Citation: Quinter EL, Sullivan JB (2014) A new apameine genus and species from the southern Appalachian Mountains, USA (Lepidoptera, Noctuidae, Noctuinae). In: Schmidt BC, Lafontaine JD (Eds) Contributions to the systematics of New World macro-moths V. ZooKeys 421: 181–191. doi: 10.3897/zookeys.421.7727
Cherokeea gen. n. is proposed for a rarely collected apameine moth species from the southern Appalachian Mountains, C. attakullakulla sp. n. It is recorded from foothills and lower montane habitats of North Carolina and Georgia where hill cane, Arundinaria appalachiana Triplett, Weakley & L.G. Clark is found. Adults and their genitalia are figured and a mtDNA barcode sequence is given.
Apameini, Arundinaria, bamboo, barcode, biogeography, endophagy, evolution, Noctuoidea
Most of the species formerly placed in the “Oligia” semicana (Walker) group were resolved by
This paper describes the second of a number of new genera of apameine moths that are highly restricted to the limited occurrences of their known or presumed host plants, Arundinaria Michx. (Poaceae: Bambusoideae) that occur in the southeastern United States. The first new genus, Protapamea Quinter (
Photographic methods used herein are described in
BMNH The Natural History Museum, London, UK
ELQ Eric L. Quinter, Willimantic, Connecticut, USA
CNC Canadian National Collection of Insects, Arachnids and Nematodes, Ottawa, Canada
JBS J. Bolling Sullivan, Beaufort, North Carolina, USA
USNM National Museum of Natural History, Washington, District of Columbia, USA
Masculine.
Cherokeea attakullakulla Sullivan & Quinter, 2014
Cherokeea is derived from Cherokee, a Nation of Native American people who occupied the southern Appalachians and were exemplary stewards of the habitats and resources of the region.
This genus exhibits most but not all of the primary characteristics of the tribe Apameini, i.e., ovipositor heavily sclerotized and dorsoventrally flattened, rugose sclerotized appendix bursae, and medially corrugated ductus bursae in the female; pleural sclerite a double helix in the male. It is distinguished from all known Nearctic and western Palearctic apameine genera by the conspicuous asymmetry of the saccular lobes of the male genitalia. This condition appears to be a uniquely derived synapomorphy shared with other as yet undescribed apameine genera restricted to southeastern United States. A sclerotized medial protrusion arising caudally from the basal margin of the male juxta appears to be autapomorphic. Additionally, the left valve bears a minute setose projection at the base of the sacculus, resembling a miniature clavus, which may be autapomorphic. The sole included species, Cherokeea attakullakulla, is a small, dull-colored moth bearing a superficial resemblance to some species of Neoligia.
Cherokeea is immediately distinguishable from Neoligia, Oligia Hübner, Mesoligia Boursin, and Mesapamea Heinicke by quite different genitalic morphology given in the description below.
Head. Male and female antennae simple, setose-ciliate; 54 segments. Eye smooth, round. Labial palpus of both sexes laterally flattened, upcurved; first segment swollen basally, arching slightly upward and somewhat more than half as long as second segment, which is straight; second segment about as long as eye width, broadly scaled; third segment 1/3 × length of second, narrowly scaled, and projecting slightly anteriorly. Frons convex, unmodified; with a central dense tuft of converging spatulate hairs. Thorax. Vestiture a mixture of coarse spatulate scales, spatulate hairs and simple hairs; mesoscutellar crest prominent, metascutellar tuft, less so. Wings. Forewings elongated and acutely rounded at apex. Venation typical apameine, as figured in
Female genitalia (Fig. 7). Posterior tip of papillae anales to anterior end of corpus bursae 7.2 mm; n = 2, 6.6–7.8 mm. Corpus bursae membranous, elongate, 2 × as long as wide, ovoid, slightly constricted posterior to middle, without signa. Appendix bursae corrugated, arising posteriorly on left, more heavily sclerotized distally, 0.8 × length corpus bursae. Ductus bursae long, narrow, 12 × as long as wide, 0.8 x length corpus bursae, heavily sclerotized in longitudinal ridges, wider anteriorly than posteriorly, entering at their junction on right side 1/3 distance from posterior end of appendix bursae to anterior end corpus bursae. Lamella antevaginalis quadrate with W-shaped outline, sclerotized, strongly indented anteriorly at juncture with ostium, somewhat concave posteriorly; dorsal wall of ostium membranous, lacking any discernible lamella. Anterior and posterior apophyses 1.5 × length A8, slender with paddle-like terminations. Papillae anales dorsoventrally flattened, evenly tapered, acutely pointed cones with dorsal surface densely spinulose, ventral surface minutely setose. The two sclerotized rods between the anal papillae characteristic of Apameini apparently secondarily lost in the very small adults.
http://zoobank.org/F8CF625C-480D-4BE2-9354-13CAEA2C388A
Figs 1–7Fontana View Estates on Lake Fontana, Swain County, North Carolina.
Holotype male: USA, North Carolina: Swain County, 2000’, Fontana Lake Estates (35°38.44'N, 83°55.79'W), mesic mixed pine/hardwoods June 10, 2002. J. Bolling Sullivan (USNM). Paratypes: (9♂ 12♀) same data as holotype, 8 and 10 June, 2002 (BMNH, USNM, CNC, ELQ, JBS). Other material examined: over 100 of both sexes collected from June 8–24 from: Great Smoky Mountains National Park, Swain County, North Carolina (Wiggins-Watson Cemetery, Deep Creek, 2215’ (35°28.0'N; 8326.2'W); Forney Creek, 1840’ (35°28.1'N, 83°34.0'W.); Big Cove Road, 2054’ (35°51.6'N, 83°29.4'W); Welch Ridge, 1840’ (35°26.9'N, 83°44.6'W); Rutherford County, North Carolina, Box Creek Preserve, 1100–1500’ (35°54.8'N; 81°93.9'W).
The name Attakullakulla, herein treated as a noun in apposition, refers to the Supreme Cherokee Leader (from 1761–1775) who represented his people in London in 1730 and at home in the Carolinas while negotiating various peace treaties.
The very limited distribution of this species to moderate altitudes in the southern Appalachian Mountains and foothills is unlikely to coincide with any species of Neoligia. It is possible the moth might be confused with worn specimens of the common, widely distributed eustrotiine moth Protodeltote muscosula (Guenée), but adults of that species are slightly larger, with an olivaceous cast to the forewings, a prominent, subquadrate dark patch between the orbicular and reniform spots, and lack the characteristic genitalic features of Apameini. Otherwise, the genitalic characters described under the genus will serve to distinguish this species from anything of similar appearance occurring in North America.
Head. Dorsum of antenna with alternating brown and gray rings of scales, underside tan; scape white. Labial palpus with gray and brown rough scaling. Frons with a mixture of white and brown erect scales, vertex and collar similar but with more dominant brown scaling. Thorax. Vestiture a mixture of coarse, brownish, spatulate scales, spatulate hairs and simple hairs; mesoscutellar crest prominent, metascutellar tuft, less so. Legs. As detailed in generic description. Wings (Figs 1–4). Forewings elongated and acutely rounded at apex. Forewing base to wing tip, 10.7 mm; N=20, (9.8–11.7 mm). Appearance variable, ranging from nearly uniform dull gray to much more contrasting and mottled, especially in females. Both phenotypes occur in both sexes, however. Antemedial line excurved, doubled, with pale gray to nearly white filling; slightly scalloped and comprised of black scales. Medial line or shade obscure. Postmedial line sinuous, excurved around reniform, most distinct at posterior margin, becoming obscure toward costa; slightly scalloped and doubled, with pale gray to nearly white filling; inner element of pm line much darker than the outer, which is defined by black points on veins. Subterminal line a merged series of brownish-black indistinct chevrons. Terminal line a series of sharp, tiny black chevrons between veins. Fringe pale gray, with unbroken dark gray basal line. Basal, medial and terminal areas predominantly uniform gray, but with some reddish-brown scaling in the medial and basal areas in some individuals, especially toward posterior margin. Subterminal area usually paler gray, with quadrate, subapical dark patch on costa. Basal dash usually clearly visible, black, often highlighted below with whitish scales; medial dash variable, from completely obscure to a prominent bar, which may be the most distinct marking of the forewing; anal dash obscure or, at most, represented by an indistinct, dark, triangular patch of scales. Reniform spot auriculate, pale gray, of same shade as subterminal area. Orbicular spot similarly colored, ovoid, with an outline of black scales. Suborbicular and claviform spots not visible on worn material studied. Dorsal hindwing pale gray, plain, unmarked except for faint discal spot; fringe pale gray with darker gray basal line. Abdomen. Dorsal abdominal scaling white basally then brownish to tip; a prominent mid-dorsal tuft on first segment; ventral abdominal scaling brownish, becoming more yellow on ventral brush on eighth segment. Genitalia. As detailed for both sexes in generic description.
Cherokeea attakullakulla adults. 1 male holotype 2 female paratype, mottled form 3 male paratype, plain form 4 female paratype, plain form.
Genitalia structure of Cherokeea attakullakulla. 5 male genitalia (aedeagus removed) (JBS5761) 6 male aedeagus and vesica (JBS5761) 7 female genitalia (JBS5757).
Barcodes were obtained for seven specimens from both Swain and Rutherford Counties. There were five haplotypes which differed by as much as 0.6%. The most common haplotype was:
AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAACCCCGGATCTTTAATTGGTGACGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCTTTAATATTAGGAGCTCCAGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGGTTACTTCCCCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCTCACGGAGGAAGTTCTGTAGATTTAGCCATTTTTTCTCTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCGGTAGGAATTACTGCATTTTTATTATTATTATCACTACCCGTTTTAGCGGGAGCTATCACAATATTATTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Barcode sequences for Cherokeea attakullakulla did not associate with Neoligia or other related genera when nearest neighbor similarity searches were conducted.
Two patterns of maculation are seen (Figs 1–4), which we are calling mottled and plain. Intermediates are seen as well. These phenotypes did not segregate by location or by barcodes. Females are usually more heavily marked than males.
We have not yet had the opportunity to investigate the bionomics of this species fully, so the early stages remain unknown. Based upon habitat association, unequivocal placement within the Apameini, and especially details of genitalic morphology clearly linking this species to other taxa known to be specialists upon Arundinaria, it appears virtually certain that its larva will be found to be an endophagous feeder upon Arundinaria appalachiana Triplett, Weakley & L.G. Clark (
In North Carolina the species is known from Swain and Macon Counties in the mountains and from Rutherford County in the foothills. The only record for Georgia is Rabun Co., slopes of Rabun Bald, 0.7 road mi. past Kelsey Mtn. Road parking lot, 4000’, June 21, 2001, James Adams (Adams, personal communication). The species is univoltine and flies from the 8th through the 24th of June. It is always found in association with hill cane (Arundinaria appalachiana), which grows on well-drained forested slopes. Two other species of Arundinaria occur in North Carolina but are associated with wet habitats, are often over 6’ in height, and grow in dense colonies. Hill cane grows singularly or in poorly defined clumps and is less than four feet in height and can be found on rocky knobs, hillsides, and throughout mesic oak-hickory forests in the foothills and lower mountains (up to about 3000’).
Despite well-developed flight musculature, most adult apameine moths are highly sedentary and non-vagile. As a result, many of the species occur only in small, extremely localized populations and thus are infrequently collected, creating a false impression of rarity, when in fact they can be extremely abundant within their respective niches. Hence the availability of suitably fresh study material for molecular analysis represents a major challenge. Some of the earlier molecular analyses were based on a very limited subset of the species occurring in a region, and of relatively little value as a consequence. More recent work in North America and Europe has a high degree of species-level coverage in the 94% range (J.D. Lafontaine, pers. com.). Issues of generic non-monophyly are thus revealed. Phylogenetic studies based on morphology have one advantage in that comprehensive representation is more readily achievable.
Morphological studies of Lepidoptera in general and Noctuoidea in particular (e.g.,
Even with regard solely to morphology, global treatments have thus far been quite uneven. The apameine fauna of the western Palearctic recently have been comprehensively studied and documented (
We thank the staff of the Great Smoky Mountains National Park, the Cherokee Nation, and Tim Sweeney, Chris Wilson and Kevin Caldwell with Box Creek Preserve in Rutherford County for collecting permits and access to habitats as well as financial support. James Adams provided additional collecting records for Georgia. Jocelyn Gill assisted with the preparation of the figures and Paul Hebert and Barcode of Life Data systems technicians obtained barcode sequences. Don Lafontaine and Jane O’Donnell provided helpful reviews of the manuscript.