Research Article
Print
Research Article
A new species of the genus Acanthosaura from Yunnan, China (Squamata, Agamidae)
expand article infoShuo Liu‡, Dingqi Rao‡
‡ Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China

Corresponding author: Shuo Liu ( liushuo@mail.kiz.ac.cn )

Corresponding author: Dingqi Rao ( raodq@mail.kiz.ac.cn )

Academic editor: Thomas Ziegler
© 2019 Shuo Liu, Dingqi Rao.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Liu S, Rao D (2019) A new species of the genus Acanthosaura from Yunnan, China (Squamata, Agamidae). ZooKeys 888: 105-132. https://doi.org/10.3897/zookeys.888.38491
ZooBank: urn:lsid:zoobank.org:pub:C454358A-DB07-4BE8-A22A-7B98CE3E6CF9
Open Access

Abstract

A new species of Acanthosaura from Yunnan, China is described based on unique morphometric and meristic external characters and a very distinctive color pattern. The fourteenth species recorded of this genus, Acanthosaura tongbiguanensis sp. nov., was previously considered A. lepidogaster although it more closely resembles A. crucigera. It can be separated from all other species of the genus by having different numbers of subdigital lamellae on the fourth finger and toe, and a different shape of the black eye patch. The new species differs genetically from investigated congeners by percentage distance of 14.46% to 23.27% (cytochrome b gene).

Keywords

crucigera, Dehong, lepidogaster, Tongbiguan

Introduction

The genus Acanthosaura (Gray, 1831) includes thirteen currently recognized species: A. armata (Hardwicke & Gray, 1827); A. lepidogaster (Cuvier, 1829); A. capra (Günther, 1861); A. coronata (Günther, 1861); A. crucigera Boulenger, 1885; A. nataliae Orlov et al., 2006; A. bintangensis Wood et al., 2009; A. titiwangsaensis Wood et al., 2009; A. cardamomensis Wood et al., 2010; A. brachypoda Ananjeva et al., 2011; A. phuketensis Pauwels et al., 2015; A. murphyi Nguyen et al., 2018; and A. phongdienensis Nguyen et al., 2019. It has a very wide distribution, and phylogenetic studies have shown that the genus was in need of revision as it included several undescribed and cryptic species as revealed by molecular data (Kalyabina-Hauf et al. 2004; Ananjeva et al. 2008). Because at least some of its members are difficult to find and similar in appearance, taxonomic research is incomplete, with many species only recognized recently.

During our field research in Dehong Autonomous Prefecture, Yunnan Province, China, we discovered some lizards that looked superficially like Acanthosaura lepidogaster. According to Zhao et al. (1999) and Yang et al. (2008), two species of the genus Acanthosaura are distributed in China and only A. lepidogaster is found in Yunnan Province. Morphological and molecular data show that this population is clearly distinct from all other named species, and we consequently describe and name it herein.

Materials and methods

Specimens were collected by hand. Photographs were taken to document color pattern in life prior to euthanasia. Liver tissues were stored in 99% ethanol and lizards were preserved in 75% ethanol. Specimens were deposited at Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences.

Forty-nine meristic and mensural characters were noted for each adult specimen of the type series, but only meristic characters were noted on juvenile specimens (see Table 3). Measurements were taken to the nearest 0.1 mm with a digital caliper. Paired measurements were made on the left side, as was done in the recent revisions in the Acanthosaura crucigera species group (Wood et al. 2009, 2010; Ananjeva et al. 2011). Paired meristic characters are given as left/right. The list and methodology of measurements and meristic counts follow Wood et al. (2010) and Pauwels et al. (2015):

BEP presence (1) or absence (0) of a black eye patch;

CS number of canthus rostralis-supraciliary scales, counted from the nasal scale to the posterior end of the ridge at the posterior margin of the orbit;

DIAS length of the diastema, measured from the posterior end of the nuchal crest to the anterior end of the dorsal crest;

DIASN number of scales in the vertebral crest scale diastema, counted from the posterior end of the nuchal crest to the anterior end of the dorsal crest;

DS maximum length of the largest spine in the dorsal crest, measured from the base to the tip;

DSL longest dorsal scale, measured at the base below the dorsal crest;

ESBO presence (1) or absence (0) of elliptical scales below the orbit;

EYE eye diameter, measured from the posterior to the anterior edge of the eye;

FI number of subdigital lamellae on the fourth finger;

FOREL forelimb length, measured from axilla to the proximal edge of the palmar region;

GP size of gular pouch, scored as absent (0), small (1), medium (2), large (3) or very large (4);

HD maximum head height, measured across the parietal region;

HINDL hindlimb length, measured from groin to the proximal edge of the plantar region;

HL head length, measured from posterior edge of the lower jaw to the tip of the snout;

HW head width, maximum head width, the width at the level of the tympanum;

INFRAL number of infralabials;

LKP presence (1) or absence (0) of light knee patch;

MH mental height;

MW mental width;

NCS number of scales between the fifth canthals;

ND presence (1) or absence (0) of a black, diamond shaped, nuchal collar;

NR number of scales between the nasal and the rostral;

NS number of scales between the nasals;

NSCSL number of scales from the fifth canthal to the fifth supralabial;

NSL maximum length of the largest spine in the nuchal crest measured from the base to the tip;

NN number of nuchal crest spines (in addition to characters abbreviations listed in Pauwels et al. 2015);

NSSLC number of scales between the seventh supralabial and the sixth canthal;

NSSOS number of scales surrounding the occipital spine;

NSSPS number of scales surrounding the postorbital spine (in addition to characters abbreviations listed in Pauwelset al. 2015);

OF presence (1) or absence (0) of oblique humeral fold;

ORBIT orbit diameter, measured from the posterior to the anterior edge of the orbit;

OS length of the occipital spine, measured from the base to the tip;

PM number of scales bordering the mental;

PS postorbital spine length, measured from the base to the tip of the spine;

RH rostral height;

RS number of scales bordering the rostral scale;

RW rostral width;

SL snout length, measured from the anterior edge of the orbit to the tip of the snout;

SUPRAL number of supralabials;

SVL snout-vent length, measured from the tip of the snout to the tip of the vent;

TL tail length, measured from the posterior margin of the vent to the tip of the tail;

TBW tail base width, maximum width at tail base;

TD tympanum diameter, measured horizontally from the anterior to the posterior border of the tympanum;

TN scales absent on tympanum (0) or present (1);

TO subdigital lamellae on the fourth toe;

VENT number of ventral scales, counted at the midline from the anterior edge of the shoulders to the edge of the vent;

WNC maximum width of the spines in the nuchal crest, measured at the base;

WDS maximum width of the largest dorsal scale below the dorsal crest, measured at the base;

YAS presence (1) or absence (0) of a Y-shaped arrangement of enlarged scales on the snout.

We compared the characters of the new collection with the characters of all currently recognized species of Acanthosaura (Pauwels et al. 2015; Nguyen et al. 2018, 2019), see Table 4.

The character DIAS of Acanthosaura brachypoda is given both as 4.5 and 1.9 mm in the original description, which is based on a single specimen, so this character is not used here for comparisons. The methodology for taking FOREL and HINDL was insufficiently described in the original description of A. brachypoda and thus could not be compared here; CS, NCS, NR, NSCSL, NSSLC and NSSOS were not provided in the original description of A. brachypoda; NSSLC, PM, ND, LKP, ESBO and OF were not provided in the original description of A. murphyi; SL, ORBIT, WNC, FOREL, HINDL, VENT, OS, NSSOS, CS, RS, NS, NSC, NSCSL,NR, NSSLC, PM, YAS, BEP, ESBO and GP were not provided in the original description of A. phongdienensis.

Molecular data were generated for three specimens and all available homologous sequences obtained from GenBank, all new sequences have been deposited in GenBank. According to Ananjeva et al. (2008), the sequences whose GenBank accession numbers are AY572873 to AY572886 belong to Acanthosaura nataliae, and the sequences whose GenBank accession numbers are AY572896 to AY572899 belong to Acanthosaura coronata. According to Nguyen et al. (2019), it can be inferred that the sequences whose GenBank accession numbers are AY572900, AY572904, AY572905, AY572912 to AY572918, AY572922 and AY572923 probably belong to Acanthosaura phongdienensis. According to Pauwels et al. (2015), it can be inferred that the sequences whose GenBank accession numbers are AY572887 and AY572889 to AY572894 probably belong to Acanthosaura phuketensis. According to Kalyabina-Hauf et al. (2004) and Ananjeva et al. (2008), the sequences whose GenBank accession numbers are AY572928 to AY572930 belong to some unknown species. Two agamids Pseudocalotes brevipes (Werner, 1904) and Calotes versicolor (Daudin, 1802) were used as the outgroups based on the results from Kalyabina-Hauf et al. (2004). All the GenBank accession numbers for taxa used in the genetic analysis can be found in Table 1. Total genomic DNA was extracted from liver tissue stored in 99% ethanol. Tissue samples were digested using proteinase K, and subsequently purified following a standard phenol/chloroform isolation and ethanol precipitation (Sambrook et al. 1989). PCR was performed using primers new to this paper TBG–F: ATTCTCGCAATACACTACACAAC and TBG–R: TTTCAAATAATACTTGGGAGGTT. Amplification conditions were as follows: after an initial denaturation at 94 °C for 300 s, 31 cycles followed with a denaturation at 94 °C for 45 s, annealing at 42–45 °C for 45 s, and extension at 70 °C for 120 s; cycle sequencing reactions used a two-step program: 15 cycles followed with denaturation at 94 °C for 45 s, annealing at 47–53 °C for 45 s, extension at 70 °C for 60 s, and 15 cycles of denaturation at 94 °C for 45 s and extension at 60 °C for 60 s (Kalyabina-Hauf et al. 2004). We used a ratio of 0.55 H2O: 0.30 ExoI: 0.15 SAP to clean the PCR product (Hanke et al. 1994). Amplified mitochondrial cytochrome b (cytb) fragments were sequenced in both directions using an ABI PRISM 3730 Automated DNA Sequencer (Applied Biosystems) following the manufacturer’s protocol (Nguyen et al. 2019).

Table 1.
Download as
CSV
XLSX

Sequences (cytb) used in this study.

Species Locality Voucher no. GenBank no.
Acanthosaura armata Pulau Pinang, Pinang, Malaysia PCUM AY572871
Pulau Pinang, Pinang, Malaysia PCUM AY572872
No data NSMT-H4595 AB266452
No data No data NC_014175
Acanthosaura coronata Krong Pa, Gia Lai, Vietnam ROM31985 AY572896
Dong Nai, Cat Tien, Dong Nai, Vietnam ROM42240 AY572897
Dong Nai, Cat Tien, Dong Nai, Vietnam ROM37083 AY572898
Dong Nai, Cat Tien, Dong Nai,Vietnam ROM42241 AY572899
Acanthosaura crucigera Bago Division, Bago Yoma, Myanmar CAS206626 AY572888
Bago Division, Bago Yoma, Myanmar CAS208426 AY572895
Acanthosaura lepidogaster Chi Linh, Hia Duong, Vietnam ROM31954 AY572901
Chi Linh, Hia Duong, Vietnam ROM31957 AY572902
Chi Linh, Hia Duong, Vietnam ROM31960 AY572911
Chi Linh, Hia Duong, Vietnam ROM35038 AY572903
Tam Dao, Vinh Phu, Vietnam ROM30503 AY572906
Tam Dao, Vinh Phu, Vietnam ROM30720 AY572907
Tam Dao, Vinh Phu, Vietnam ROM30694 AY572908
Tam Dao, Vinh Phu, Vietnam ROM30693 AY572927
Quang Thanh, Cao Bang, Vietnam ROM36073 AY572909
Quang Thanh, Cao Bang, Vietnam ROM36075 AY572910
Nakai, Khammouane, Laos FMNH255488 AY572920
Nakai, Khammouane, Laos FMNH255487 AY572921
Thaphabat, Bolikhamxay, Laos FMNH255491 AY572919
Hainan, China MD001 KR092427
Sa Pa, Lao Cai, Vietnam ROM38117 AY572924
Sa Pa, Lao Cai, Vietnam ROM38115 AY572925
Sa Pa, Lao Cai, Vietnam ROM38116 AY572926
Acanthosaura nataliae Krong Pa, Gia Lai, Vietnam ROM31983 AY572873
Krong Pa, Gia Lai, Vietnam ROM32167 AY572874
Krong Pa, Gia Lai, Vietnam ROM32160 AY572875
Krong Pa, Gia Lai, Vietnam ROM31984 AY572876
Krong Pa, Gia Lai, Vietnam ROM32154 AY572877
Krong Pa, Gia Lai, Vietnam ROM32155 AY572878
Krong Pa, Gia Lai, Vietnam ROM32160 AY572879
Tram Lap, Gia Lai, Vietnam ROM30627 AY572880
Tram Lap, Gia Lai, Vietnam ROM30628 AY572881
Krong Pa, Gia Lai, Vietnam ROM32161 AY572882
Krong Pa, Gia Lai, Vietnam ROM32152 AY572883
Krong Pa, Gia Lai, Vietnam ROM32162 AY572884
Krong Pa, Gia Lai, Vietnam ROM32143 AY572885
Krong Pa, Gia Lai, Vietnam ROM32166 AY572886
Acanthosaura cf. phongdienensis Khe Moi River, Nghe An, Vietnam ROM26328 AY572900
Annam, Vu Quang, Ha Tinh, Vietnam ZISP20753-1 AY572904
Annam, Vu Quang, Ha Tinh, Vietnam ZISP20753-2 AY572905
Boualapha, Khammouane, Laos FMNH255481 AY572912
Con Cuong, Nghe An, Vietnam FMNH255582 AY572913
Con Cuong, Nghe An, Vietnam FMNH255583 AY572914
Tuong Duong, Nghe An, Vietnam FMNH255585 AY572915
Tuong Duong, Nghe An, Vietnam FMNH255587 AY572916
Con Cuong, Nghe An, Vietnam FMNH255581 AY572917
Tuong Duong, Nghe An, Vietnam FMNH255584 AY572918
Vieng Tong, Huaphan, Laos FMNH255489 AY572922
Khao Yoi, Thailand PCUM AY572923
Acanthosaura cf. phuketensis Kao Yoi, Phetchaburi, Thailand No data AY572887
Khao Lak, TakuaPa, Phang Nga, Thailand PCUM AY572889
Khao Lak, TakuaPa, Phang Nga, Thailand PCUM AY572890
Khao Lak, TakuaPa, Phang Nga, Thailand PCUM AY572891
ThaiMuang, Phang Nga, Thailand IRSNB15141 AY572892
Malaysia No data AY572893
Malaysia No data AY572894
Acanthosaura sp. 1 Myanmar HLMD-RA2969 AY572929
Acanthosaura sp. 1 Myanmar HLMD-RA2970 AY572930
Acanthosaura sp. 2 Ngoc Linh, Kon Tum, Vietnam ROM37082 AY572928
Calotes versicolor Vietnam HLDM57 AY572870
Pseudocalotes brevipes Pac Ban, Tuyen Quang, Vietnam ROM30515 AY572869
Acanthosaura tongbiguanensis sp. nov. Tongbiguan, Dehong, Yunnan, China KIZL201801 MN604012
Tongbiguan, Dehong, Yunnan, China KIZL201802 MN604013
Tongbiguan, Dehong, Yunnan, China KIZL201803 MN604014

Sequences were aligned using CLUSTAL X v1.83 (Thompson et al. 1997) with the default parameters and the alignment revised by eye. Pairwise distances between species were calculated in MEGA 7 (Tamura et al. 2011). The best substitution model HKY+G+I was selected using the Akaike Information Criterion (AIC) in MODELTEST v3.7 (Posada and Crandall 1998). Bayesian phylogenetic inference was performed in MRBAYES 3.2.6 (Wang et al. 2009, Ronquist et al. 2012) based on the selected substitution model. Two runs were performed simultaneously with four Markov chains starting from random tree. The chains were run for 1,000,000 generations and sampled every 100 generations. The first 25% of the sampled trees was discarded as burn-in after the standard deviation of split frequencies of the two runs was less than a value of 0.01, and then the remaining trees were used to create a 50% majority-rule consensus tree and to estimate Bayesian posterior probabilities (BPPs). Maximum likelihood analysis was performed in MEGA 7 (Tamura et al. 2011), nodal support was estimated by 1,000 rapid bootstrap replicates.

Results

The obtained sequence alignment is 795 bp in length. Both Bayesian inference and Maximum likelihood analyses recovered this lineage of the new samples as the sister to the clade consisting of Acanthosaura crucigera and A. cf. phuketensis with weak support (Figures 1, 2). The average uncorrected pairwise distances (p-distance) between other investigated members of Acanthosaura ranged from 11.17% to 23.9%, the average uncorrected pairwise distances (p-distance) between the new species and investigated congeners ranged from 14.46% to 23.27% (Table 2).

Figure 1. 

Bayesian phylogram of investigated members of Acanthosaura inferred from cytb gene. The nodal numbers are Bayesian posterior probabilities (only values above 70% are shown).

Figure 2. 

Maximum likelihood phylogram of investigated members of Acanthosaura inferred from cytb gene. The nodal numbers are ML bootstrap values (only values above 50% are shown).

Table 2.
Download as
CSV
XLSX

Average uncorrected p-distances (%) between investigated members of Acanthosaura and outgroups calculated from cytb gene sequences.

Species 1 2 3 4 5 6 7 8 9 10 11
1 Acanthosaura tongbiguanensis sp. nov.
2 A. armata 14.80
3 A. coronata 23.27 22.20
4 A. crucigera 15.52 15.11 22.71
5 A. lepidogaster 15.18 16.11 22.48 16.52
6 A. nataliae 14.94 14.90 22.15 15.45 13.72
7 A. cf. phongdienensis 15.88 14.43 22.63 15.23 12.32 14.77
8 A. cf. phuketensis 14.46 14.83 22.65 11.17 15.35 15.02 14.04
9 Acanthosaura sp. 1 22.94 21.81 16.18 22.51 23.04 23.77 23.62 23.86
10 Acanthosaura sp. 2 15.35 14.08 23.90 16.47 14.82 15.82 14.93 15.79 23.78
11 Pseudocalotes brevipes 22.85 24.43 26.92 24.32 23.66 24.00 24.79 24.44 26.39 24.67
12 Calotes versicolor 27.25 25.49 28.40 27.60 27.75 27.11 26.39 26.38 28.56 29.33 28.00

Systematics

Acanthosaura tongbiguanensis sp. nov.

http://zoobank.org/6E91FE2B-A4E7-4A7E-BD68-A9C883760883
Figures 3, 4, 5, 6, 10

Acanthosaura lepidogaster: Zhao et al. 1999: 82–85.

Acanthosaura lepidogaster: Yang and Rao 2008: 186–187.

Type material

Holotype. KIZL201804, an adult male, 22:18 02 Sept 2018, leg. Shuo Liu, Tongbiguan Township (24°36’51.24”N, 97°35’1.88”E, 1170.24 m elevation), Yingjiang County, Dehong Autonomous Prefecture, Yunnan, China.

Paratypes. KIZL201801, an adult male, 22:53 01 Sept 2018, leg. Shuo Liu, same locality as holotype; KIZL201802 and KIZL201803, two juveniles, 21:00–22:00 02 Sept 2018, leg. Shuo Liu, same locality as holotype; KIZL201805, adult female, 22:40 02 Sept 2018, leg. Shuo Liu, same locality as holotype; 74I0039 and 74I0040, two gravid females, old specimens in the specimen collection room of Kunming Institute of Zoology, Chinese Academy of Sciences, Aug 1974, leg. Longchuan County, Dehong Autonomous Prefecture, Yunnan, China.

Etymology

The name refers to Tongbiguan Nature Reserve, the locality where the new species was found.

Diagnosis

A medium-sized (maximum SVL 115.6 mm) agamid lizard with two pairs of spines: postorbital (supraciliary) spines and spines on occiput between tympanum and nuchal crest; tympanum naked; moderately developed gular pouch; scales on flanks randomly intermixed with medium and large scales; nuchal crest present and strongly developed; diastema between the nuchal and dorsal crests present; dorsal crest slightly developed, composed of enlarged, pointed scales beginning at shoulder region and decreasing regularly in size; tail 1.56–1.85 times SVL; black nuchal collar present; black eye patch present; black oblique folds anterior to the fore limb insertions present.

The new species can be separated from all congeners by having different numbers of subdigital lamellae on the fourth finger (19–21) and toe (25–28), and a different shape of the black eye patch, that extends from posterior margin of nostrils through orbit posteriorly and downwards beyond the posterior end of the tympanum but neither meeting the diamond shaped black nuchal collar on nape nor black oblique humeral fold.

Description of the holotype

Adult male. SVL 110.8 mm. TL 205.0 mm, tail complete. Head length 31.1 mm; head moderately long (HL/SVL 28%), somewhat narrow (HW/SVL 18%), not tall (HD/HL 52%), triangular in dorsal and lateral profile. Snout short (SL/HL 31%); interorbital and frontal regions and rostrum wide, steeply sloping anteriorly. Canthus rostralis prominent, forming a large projecting ridge extending above eye, composed of 11/13 enlarged scales; the ridge terminates with a notch anterior to the postorbital spine. Rostral moderate in size, rectangular; nasal concave, nostrils surrounded by a circular scale. Eye relatively large (EYE/HL 22%), orbit very large (ORBIT/HL 35%). Prefrontal and frontal scales slightly keeled and larger than scales between supralabials; scales on occiput weakly keeled. Moderately elongate epidermal spine above posterior margin of eye, straight, surrounded by 5/4 enlarged scales. A notch present between the supraciliary edge and postorbital spine. Moderately elongate epidermal spine on occipital region, straight, surrounded by a rosette of 5/4 short spiny scales. Tympanum exposed, oblong, surrounded by small scales. Supralabials 13/13, rectangular, scales in center of series largest; mental squarish above, becoming triangular below, larger than first pair of INFRAL; five scales contacting the mental; infralabials 13/12, rectangular, scales in center of series largest; gulars sharply keeled and spinose. Dewlap extensible, gular pouch moderate. Nuchal crest composed of four very elongate, lanceolate, laterally compressed scales and one moderately elongate, lanceolate, laterally compressed scale bordered on each side by one row of enlarged, spinose scales; nuchal crest followed by a diastema at base of nape. Dorsal body crest slightly developed, extending from posterior margin of diastema onto base of tail; vertebral crest composed of enlarged, epidermal, laterally compressed, spinose scales, bordered by a single row of smaller paravertebral spinose scales; vertebral crest tapers slightly to base of tail, then fades progressively. Body slightly short, triangular in cross-section. Dorsal scales small, mixed with large scales indistinctly arranged in slanted forward and downward rows from the midline of the back, keels projecting posterior wards; scales of pectoral region and abdomen larger than dorsal scales, keeled, more or less arranged in transverse rows; keeled scales anterior to vent not enlarged. Limbs relatively long (FOREL/SVL 39%, HINDL/SVL 56%); dorsal and ventral scales of forelimbs keeled, spinose, about the same size. Five digits on manus; subdigital scales keeled, subdigital lamellae under fourth finger 20/21. Scales of hind limbs keeled and spinose; postfemoral scales small, interspersed with larger spinose scales. Five digits on pes; subdigital scales keeled, subdigital lamellae under fourth toe 26/27. Tail length 1.85 times SVL, tail covered with keeled spinose scales, keels on subcaudals directed posteriorly; subcaudals much longer than supracaudals; base of tail 13.1 mm wide.

Figure 3. 

Adult male holotype (KIZL201804) of Acanthosaura tongbiguanensis sp. nov. in life A lateral view of the head B dorsal view of the body C dorsal view of the head D lateral view of the body E ventral view of the head F ventral view of the body.

Figure 4. 

Adult female paratype (KIZL201805) of Acanthosaura tongbiguanensis sp. nov. in life A lateral view of the head B dorsal view of the body C dorsal view of the head D lateral view of the body E ventral view of the head F ventral view of the body.

Figure 5. 

Adult male paratype (KIZL201801) of Acanthosaura tongbiguanensis sp. nov. in life A lateral view of the head B dorsal view of the body C dorsal view of the head D lateral view of the body E ventral view of the head F ventral view of the body.

Figure 6. 

Dorsal view (top) and ventral view (bottom) of type series of Acanthosaura tongbiguanensis sp. nov. in preservative. From left to right: male holotype (KIZL201804), female paratype (KIZL201805), male paratype (KIZL201801), female paratype (74I0039), female paratype (74I0040), juvenile paratype (KIZL201802), juvenile paratype (KIZL201803).

Figure 7. 

Comparison of three different types of eye patch A Acanthosaura tongbiguanensis sp. nov. B A. lepidogaster C A. nataliae.

Figure 8. 

The type locality of Acanthosaura tongbiguanensis sp. nov. (black dot) close to the border with Myanmar.

Figure 9. 

Habitat at the type locality of Acanthosaura tongbiguanensis sp. nov., Tongbiguan Township, Yingjiang County, Dehong Autonomous Prefecture, Yunnan, China A distant view B close view.

Color of holotype in life

Dorsal surface of head black, dorsal surface of body and limbs orangish brown; black eye patch extending from posterior margin of nostrils through orbit posteriorly and downwards beyond the posterior end of the tympanum but neither meeting the diamond shaped black nuchal collar on nape nor black oblique folds anterior to the fore limb insertions; upper lip white, same as color of lateral and ventral sides of neck, lower lip white with small black speckle at posterior region; iris orangish brown; black nuchal collar extending downward to reach black oblique folds anterior to fore limb insertions, two white patches at lower back of black nuchal collar; gular region white; postorbital spines, occipital spines, nuchal crest spines and ridge of the rostral and orbit cream-colored; tongue and inside of mouth pink; few small black speckles and yellow diagonal stripes from midline of the back, irregular light colored spots on sides of body not obvious; stripes checkered with black and white on dorsal ground of limbs and tail; ventral sides of limbs and body white, front part white and back part dark on ventral side of tail. However, it should be noted that this species can change the color of its body within a certain range like most other members of the genus.

Variations

Morphometric and meristic data for the type series are provided in Table 3. The paratypes resemble the holotype in most aspects except that the male KIZL201801 has a darker dorsal ground of the body with no black speckles in the dorsal pattern, and the number of nuchal crest scales is six. The female KIZL201805 has a much darker dorsal ground of the body and irregular black patterns on the ventral sides of the body, limbs, and tail; light colored spots on the sides of the body are more obvious, the color in the gular region is a bit darker. The juveniles KIZL201802 and KIZL201803 have much shorter postorbital, occipital, and nuchal crest spines, and obvious radial patterns around the eyes; the colors of the bodies are relatively darker, the yellow diagonal stripes from the midline of the back are more obvious; they also have irregular black patterns on the ventral sides of the body, limbs, and tail; nuchal crest scales of KIZL201803 numbers four. The females 74II0039 and 74I0040 were not observed alive but only in preservative: the female 74II0039 has a much more obvious black speckling in the dorsal pattern while the female 74II0039 has no black speckles, but they both have irregular black patterns on the ventral sides of the body, limbs, and tail; both have six nuchal crest scales.

Table 3.
Download as
CSV
XLSX

Morphometric (in mm) and meristic data for the type series of Acanthosaura tongbiguanensis sp. nov. For character abbreviations see material and methods. Paired meristic characters are given left/right. NA = not applicable.

Adult males Adult females Juveniles Range Mean
Holotype Paratype Paratypes Paratypes
KIZL201804 KIZL201801 KIZL201805 74II0039 74I0040 KIZL201802 KIZL201803
SVL 110.8 108.1 107.2 93.0 115.6 NA NA 93.0–115.6 106.9
TL 205.0 NA 180.0 144.9 183.5 NA NA 144.9–205.0 178.4
TL/SVL 1.85 NA 1.68 1.56 1.59 NA NA 1.56–1.85 1.7
TBW 13.1 13.0 9.2 10.5 12.1 NA NA 9.2–13.1 11.6
HL 31.1 33.0 30.4 27.5 33.2 NA NA 27.5–33.2 31.0
HW 20.0 22.0 18.8 18.6 23.3 NA NA 18.6–23.3 20.5
HD 16.1 17.4 15.7 13.9 17.3 NA NA 13.9–17.4 16.1
SL 9.8 10.3 10.1 9.2 11.0 NA NA 9.2–11.0 10.1
ORBIT 11.0 10.6 10.2 7.7 10.6 NA NA 7.7–11.0 10.0
EYE 6.9 5.8 6.9 6.0 7.3 NA NA 5.8–7.3 6.6
TD 3.6 4.2 3.3 3.2 3.7 NA NA 3.2–4.2 3.6
TD/HD 0.22 0.24 0.21 0.23 0.21 NA NA 0.21–0.24 0.2
TN 0 0 0 0 0 0 0 0 0
PS 5.3 6.3 4.6 3.6 5.4 NA NA 3.6–6.3 5.0
PS/HL 0.17 0.19 0.15 0.13 0.16 NA NA 0.13–0.19 0.2
NSSPS 5/4 5/5 5/5 5/5 5/NA 4/4 4/4 4/4–5/5 4.7/4.5
NSL 6.5 6.7 5.4 4.0 6.2 NA NA 4.0–6.7 5.8
NSL/HL 0.21 0.20 0.18 0.15 0.19 NA NA 0.15–0.21 0.2
DS 3.7 4.2 3.7 2.4 3.8 NA NA 2.4–4.2 3.6
DS/HL 0.12 0.13 0.12 0.09 0.11 NA NA 0.09–0.13 0.1
NN 5 6 5 6 6 5 4 4–6 5.3
DSL 1.9 1.9 1.8 1.7 2.6 NA NA 1.7–2.6 2.0
WNC 1.2 1.5 1.0 1.1 1.5 NA NA 1.0–1.5 1.3
WDS 1.4 1.5 1.5 1.4 2.1 NA NA 1.4–2.1 1.6
DIAS 6.0 5.6 5.5 6.1 3.9 NA NA 3.9–6.1 5.4
DIAS/SVL 0.05 0.05 0.05 0.07 0.03 NA NA 0.03–0.07 0.1
DIASN 10 8 9 8 6 7 9 6–10 8.1
FOREL 43.2 42.5 42.4 34.7 41.3 NA NA 34.7–43.2 40.8
HINDL 62.1 63.9 62.5 54.1 62.9 NA NA 54.1–63.9 61.1
SUPRAL 13/13 14/14 13/13 11/11 13/13 11/11 12/12 11–14 12.4/12.4
INFRAL 13/12 13/14 14/14 12/11 12/12 10/11 12/13 10–14 12.3/12.4
VENT 66 59 62 52 53 53 60 52–66 57.9
FI 20/21 20/19 21/20 19/19 21/20 20/20 20/21 19–21 20.1/20.0
TO 26/27 25/26 28/27 27/26 26/25 26/27 25/26 25–28 26.1/26.3
OS 6.1 7.0 6.9 4.5 6.3 NA NA 4.5–7.0 6.2
OS/HL 0.20 0.21 0.23 0.16 0.19 NA NA 0.16–0.23 0.2
NSSOS 5/4 5/5 4/4 5/5 5/5 5/5 4/4 4–5 4.7/4.6
CS 11/13 14/15 13/13 10/10 12/11 11/10 13/11 10–14 12.0/11.9
RW 3.7 4.5 3.4 3.3 3.5 NA NA 3.3–4.5 3.7
RH 1.6 1.7 2.0 1.0 1.9 NA NA 1.0–2.0 1.6
RS 9 9 7 7 7 6 6 6–9 7.3
NS 9 8 8 8 8 8 8 8–9 8.1
NCS 11 11 10 12 13 11 10 10–13 11.1
NSCSL 9 8 9 7 8 9 8 7–9 8.3
NR 2 2 2 2 2 2 2 2 2
NSSLC 13 10 13 10 9 11 12 9–13 11.1
MW 1.6 1.4 1.4 1.9 1.5 NA NA 1.4–1.9 1.6
MH 1.2 2.0 1.3 1.4 1.7 NA NA 1.2–2.0 1.5
PM 5 4 5 5 4 4 5 4–5 4.6
YAS 1 1 1 1 1 1 1 1 1
ND 1 1 1 1 1 1 1 1 1
LKP 1 1 1 1 1 1 1 1 1
BEP 1 1 1 1 1 1 1 1 1
ESBO 0 0 0 0 0 0 0 0 0
GP 2 2 2 2 2 1 1 1–2 1.7
OF 1 1 1 1 1 1 1 1 1

Distribution

Acanthosaura tongbiguanensis sp. nov. is only recorded in Tongbiguan Nature Reserve including Yingjiang County, Longchuan County and Ruili City, the border region with northern Myanmar in western Yunnan, China, so it probably occurs in northern Myanmar.

Natural history

The type series of Acanthosaura tongbiguanensis sp. nov. was collected at night while they were asleep on small trees in a primordial forest. However, we suppose that they forage for food on the ground during the day. At the type locality we found four other species of reptiles, namely Cyrtodactylus khasiensis (Jerdon, 1870), Pseudocalotes kakhienensis (Anderson, 1879); P. microlepis (Boulenger, 1887); Trimeresurus yingjiangensis Chen et al., 2019; and seven species of amphibians, Leptobrachella yingjiangensis (Yang et al., 2018); Limnonectes longchuanensis Suwannapoom et al., 2016; Megophrys feii Yang et al., 2018; M. glandulosa Fei et al., 1990; Raorchestes longchuanensis (Yang & Li, 1978); Theloderma moloch (Annandale, 1912); Zhangixalus smaragdinus (Blyth, 1852).

Comparisons

Table 4 shows a comparison of morphometric and meristic data for all currently recognized species of Acanthosaura and Acanthosaura tongbiguanensis sp. nov. It is based mostly on the interspecific comparison tables provided by Pauwels et al. (2015: table 2), Nguyen et al. (2018: table 3) and Nguyen et al. (2019: table 3).

Table 4.
Download as
CSV
XLSX

Comparisons of morphometric (in mm) and meristic data for all currently recognized species of Acanthosaura and Acanthosaura tongbiguanensis sp. nov., “?” = data not available. (1) Acanthosaura tongbiguanensis sp. nov.; (2) A. armata; (3) A. bintangensis; (4) A. brachypoda; (5) A. capra; (6) A. cardamomensis; (7) A. coronata; (8) A. crucigera; (9) A. lepidogaster; (10) A. murphyi; (11) A. nataliae; (12) A. phongdienensis; (13) A. phuketensis; (14) A. titiwangsaensis.

(1) (2) (3) (4) (5) (6) (7) (8) (9) (10) (11) (12) (13) (14)
SVL 93.0–115.6 72.4–138.0 83.9–142.0 117 94.0–137.9 82–149 66.0–86.1 92.2–127.0 76.5–101.1 103.7–127.3 106.7–158.0 58.5–77.4 69.2–123.5 91.8–118.4
TL 144.9–205.0 96.6–190 112.8–206.0 185.4 133.6–182.1 103–188 86.3–105.0 130.0–174.0 130.6–144.1 159.3–195.8 171.0–287.0 94.6–137.2 107.0–205.6 136.0–174.0
HL 27.5–33.2 6.6–33.7 16.9–25.4 30.3 16.3–38.9 16.3–42.4 14.4–16.3 18.7–23.6 18.9–29.7 29.1–36.8 25.2–43.6 18.6–23.8 19.7–31.4 20.0–24.3
HW 18.6–23.3 15.3–23.0 17.5–23.4 20.6 16.8–27.0 16.4–27.7 13.6–17.5 16.0–22.3 13.4–19.1 20.3–24.6 20.2–27.8 13.1–15.9 14.4–22.8 17.5–23.4
HD 13.9–17.4 12.2–18.9 15.0–19.2 17.2 14.8–24.3 12.6–21.7 11.9–16.8 15.7–22.5 12.0–12.5 18.5–20.6 16.9–24.9 10.4–13.6 10.9–18.6 15.7–20.2
SL 9.2–11.0 6.3–16.6 7.9–11.3 12.2 7.6–16.6 8.6–18.7 6.9–8.4 8.7–12.1 9.3–10.2 10.3–15.3 12.0–19.9 ? 6.8–11.0 9.7–12.5
ORBIT 7.7–11.0 5.4–12.2 8.4–12.6 8.3 7.6–11.6 6.0–12.7 6.9–7.5 8.9–10.8 4.7–9.1 9.9–12.3 7.2–10.9 ? 6.6–11.2 9.8–13.2
TD 3.2–4.2 2.4–5.2 2.5–3.0 3.6 3.4–5.2 2.5–5.8 1.7–2.8 2.5–3.9 2.2–3.0 3.2–5.2 3.9–7.0 1.78–2.81 3.5–4.7 2.7–4.0
TD/HD 0.21–0.24 0.19–0.28 0.16 0.21 0.21–0.23 0.20–0.27 0.14–0.17 0.14–0.21 0.18–0.24 0.17–0.28 0.23–0.28 0.17–0.22 0.22–0.33 0.17–0.20
TN 0 0 0 0 0 0 0 0 0–1 1 0 0 0 0
PS 3.6–6.3 4.9–9.9 1.9–4.2 3.2 5.2–10.2 3.2–12.7 Absent 1.9–7.8 1.5–2.5 5.6–11.8 7.7–17.8 1.18–2.07 4.6–11.8 3.3–4.4
PS/HL 0.13–0.19 0.22–0.56 0.07–0.19 0.11 0.36 0.14–0.45 0 0.09–0.33 0.06–0.11 0.16–0.34 0.36 0.06–0.09 0.23–0.38 0.14–0.18
NSL 4.0–6.7 5.5–11.2 1.3–4.7 4.7 4.2–14.7 3.8–17.4 0 3.1–8.9 2.9–3.4 7.0–14.9 8.5–23.8 1.24–4.18 4.1–12.2 2.7–4.4
NSL/HL 0.15–0.21 0.22–0.51 0.17–0.21 0.16 0.42–0.43 0.17–0.66 0 0.14–0.38 0.12–0.15 0.24–0.43 0.58 0.07–0.18 0.21–0.39 0.11–0.18
DS 2.4–4.2 4.9–11.3 1.8–2.2 1.9 3.5–6.8 2.0–14.2 Absent 2.0–5.5 1.5–2.7 2.6–10.5 6.0–17.7 0.58–1.65 2.3–8.3 1.7–2.1
DS/HL 0.09–0.13 0.20–0.52 0.08–0.09 0.06 0.16–0.17 0.14–0.45 0 0.09–0.24 0.07–0.12 0.14–0.51 0.44 0.03–0.07 0.11–0.26 0.07–0.09
WNC 1.0–1.5 1.0–2.2 1.6–2.1 1.6 2.3–4.1 1.8–4.2 0 1.3–3.4 1.5 2.9–4.8 3.1–4.8 ? 1.4–2.9 1.4–1.6
DIAS 3.9–6.1 1.2–6.8 5.0–7.9 ? 2.0–6.7 2.7–8.3 Absent 4.9–8.4 6.3 2.6–4.8 2.5 Absent 3.6–7.6 5.1–7.6
DIASN 6–10 1–8 11–15 7 4–7 6–15 Absent 9–25 10–12 4–8 10 Absent 12–17 10–13
DIAS/SVL 0.03–0.07 0.01–0.06 0.04–0.07 ? 0.05 0.03–0.07 Absent 0.04–0.08 0.08 0.02–0.04 0.04 Absent 0.05–0.08 0.05–0.07
FOREL 34.7–43.2 33.7–48.9 33.9–61.5 ? 54.2–83.8 31.7–56.8 30.2–35.3 35.6–49.8 33.0–37.1 49.8–56.6 60.0–85.0 ? 22.3–42.9 38.0–51.7
HINDL 54.1–63.9 39.0–69.6 43.3–68.6 ? 78.5–107.2 42.0–77.1 38.4–47.8 48.8–65.0 49.4–50.4 60.4–68.4 85.0–129.7 ? 38.2–60.6 48.5–65.6
SUPRAL 11–14 10–14 12 12–13 10 11–15 12–13 10–13 10–13 12–14 11 9–12 10–12 12–13
INFRAL 10–14 12–15 11–12 11 12–13 10–14 11–13 10–12 9–13 12–14 11–12 10–11 10–12 11–12
VENT 52–66 51–68 51–55 63 55–66 50–65 53–58 55–63 55–61 55–65 64–71 ? 57–67 47–57
FI 19–21 13–17 23 18 16–17 15–20 13–14 16–18 17–19 15–18 16–21 14–17 15–17 20–21
TO 25–28 19–26 26–28 24 22–24 20–25 17–19 21–26 22–23 21–23 20–27 19–23 21–24 23–27
TL/SVL 1.56–1.85 1.2–1.6 1.3–1.4 1.58 1.2–1.5 1.2–1.6 0.6–1.0 1.1–1.8 1.6–1.9 1.48–1.54 1.2–1.5 1.5–1.9 1.4–1.7 1.1–1.5
OS 4.5–7.0 4.0–9.4 1.2–2.6 1.0 Absent 4.1–13.3 0 2.5–4.9 3.2–3.4 Absent Absent ? 2.6–9.5 1.8–2.3
OS/HL 0.16–0.23 0.16–0.38 0.10–0.11 0.03 0 0.24–0.56 0 0.11–0.50 0.14–0.15 0 0 ? 0.13–0.30 0.09–0.10
NSSOS 4–5 4–6 6–7 ? Absent 4–6 4–5 4–6 5 Absent Absent ? 4–5 4–5
CS 10–14 11–15 14–15 ? 12–14 11–16 12–15 12–15 10–12 12–14 13 9–13 10–14 14–15
RW 3.3–4.5 1.8–4.5 3.6–5.3 3.5 4.2–4.6 1.7–4.7 0.8–0.9 2.7–4.0 2.8–3.0 3.3–5.1 6.1 2.07–2.65 2.3–3.8 3.6–5.2
RH 1.0–2.0 0.9–1.8 1.7–2.0 2.3 1.8–2.3 1.1–2.2 0.5–0.8 1.3–2.0 1.4–1.5 1.2–2.0 2.6 1.00–1.32 1.1–1.7 1.4–1.8
RS 6–9 5–9 7–9 7 7–8 5–9 5 7–9 5–9 8–9 6 ? 5–8 9
NS 8–9 7–10 8 9 9 7–10 7–9 7–9 7–8 7–8 8 ? 7–8 8
NCS 10–13 10–17 10–11 ? 9 9–17 8–11 9–12 7–10 13–16 14 ? 12–13 11–12
NSCSL 7–9 6–14 7–8 ? 7–8 7–12 5–6 7–11 8 7–10 8 ? 8–10 9–11
NR 2 1–2 1 ? 1–2 1–2 3–4 1–2 1–2 3–4 1 ? 1–2 1–2
NSSLC 9–13 10–22 9–12 ? 9–11 10–19 6–11 10–14 10 ? 16 ? 11–14 11–14
MW 1.4–1.9 0.9–2.0 1.3–1.8 2.9 1.9–2.2 0.2–2.1 0.6–1.5 1.0–1.5 1.2–1.3 1.7–2.2 2.9 0.87–1.52 0.5–1.4 1.4–2.0
MH 1.2–2.0 0.8–2.2 1.4–2.1 2.1 1.7–2.2 0.9–2.0 1.3–1.6 1.1–1.7 1.2–1.3 1.4–2.0 2.0 1.04–1.60 0.6–1.6 1.4–2.4
PM 4–5 3–6 4–5 4 4 4–5 4–5 4 5 ? 4 ? 4 5
YAS 1 0–1 1 1 1 0–1 0–1 1 1 0–1 1 ? 0–1 1
ND 1 0–1 1 1 1 1 0 1 1 ? 0 1 1 1
LKP 1 1 0 1 1 1 1 1 1 ? 0 1 1 0
BEP 1 0 1 1 1 1 0 1 0–1 0–1 1 ? 1 1
ESBO 0 0 1 0 0 0 0 0 0 ? 0 ? 0 0
GP 1–2 1 3–4 0 3–4 1–4 0 1–2 0–1 4 4 ? 0–2 2–4
OF 1 1 1 1 1 1 1 1 1 ? 1 1 1 1

Acanthosaura tongbiguanensis sp. nov. can be distinguished from A. armata by having more subdigital lamellae on the fourth finger (19–21 vs. 13–17) and the fourth toe (25–28 vs. 19–26), shorter postorbital spines (3.6–6.3 vs. 4.9–9.9 mm, PS/HL 0.13–0.19 vs. 0.22–0.56) and shorter occipital spines (4.5–7.0 vs. 4.0–9.4 mm, OS/HL 0.16–0.23 vs. 0.16–0.38), much shorter nuchal crest spines (4.0–6.7 vs. 5.5–11.2 mm, NSL/HL 0.15–0.21 vs. 0.22–0.51) and much shorter dorsal crest spines (2.4–4.2 vs. 4.9–11.3 mm, DS/HL 0.09–0.13 vs. 0.20–0.52), a higher number of scales in the diastema between the nuchal and the dorsal crests (6–10 vs. 1–8), a relatively longer tail (TL/SVL 1.56–1.85 vs. 1.2–1.6). Acanthosaura tongbiguanensis sp. nov. has a black eye patch (vs. absent) and an obvious black nuchal collar (vs. not obvious or absent); Acanthosaura tongbiguanensis sp. nov. has fewer or no spots on the dorsal surface of the body, whereas A. armata has more spots on the dorsal surface of the body.

The new species can be distinguished from Acanthosaura bintangensis by having a larger tympanum (3.2–4.2 vs. 2.5–3.0 mm, TD/HD 0.21–0.24 vs. 0.16), longer head (27.5–33.2 vs. 16.9–25.4 mm), longer postorbital spines (6.3 vs. 4.2 mm), higher maximal length of spines in the nuchal crest (6.7 vs. 4.7), longer spines in the dorsal crest (2.4–4.2 vs. 1.8–2.2 mm, DS/HL 0.09–0.13 vs. 0.08–0.09), less subdigital lamellae on the fourth finger (19–21 vs. 23), much longer occipital spines (4.5–7.0 vs. 1.2–2.6 mm, OS/HL 0.16–0.23 vs. 0.10–0.11), less scales surrounding the occipital spine (4–5 vs. 6–7), lower number of scales in the diastema between the nuchal and the dorsal crests (6–10 vs. 11–15), presence of a light knee patch (vs. absence), less developed gular pouch (1–2 vs. 3–4), absence of an enlarged row of keeled scales below orbit (vs. presence), absence of large yellow spots edged in blackish-brown arranged on body and base of tail (vs. presence); the black eye patch in Acanthosaura tongbiguanensis sp. nov. extends backward and downward beyond the posterior end of the tympanum while it never extends onto the head side in A. bintangensis (Wood et al. 2009).

From Acanthosaura brachypoda, Acanthosaura tongbiguanensis sp. nov. can be differentiated by having more subdigital lamellae on the fourth finger (19–21 vs. 18) and the fourth toe (25–28 vs. 24), longer postorbital spines (3.6–6.3 vs. 3.2 mm, PS/HL 0.13–0.19 vs. 0.11) and longer occipital spines (4.5–7.0 vs. 1.0 mm, OS/HL 0.16–0.23 vs. 0.03), much longer spines in the dorsal crest (2.4–4.2 vs. 1.9 mm, DS/HL 0.09–0.13 vs. 0.06), the presence of gular pouch (vs. absence). Acanthosaura tongbiguanensis sp. nov. does not have pairs of transverse creamy spots along both sides of spine forming a symmetrical pattern present as in A. brachypoda.

Acanthosaura tongbiguanensis sp. nov. can be distinguished from A. capra based on its smaller body size (93.0–115.6 vs. 94.0–137.9 mm) but longer tail (144.9–205.0 vs. 133.6–182.1 mm, TL/SVL 1.56–1.85 vs. 1.2–1.5), a higher number of subdigital lamellae on the fourth finger (19–21 vs. 16–17) and the fourth toe (25–28 vs. 22–24), lower maximal length of forelimb (43.2 vs. 83.8 mm) and hindlimb (63.9 vs. 107.2 mm), shorter postorbital spines (3.6–6.3 vs. 5.2–10.2 mm, PS/HL 0.13–0.19 vs. 0.36), nuchal crest spines (4.0–6.7 vs. 4.2–14.7 mm, NSL/HL 0.15–0.21 vs. 0.42–0.43) and dorsal crest spines (2.4–4.2 vs. 3.5–6.8 mm, DS/HL 0.09–0.13 vs. 0.16–0.17),lower width of the nuchal crest spines (1.0–1.5 vs. 2.3–4.1 mm), higher number of scales in the diastema between nuchal and dorsal crests (6–10 vs. 4–7), presence of occipital spines (vs. absence), a smaller gular pouch (1–2 vs. 3–4); the black eye patch in Acanthosaura tongbiguanensis sp. nov. extends backward and downward beyond the posterior end of the tympanum, while it usually extends backwards and upwards to reach the nuchal crests in A. capra.

From Acanthosaura cardamomensis, the new species can be separated based on a higher number of subdigital lamellae on the fourth finger (19–21 vs. 15–20) and the fourth toe (25–28 vs. 20–25), a longer tail (144.9–205.0 vs. 103–188 mm, TL/SVL 1.56–1.85 vs. 1.2–1.6), much shorter postorbital spines (3.6–6.3 vs. 3.2–12.7 mm, PS/HL 0.13–0.19 vs. 0.14–0.45), occipital spines (4.5–7.0 vs. 4.1–13.3 mm, OS/HL 0.16–0.23 vs. 0.24–0.56), nuchal crest spines (4.0–6.7 vs. 3.8–17.4 mm, NSL/HL 0.15–0.21 vs. 0.17–0.66) and dorsal crest spines (2.4–4.2 vs. 2.0–14.2 mm, DS/HL 0.09–0.13 vs. 0.14–0.45), a lower width of nuchal crest spines (1.0–1.5 vs. 1.8–4.2 mm); the black eye patch in Acanthosaura tongbiguanensis sp. nov. extends backward and downward beyond the posterior end of the tympanum but never reaches the dark nuchal marking on nape while it does so in A. cardamomensis (see species’ description and photographs in Wood et al. 2010), besides, Acanthosaura tongbiguanensis sp. nov. has fewer or no spots on the dorsal surface of the body, whereas A. cardamomensis has more spots on the dorsal surface of the body.

Acanthosaura tongbiguanensis sp. nov. is distinguishable from A. coronata based on its much bigger body size (93.0–115.6 vs. 66.0–86.1 mm), much longer tail (144.9–205.0 vs. 86.3–105.0 mm, TL/SVL 1.56–1.85 vs. 0.6–1.0), higher number of subdigital lamellae on the fourth finger (19–21 vs. 17–19) and the fourth toe (25–28 vs. 22–23), relatively larger tympanum (TD/HD 0.21–0.24 vs. 0.14–0.17), bigger rostral (RW 3.4–4.5 vs. 0.8–0.9 mm, RH 1.0–2.0 vs. 0.5–0.8 mm), the presence of postorbital spines, occipital spines, nuchal and dorsal crests (vs. absence or not obvious), a diastema between nuchal crest and dorsal crest (vs. a continuous nuchal and dorsal crest), presence of a black nuchal collar (vs. absence), presence of a black eye patch (vs. absence), and the presence of a gular pouch (vs. absence) (see the original description by Günther 1861 and expanded descriptions by Günther 1864; Boulenger 1885).

Acanthosaura tongbiguanensis sp. nov. can be differentiated from A. crucigera by having more subdigital lamellae on the fourth finger (19–21 vs. 16–18) and the fourth toe (25–28 vs. 21–26), a relatively larger tympanum (TD/HD 0.21–0.24 vs. 0.14–0.21), a higher maximal length of tail (205.0 vs. 174.0 mm), a higher maximal length of occipital spines (7.0 vs. 4.9 mm), a lower number of scales in the diastema between the nuchal and the dorsal crests (6–10 vs. 9–25), a larger mental (MW 1.4–1.9 vs. 1.0–1.5 mm, MH 1.2–2.0 vs. 1.1–1.7 mm). Most obvious is the difference in the color pattern: the black eye patch in Acanthosaura tongbiguanensis sp. nov. extends back and downwards beyond the posterior end of the tympanum, while it only extends to the anterior edge of the tympanum in A. crucigera; additionally, Acanthosaura tongbiguanensis sp. nov. has fewer or no spots on the dorsal surface of the body, whereas A. crucigera has more spots on the dorsal surface of the body.

Acanthosaura tongbiguanensis sp. nov. can be separated from A. lepidogaster based on its higher number of subdigital lamellae on the fourth finger (19–21 vs. 17–19) and the fourth toe (25–28 vs. 22–23), its bigger body size (93.0–115.6 vs. 76.5–101.1 mm), longer postorbital spines (3.6–6.3 vs. 1.5–2.5 mm, PS/HL 0.13–0.19 vs. 0.06–0.11) and longer occipital spines (4.5–7.0 vs. 3.2–3.4 mm, OS/HL 0.16–0.23 vs. 0.14–0.15), longer nuchal crest spines (4.0–6.7 vs. 2.9–3.4 mm, NSL/HL 0.15–0.21 vs. 0.12–0.15) and longer dorsal crest spines (2.4–4.2 vs. 1.5–2.7 mm, DS/HL 0.09–0.13 vs. 0.07–0.12), much higher maximal length of tail (205.0 vs. 144.1 mm), lower number of scales in the diastema between the nuchal and the dorsal crests (6–10 vs. 10–12), much wider rostral (3.3–4.5 vs. 2.8–3.0 mm), and larger gular pouch (1–2 vs. 0–1). The black eye patch in Acanthosaura tongbiguanensis sp. nov. extends backwards and downwards beyond the posterior end of the tympanum but never backwards and upwards to reach the black nuchal collar, while it usually does so in A. lepidogaster; the black nuchal collar extends downwards to reach the black oblique humeral fold, while it rarely reaches the black oblique humeral fold in A. lepidogaster; besides, the tongue and the inside of the mouth are pink in Acanthosaura tongbiguanensis sp. nov., while they are bluish-grey or black in A. lepidogaster; the postorbital spines, occipital spines, nuchal crest spines, the ridge of the rostralis, and orbit are lighter in color in Acanthosaura tongbiguanensis sp. nov., whereas they are darker in color in A. lepidogaster.

Acanthosaura tongbiguanensis sp. nov. can be separated from A. murphyi based on its smaller body size (93.0–115.6 vs. 103.7–127.3 mm) but relatively longer tail (TL/SVL 1.56–1.85 vs. 1.48–1.54), a higher number of subdigital lamellae on the fourth finger (19–21 vs. 15–18) and the fourth toe (25–28 vs. 21–23), shorter forelimb (34.7–43.2 vs. 49.8–56.6 mm) and hindlimb (54.1–63.9 vs. 60.4–68.4 mm), much shorter postorbital spines (3.6–6.3 vs. 5.6–11.8 mm, PS/HL 0.13–0.19 vs. 0.16–0.34), nuchal crest spines (4.0–6.7 vs. 7.0–14.9 mm, NSL/HL 0.15–0.21 vs. 0.24–0.43) and dorsal crest spines (2.4–4.2 vs. 2.6–10.5 mm, DS/HL 0.09–0.13 vs. 0.14–0.51), much lower width of the nuchal crest spines (1.0–1.5 vs. 2.9–4.8 mm), higher number of scales in the diastema between nuchal and dorsal crests (6–10 vs. 4–8), presence of occipital spines (vs. absence), a smaller gular pouch (1–2 vs. 4); the black eye patch in Acanthosaura tongbiguanensis sp. nov. extends backward and downward beyond the posterior end of the tympanum, while it usually extends backwards and upwards to reach the nuchal crests in A. murphyi (see species’ photographs in Nguyen et al. 2018).

Acanthosaura tongbiguanensis sp. nov. can be separated from A. nataliae by its smaller body size (93.0–115.6 vs. 106.7–158.0 mm) and a lower maximal tail length (205.0 vs. 287.0 mm) but a relatively longer tail (TL/SVL 1.56–1.85 vs. 1.2–1.5), much shorter length of postorbital spines (3.6–6.3 vs. 7.7–17.8 mm, PS/HL 0.13–0.19 vs. 0.36), nuchal crest spines (4.0–6.7 vs. 8.5–23.8 mm, NSL/HL 0.15–0.21 vs. 0.58) and dorsal crest spines (2.4–4.2 vs. 6.0–17.7 mm, DS/HL 0.09–0.13 vs. 0.44), a lower width of the nuchal crest spines (1.0–1.5 vs. 3.1–4.8 mm), lower width of mental (1.4–1.9 vs. 2.9 mm), a lower number of ventral scales (52–66 vs. 64–71), lower maximal length of forelimb (43.2 vs. 85.0 mm) and hindlimb (63.9 vs. 129.7 mm), presence of occipital spines (vs. absence), much lesser development of gular pouch (1–2 vs. 4), presence of light knee patch (vs. absence) and presence of a black nuchal collar (vs. absence); the black eye patch in Acanthosaura tongbiguanensis sp. nov. extends backward and downward beyond the posterior end of the tympanum but never continues backward to reach the black oblique folds anterior to the fore limb insertions while it usually does so in A. nataliae (see species’ description and photographs in Orlov et al. 2006).

Acanthosaura tongbiguanensis sp. nov. is distinguishable from A. phongdienensis based on its bigger body size (93.0–115.6 vs. 58.5–77.4 mm), longer tail (144.9–205.0 vs. 94.6–137.2 mm), higher number of subdigital lamellae on the fourth finger (19–21 vs. 14–17) and the fourth toe (25–28 vs. 19–23), longer postorbital spines (3.6–6.3 vs. 1.18–2.07 mm, PS/HL 0.13–0.19 vs. 0.06–0.09), longer nuchal crest spines (4.0–6.7 vs. 1.24–4.18 mm, NSL/HL 0.15–0.21 vs. 0.07–0.18) and longer dorsal crest spines (2.4–4.2 vs. 0.58–1.65 mm, DS/HL 0.09–0.13 vs. 0.03–0.07), a diastema between nuchal crests and dorsal crests (vs. a continuous nuchal and dorsal crest); the black eye patch in Acanthosaura tongbiguanensis sp. nov. extends backwards and downwards beyond the posterior end of the tympanum but never backwards and upwards to reach the black nuchal collar, while it does so in male A. phongdienensis (see species’ description and photographs in Nguyen et al. 2019), the postorbital spines, occipital spines, nuchal crest spines, the ridge of the rostralis and orbit are lighter in color in Acanthosaura tongbiguanensis sp. nov., whereas they are darker in color in A. phongdienensis.

Acanthosaura tongbiguanensis sp. nov. can be differentiated from A. phuketensis by having a higher number of subdigital lamellae on the fourth finger (19–21 vs. 15–17) and the fourth toe (25–28 vs. 21–24), a relatively longer tail (TL/SVL 1.56–1.85 vs. 1.4–1.7), much shorter postorbital spines (3.6–6.3 vs. 4.6–11.8 mm, PS/HL 0.13–0.19 vs. 0.23–0.38), nuchal crest spines (4.0–6.7 vs. 4.1–12.2 mm, NSL/HL 0.15–0.21 vs. 0.21–0.39) and dorsal crest spines (2.4–4.2 vs. 2.3–8.3 mm, DS/HL 0.09–0.13 vs. 0.11–0.26), a lower width of nuchal crest spines (1.0–1.5 vs. 1.4–2.9 mm), a lower maximal length of occipital spines (7.0 vs. 9.5 mm), a lower number of scales in the diastema between the nuchal and the dorsal crests (6–10 vs. 12–17), a bigger mental (MW 1.4–1.9 vs. 0.5–1.4 mm, MH 1.2–2.0 vs. 0.6–1.6 mm); the black eye patch in Acanthosaura tongbiguanensis sp. nov. never extends backward to reach the nuchal crest while it does so in male A. phuketensis (see species’ original description by Pauwels et al. 2015) and Acanthosaura tongbiguanensis sp. nov. has fewer or no spots on the dorsal surface of the body, whereas A. phuketensis has more spots on the dorsal surface of the body.

From Acanthosaura titiwangsaensis, the new species can be distinguished by its relatively larger tympanum (TD/HD 0.21–0.24 vs. 0.17–0.20), its longer tail (144.9–205.0 vs. 136.0–174.0mm, TL/SVL 1.56–1.85 vs. 1.1–1.5), higher maximal length of postorbital spines (6.3 vs. 4.4 mm) and nuchal crest spines (6.7 vs. 4.4 mm), higher length of dorsal crest spines (2.4–4.2 vs. 1.7–2.1 mm, DS/HL 0.09–0.13 vs. 0.07–0.09), much longer occipital spines (4.5–7.0 vs. 1.8–2.3 mm, OS/HL 0.16–0.23 vs. 0.09–0.10), lower number of scales in the diastema between the nuchal and the dorsal crests (6–10 vs. 10–13), presence of a light knee patch (vs. absence), less developed gular pouch (1–2 vs. 2–4), absence of medium-sized light orange spots edged in a faded black color on body and base of tail (vs. presence); the black eye patch in Acanthosaura tongbiguanensis sp. nov. extends backward and downward beyond the posterior end of the tympanum while it is restricted to the orbit and not extends into the postorbital region in A. titiwangsaensis (Wood et al. 2009).

Figure 10. 

Acanthosaura tongbiguanensis sp. nov. A live adult male on the ground B live adult female on a leaf C live adult female asleep on a branch D live juvenile asleep on branches and leaves.

Discussion

Although Acanthosaura collections from Myanmar and other Southeast Asian countries were not available for comparative analyses, we could demonstrate that Acanthosaura tongbiguanensis sp. nov. is a distinct species using data available from literature (Hardwicke and Gray 1827; Cuvier 1829; Günther 1861; Boulenger 1885; Orlovet al. 2006; Manthey 2008; Wood et al. 2009, 2010, Ananjeva et al. 2011; Grismer 2011; Pauwels et al. 2015; Nguyen et al. 2018; Nguyen et al. 2019).

Several morphometric characters of Acanthosaura tongbiguanensis sp. nov. overlap with some characters of other species in this genus, however, the new species can be differentiated from all other species of Acanthosaura by the black eye patch extending from the posterior margin of the nostrils through the orbit backwards and downwards to beyond the posterior end of the tympanum but neither meeting black nuchal collar nor the black oblique humeral fold (see Fig. 7).

The Acanthosaura crucigera group is wide ranging and its morphological variation is conserved, it is not surprising to find cryptic diversity within the A. crucigera complex (Wood et al. 2010). Acanthosaura tongbiguanensis sp. nov. was previously considered to represent A. lepidogaster (Yang et al. 2008) although it more closely resembles A. crucigera, however the numbers of subdigital lamellae on the fourth finger and toe of Acanthosaura tongbiguanensis sp. nov. are significantly different from A. lepidogaster and A. crucigera, and the molecular analyses also revealed them distinct taxa. Together with the species described herein Acanthosaura currently comprises 14 species in total.

Acknowledgements

We would like to thank Decai Ouyang and Lei Ouyang for assistance in the field. Thanks also to our workmates for their help and advice. Thanks to the manager of the collection room of the Institute of Zoology, Chinese Academy of Sciences for helping to find specimens. We also thank the reviewers for their valuable comments on the manuscript. We owe thanks to the curator Weiwei Li for giving us the opportunity to conduct the field investigation; this work was supported by Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences.

References

  • Ananjeva NB, Guo XG, Wang YZ (2011) Taxonomic diversity of agamid lizards (Reptilia, Sauria, Acrodonta, Agamidae) from China: a comparative analysis. Asian Herpetological Research 2(3): 117–128. https://doi.org/10.3724/SP.J.1245.2011.00117
  • Ananjeva NB, Orlov NL, Kalyabina-Hauf SA (2008) Species of Acanthosaura Gray, 1831 (Agamidae: Sauria, Reptilia) of Vietnam: results of Molecular and Morphological study. Biology Bulletin 35(2): 178–186. https://doi.org/10.1134/S106235900802012X
  • Ananjeva NB, Orlov NL (2007) Agamid lizards (Agamidae, Acrodonta, Sauria, Reptilia) of Vietnam. Mitteilungen aus dem Museum für Naturkunde in Berlin, Zoologische Reihe 83(2007): 13–21. https://doi.org/10.1002/mmnz.200600021
  • Ananjeva NB, Orlov NL, Nguyen TT, Ryabov SA (2011b) A new species of Acanthosaura (Agamidae, Sauria) from northwest Vietnam. Russian Journal of Herpetology 18(3): 195–202.
  • Anderson J (1879) Reptilia and amphibia. In: Quarich B (Ed.) Comprising an Account of the Zoological Results of the Two Expeditions to Western Yunnan in 1868 and 1875. Anatomical and Zoological Research (Vol. I). London, 705–860. https://doi.org/10.5962/bhl.title.50434
  • Blyth E (1852) Report of Curator, Zoological Department. Journal of the Asiatic Society of Bengal 21: 341–358.
  • Boulenger GA (1885) Catalogue of the lizards in the British Museum (Natural History). Second edition (Vol. I). Geckonidae, Eublepharidae, Uroplatidae, Pygopodidae, Agamidae. British Museum (Natural History), London, 436 pp.
  • Boulenger GA (1887) An account of the reptiles and batrachians obtained in Tenasserim by M. L. Fea, of the Genova Civic Museum. Annali del Museo Civico di Storia Naturale da Genova 5: 474–486.
  • Chan-ard T, Grossmann W, Gumprecht A, Schulz K-D (1999) Amphibians and reptiles of Peninsular Malaysia and Thailand. An Illustrated Checklist. [Amphibien und reptilien der Halbinsel Malaysia und Thailands. Eineillustrierte Checkliste] Bushmaster Publications, Würselen, Germany, 240 pp.
  • Chen ZN, Zhang L, Shi JS, Tang YZ, Guo YH, Song ZB, Ding L (2019) A New Species of the Genus Trimeresurus from Southwest China (Squamata: Viperidae). Asian Herpetological Research 10(1): 13–23. http://doi.org/10.16373/j.cnki.ahr.180062
  • Cuvier GJLNFD (1829) Le Regne Animal Distribué, d’après son Organisation, pur servir de base à l’Histoire naturelle des Animaux et d’introduction à l’Anatomie Comparé. Nouvelle Edition [2eme ed] (Vol. 2). Les Reptiles. Déterville, Paris, 406 pp.
  • Daudin FM (1802) Histoire Naturelle, Générale et Particulière des Reptiles; ouvrage faisant suit à l’Histoire naturelle générale et particulière, composée par Leclerc de Buffon; et rédigée par CS Sonnini, membre de plusieurs sociétés savantes (Tome 4). F Dufart, Paris. https://doi.org/10.5962/bhl.title.60678
  • Fei L, Ye CY, Huang YZ (1990) Key to Chinese Amphibians. Publishing House for Scientific and Technological Literature, Chongqing, 364 pp.
  • Gray JE (1831) A synopsis of the species of the Class Reptilia. In: Griffithand E, Pidgeon E (Ed.) The Animal Kingdom Arranged in Conformity with its Organization by the Baron Cuvier with Additional Descriptions of all the Species Hitherto Named and of Many not Before Noticed (Vol. 9). The class Reptilia arranged by the Baron Cuvier with specific descriptions. Whittaker, Treacher and Co., London, 483–600.
  • Grismer LL (2011) Lizards of Peninsular Malaysia, Singapore and Their Adjacent Archipelagos. Edition Chimaira, Frankfürt am Main, 728 pp.
  • Grismer LL, Pan KA (2008) Diversity, endemism, and conservation of the amphibians and reptiles of southern Peninsular Malaysia and its offshore islands. Herpetological Review 39(3): 270–281.
  • Günther ACLG (1861) Second list of Siamese reptiles. Proceedings of the Zoological Society of London 1861(10): 187–189.
  • Günther ACLG (1864) The Reptiles of British India. The Ray Society, London, 452 pp.
  • Hallermann J (2000) The taxonomic status of Acanthosaura fruhstorferi Werner, 1904 and Calotes brevipes Werner, 1904 (Squamata, Agamidae). Mitteilungen aus dem Museum für Naturkunde in Berlin, Zoologische Reihe 76(1): 143–150. https://doi.org/10.1002/mmnz.20000760113
  • Hanke M, Wink M (1994) Direct DNA sequencing of PCR-amplified vector inserts following enzymatic degradation of primer and dNTPs. Biotechniques 17(5): 858–860.
  • Hardwicke T, Gray JE (1827) A synopsis of the species of saurian reptiles, collected in India by Major-General Hardwicke. Zoological Journal 3: 214–229.
  • Jerdon TC (1870) Notes on Indian Herpetology. Proceedings of the Asiatic Society of Bengal 1870: 66–85.
  • Kalyabina-Hauf S, Ananjeva NB, Joger U, Lenk P, Murphy RW, Stuart BL, Orlov NL, Ho CT, Wink M (2004) Molecular phylogeny of the genus Acanthosaura (Agamidae). Current Herpetology 23(1): 7–16. https://doi.org/10.5358/hsj.23.7
  • Manthey U (2008) Agamid Lizards of Southern Asia – Agamen des südlichen Asien – Draconinae 1. Terralog (Vol. 7a). Edition Chimaira, Frankfurt am Main, 160 pp.
  • Nguyen LT, Do DT, Hoang HV, Nguyen TT, McCormack TEM, Nguyen TQ, Orlov NL, Nguyen VDH, Nguyen SN (2018) A new species of the genus Acanthosaura Gray, 1831 (Reptilia: Agamidae) from Central Vietnam. Russian Journal of Herpetology 25(4): 259–274.
  • Nguyen SN, Jin JQ, Dinh BV, Nguyen LT, Zhou WW, Che J, Murphy RW (2019) A new species of Acanthosaura Gray 1831 (Reptilia: Agamidae) from Central Vietnam. Zootaxa 4612(4): 555–565. https://doi.org/10.11646/zootaxa.4612.4.7
  • Orlov NL, Nguyen TQ, Nguyen VS (2006) A new Acanthosaura allied to A. capra Günther, 1861 (Agamidae, Sauria) from central Vietnam and southern Laos. Russian Journal of Herpetology 13(1): 61–76.
  • Pauwels OSG, Sumontha M, Kunya K, Nitikul A, Samphanthamit P, Wood PLJr, Grismer LL (2015) Acanthosaura phuketensis (Squamata: Agamidae), a new long-horned tree agamid from southwestern Thailand. Zootaxa 4020(3): 473–494. https://doi.org/10.11646/zootaxa.4020.3.4
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York, 1546 pp.
  • Stuart BL, Sok K, Neang T (2006) A collection of amphibians and reptiles from hilly eastern Cambodia. The Raffles Bulletin of Zoology 54(1): 129–155.
  • Stuart BL, Rowley JJL, Neang T, Emmett DA, Sitha S (2010) Significant new records of amphibians and reptiles from Virachey National Park, northeastern Cambodia. Cambodian Journal of Natural History 2010(1): 38–47.
  • Suwannapoom C, Yuan ZY, Chen JM, Hou M, Zhao HP, Wang LJ, Nguyen TS, Nguyen TQ, Murphy RW, Sullivan J, Mcleod DS, Che J (2016) Taxonomic revision of the Chinese Limnonectes (Anura, Dicroglossidae) with the description of a new species from China and Myanmar. Zootaxa 4093: 181–200. https://doi.org/10.11646/zootaxa.4093.2.2
  • Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28(10): 2731–2739. https://doi.org/10.1093/molbev/msr121
  • Thompson JD, Gibson TJ, Plewniak F, Jeanmougin J, Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25(24): 4876–4882. https://doi.org/10.1093/nar/25.24.4876
  • Wang Y, Cheng KP, Yao Q (2009) An introduction to the operation method of phylogenetic analysis program MrBayes 3.1. Journal of Anhui Agricultural Sciences 37(33): 16665–16669.
  • Werner F (1904) Beschreibung neuer Reptilien aus den Gattungen Acanthosaura, Calotes, Gastropholis und Typhlops. Zoologischer Anzeiger 27: 461–464.
  • Wood Jr PL, Grismer JL, Grismer LL, Norhayati A, Chan K-O, Bauer AM (2009) Two new montane species of Acanthosaura Gray, 1831 (Squamata: Agamidae) from Peninsular Malaysia. Zootaxa 2012: 28–46. https://doi.org/10.11646/zootaxa.2012.1.2
  • Wood Jr PL, Grismer LL, Grismer JL, Neang T, Chav T, Holden J (2010) A new cryptic species of Acanthosaura Gray, 1831 (Squamata: Agamidae) from Thailand and Cambodia. Zootaxa 2488: 22–38. https://doi.org/10.11646/zootaxa.2488.1.2
  • Yang DT, Rao DQ (2008) Amphibia and Reptilia of Yunnan. Yunnan Publishing Group Corporation, Yunnan Science and Technology Press, Kunming, 411 pp.
  • Yang DT, Su CY, Li SM (1978) Amphibians and Reptiles of Gaoligongshan. Compilation of Scientific Research Work 1978: 1–94.
  • Yang JH, Zeng ZC, Wang YY (2018) Description of two new sympatric species of the genus Leptolalax (Anura: Megophryidae) from western Yunnan of China. PeerJ 6: e4586. https://doi.org/10.7717/peerj.4586
  • Zhao EM, Jiang YM, Huang QY, Zhao H, Zhao KT, Zhou KY, Liu YZ, Liu MY, Li DJ, Zhang YX (1999) Fauna Sinica (Reptilia 2): Squamata (Lacertilia). Science Press, Beijing, 394 pp.
login to comment