1.2.121 |
| P3 | 0.1.323 | 1.2.221 |
| P4 | 0.1.323 | 1.1.221 |
P5
(Fig.
P6
(Fig.
Male. Body (Fig.
A1
(Fig.
P1
(Fig.
P2
(Fig.
P5
(Fig.
P6
(Fig.
Species name refers to the type locality (i.e., Republic of Korea).
In regards to pairwise distances (Tamura-Nei distance) among the 582-bp COI sequences, D. koreanus sp. nov. exhibited intra-specific variation of 0–2.28%, and inter-specific distances of 19.42–22.34% were observed among all three Diosaccus species (Table
Pairwise distances (Tamura-Nei distance) between COI sequences from species in genus Diosaccus. Numbers in parentheses indicate the Genbank accession numbers.
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | ||
|---|---|---|---|---|---|---|---|---|---|
| 1 | D. koreanus sp. nov. (CR00247255, CR00247258) | ||||||||
| 2 | D. koreanus sp. nov. (CR00247256) | 1.52 | |||||||
| 3 | D. koreanus sp. nov. (CR00247257 CR00247260) | 0.91 | 0.91 | ||||||
| 4 | D. koreanus sp. nov. (CR00247259) | 2.28 | 1.67 | 1.67 | |||||
| 5 | D. ezoensis (KR049013) | 19.93 | 20.62 | 20.62 | 20.79 | ||||
| 6 | D. spinatus (MH242730) | 20.36 | 21.28 | 21.28 | 22.04 | 19.76 | |||
| 7 | D. spinatus (MH242731) | 20.67 | 21.59 | 21.59 | 22.34 | 19.42 | 1.06 | ||
| 8 | D. spinatus (HQ966504) | 20.06 | 20.97 | 20.97 | 21.73 | 19.93 | 1.06 | 0.61 |
Pairwise distances (Tamura-Nei distance) based on 1,756 bp between 18SrRNA sequences from species in genus Diosaccus.
Republic Of Korea ∙ 1 ♀ (MABIK CR00246555) was dissected on 13 slides ∙ 1 ♂ (MABIK CR00246552) was dissected on 9 slides ∙ 11 ♀♀ (MABIK CR00246553, CR00246554, CR00246556 to CR00246560, CR00246562 to CR00246565) and 1 ♂ (MABIK CR00246561) were preserved in 99 % alcohol ∙ GenBank accession numbers: MN996282 to MN996293 (COI) and MT002906 to MT002909 (18SrRNA).
Parathalestris verrucosa Itô, 1970 (p. 211–218, Figs
Peltidium quinquesetosum Song & Yun, 1999: 67–74, figs 1–3
Republic Of Korea (Table
There was no remarkable difference between the original description and the specimens analyzed in the present study. However, additional details of sensilla on the surface, the structure of mouthparts and appendages, and the rows of spinules and setules were added in the figures.
The new species (D. koreanus sp. nov.) was placed in the genus Diosaccus on the basis of several characteristics (A2 exp with 4 setae, P2 exp-2 with 2 inner setae, P2 exp-1 without inner seta, and P4 enp 3-segmented) and was most closely related to D. ezoensis Itô, 1974, based on the setae formula of the swimming legs, mouthpart structures, and the shapes of P5 and P6. However, the new species was also clearly distinguishable from D. ezoensis based on the length of the second inner seta on the P5 exp (obviously longest in the female) and the presence of long setules along the outer margin of the P2 enp-3, as previously noted by
The genus Diosaccus currently contains 14 valid species (
| 1 | A2 exp 3-segmented | 2 |
| – | A2 exp 2-segmented | 4 |
| – | A2 exp 1-segmented | 7 |
| 2 | P1 enp-2 without inner seta; basis of mxp robust | D. rebus (Sewell, 1940) |
| – | Specimen without this combination of characters | 3 |
| 3 | Basis of mxp slender; P1 enp-3 longer than enp-2; P1 enp-2 with 1 inner seta | D. valens (Gurney, 1927) |
| – | Base of mxp robust; P1 enp-3 as long as enp-2; P1 enp-2 without inner seta | D. robustus (Thompson & Scott, 1903) |
| 4 | Seg-3 and seg-4 with sharp dorsal teeth; P5 exp with 7 setae; benp with 5 spines, nearly equal in length | D. dentatus (Thompson & Scott, 1903) |
| – | Specimen without this combination of characters | 5 |
| 5 | P1 enp 2-segmented | D. varicolor biarticulatus (Monard, 1924) |
| – | P2 enp 3-segmented | 6 |
| 6 | P5 exp with 6 setae | D. varicolor varicolor (Farran, 1913) |
| – | P5 exp with 5 setae | D. varicolor pentasetosus (Noodt, 1955) |
| 7 | P1 enp 2-segmented | D. monardi Sewell, 1940 |
| – | P1 enp 3-segmented | 8 |
| 8 | Benp with 6 setae/spines | 9 |
| – | Benp with 5 setae/spines | 11 |
| 9 | Caudal seta VII on proximally, P5 with 6 uniform (in length) setae, P6 with 2 setae | D. ezoensis Itô, 1974 |
| – | Specimen without this combination of characters | 10 |
| 10 | Second outer seta on P5 benp longest | D. borborocoetus Jakobi, 1954 |
| – | P5 benp with 6 spines | D. koreanus sp. nov. |
| 11 | P5 benp with 5 spines | 12 |
| – | P5 benp with 5 spines/setae | 13 |
| 12 | Second outer seta on P5 benp longest; caudal seta II slender | D. spinatus Campbell, 1929 |
| – | First and second outer setae on P5 benp equal in length; caudal seta II strong | D. truncates Gurney, 1927 |
| 13 | P2 exp-3 with 3 outer spines; ♂ P5 benp with 2 setae, inner seta longer than outer seta | D. hamiltoni (Thompson & Scott, 1903) |
| – | P2 exp-3 with 2 outer spines; ♂ P5 benp with 2 same length setae | D. tenuicornis (Claus, 1863) |
The classification of harpacticoids has, until now, been primarily based on adult morphology, especially that of females. Significant differences between species, such as differences in number of segments or setae, are very important and recognizable characteristic that can be used to detect new species. However, some groups require researchers to classify species by features that are difficult describe, such as the width-to-length ratio of appendages, angle of segment inclination, and seta location. In addition, most of the recently discovered cryptic species are morphologically similar to known species. Although meiofauna are difficult to describe, owing to their small, fragile bodies, which make it difficult to obtain large amounts of genomic DNA from individual wild specimens (
Previously identified harpacticoid species were described on the basis of morphological characteristics, not molecular ones. To classify benthic harpacticoids, observation is usually necessary under a high-power microscope. In this process, DNA in the specimen is destroyed by prolonged microscopic observation and the use of toxic media. Until now, it was difficult to get the DNA sequence and morphological information using same specimen. Therefore, there may be cases of incorrect registration of genetic information for other species. As in the present study and in
The authors are indebted to Dr Sahar Khodami and Dr Sven Rossel (Senckenberg am Meer Wilhelmshaven, Germany) for reviewing the manuscript and providing helpful and constructive critics and comments. This work was supported by grants from the National Marine Biodiversity Institute of Korea (2020M00100).