Petrolisthes virgilius sp. nov. from the Caribbean Sea of Colombia is described. The new species resembles P. tonsorius morphologically but differs from it principally by its color and habitat. Petrolisthes tonsorius is brown or blueish brown and occurs under intertidal boulders strongly exposed to water movement. Petrolisthes virgilius sp. nov. is pale brown to beige and lives exclusively in intertidal areas dominated by vermetid snails, exposed to heavy wave action. The entangled tubular shells of vermetids are cemented to each other and to a hard substrate like beach rock, forming a microhabitat for the new crab species and other porcellanids of the genera Neopisosoma and Clastotoechus. Large genetic distances between DNA sequences of the mitochondrial 16S rDNA gene from P. virgilius sp. nov. and P. tonsorius confirmed that they comprise different species. Petrolisthes virgilius sp. nov. is the 53^rd member of the West Atlantic porcellanid fauna.

West Atlantic, Petrolisthes virgilius sp. nov., Petrolisthes tonsorius, ecological differences, color morphs, vermetid formations, mitochondrial marker

The porcellanid fauna of the western Atlantic has been studied intensively in the last 60 years. With the last additions by Ferreira and Tavares (2017, 2019) and Werding and Hiller (2017), consisting of three new species of Pachycheles Stimpson, the number of western Atlantic species rose to 52. Werding (1978) found individuals of Petrolisthes inhabiting vermetid formations in the Colombian Gulf of Urabá, and assigned them to P. tonsorius Haig, 1960, but warned that coloration and habitat of the crab specimens were atypical. Petrolisthes tonsorius inhabits the rocky intertidal of both the Caribbean and the tropical East Pacific and exhibits a brown to dark-brown color (Fig. 1a), sometimes blueish (Fig. 1b). The individuals found inhabiting vermetid formations were pale brown to beige (Fig. 2). Morphological re-examination of this color morph, and genetic distances estimated between DNA sequences of the 16S rDNA gene from this new form and P. tonsorius confirmed that they comprise different species. Here we describe the new form as Petrolisthes virgilius sp. nov.

Figure 1. 

Petrolisthes tonsorius, Venezuela, Isla Cubagua. a Brownish color morph b Blueish color morph. Scale bars: 3.7 mm (a); 3.2 mm (b).

Figure 2. 

Petrolisthes virgilius sp. nov., Colombia, Santa Marta. Scale bar: 2.4 mm.

Material of Petrolisthes virgilius sp. nov. collected in the Colombian regions of Santa Marta and the Gulf of Urabá was used for morphological examination and molecular analyses. Type material was deposited in the collection of the Museo de Historia Natural Marina de Colombia (INV CRU), INVEMAR (Institute of Marine and Coastal Research of Colombia, Santa Marta). Specimens were sexed and measured by using a stereoscope with a micrometer. Measurements are given in mm and correspond to carapace length, followed by carapace width.

DNA was extracted from the chelipeds or walking legs of seven specimens of the new species (3 from Santa Marta and 4 from the Gulf of Urabá) using the DNeasy Blood & Tissue Kit (Qiagen), following the manufacturer´s protocol for animal tissues. A 540 bp fragment of the ribosomal 16S rDNA was amplified using primers 16Sar (CGCCTGTTTATCAAAAACAT) and 16Sbr (CCGGTCTGAACTCAGATCACGT) (Palumbi 1996), and trimmed to 496 bp. Double-stranded amplifications were performed in 12 ml volume reactions containing 2.5 µl of Taq buffer (5×), 1.7 µl of dNTP mix (8 mM), 0.6 µl of each primer (10µM), 1.2 µl of MgCl₂ (25mM), 0.2 µl of GoTaq Flexi DNA Taq Polymerase (Promega), 1 µl of DNA template, and 4.8 µl of ddH₂0. Thermal cycling conditions consisted of an initial denaturation step at 96 °C for 3 min, followed by 30 cycles of 95 °C for 1 min, 50 °C for 1 min, and 72 °C for 1 min. An extension step at 72 °C for 5 min followed the last cycle. PCR products were cleaned using the ExoSap-IT kit (USB Corporation) following the manufacturer´s protocol. Clean PCR products were cycle-sequenced in both directions using the BigDye Terminator v. 3.1 Cycle Sequencing Kit, and electrophoresed in an Applied Biosystems 3130 Genetic Analyzer.

The 16S rDNA sequences of P. virgilius sp. nov. were compared to two sequences of P. tonsorius from the Venezuelan Caribbean and the Colombian Pacific, published by Hiller et al. (2006) (GenBank accession numbers DQ444960 and DQ444959). The BioEdit Sequence Alignment Editor (Hall 1999) was used to trim primer regions from DNA sequences. MAFFT v. 7 (Katoh and Standley 2013) was used to align the sequences of P. virgilius sp. nov. and P. tonsorius. Genetic distances within and between these species were estimated using Kimura’s two-parameter model (K2P; Kimura 1980) implemented in MEGA v. 7.0 (Kumar et al. 2016). GenBank accession numbers of the 16S rDNA sequences of P. virgilius sp. nov. are MN275526-MN275532.

The new species belongs to one of the morphological lines in the diverse and world-wide distributed genus Petrolisthes. This morphological line is strictly American and includes species lacking spines and dentations in carapace and extremities. In the West Atlantic this group is represented by two trans-isthmian species, P. tridentatus Stimpson, 1859, and P. tonsorius Haig, 1960, and by P. quadratus Benedict, 1901, P. gertrudae Werding, 1996, P. hispaniolensis Werding & Hiller, 2005, and now P. virgilius. Besides the two trans-isthmian species, the East Pacific members of this group are numerous, and are morphologically represented by the tropical P. galapagensis Haig, 1960, and a number of subtropical, warm-temperate and temperate species (see Haig 1960). Despite the close resemblance between P. virgilius and P. tonsorius, which led Werding (1978) to cautiously consider them conspecific, the large 16S genetic distance and distinguishing color and habitat confirms that they are different species. The genetic distance is double to that between individuals of P. tonsorius from each side of the Isthmus of Panama and surpasses by far the distance of 1.5% found by Hiller et al. (2006) for the trans-isthmian P. armatus Gibbes, 1850. The high molecular divergence between P. virgilius and P. tonsorius seems to be accompanied by species-specific coloration. However, intraspecific variation in color in P. tonsorius from each side of the Isthmus of Panama overlaps and therefore, in this case, color does not distinguish populations from each ocean. The crabs from both the East Pacific and West Atlantic display carapace and extremities that vary from brown to blueish. Haig (1960) described P. tonsorius from preserved specimens collected in the Galápagos Islands and surmised that they were blueish-colored in life. She wrote (p. 87): “After more than twenty years in alcohol, a few specimens show a dark blue-violet on the metabranchial regions of the carapace, ringed by a darker line of the same color; this shade of blue is also present on the eyestalks, movable segments of the antennae, walking legs, telson of the abdomen, and palps of the maxillipeds”. Color and color pattern have been taxonomically reliable characters for distinguishing cryptic species of porcellanids (Hiller et al. 2006; Hiller and Werding 2007) and other anomurans like hermit crabs (Malay et al. 2012; Negri et al. 2014) and squat lobsters (Macpherson and Machordom 2001; Cabezas et al. 2011). However, in some species complexes in Anomura color may not vary interspecifically (Werding and Hiller 2017) or it can vary intraspecifically (Rodríguez-Flores et al. 2018).

Petrolisthes virgilius is ecologically unique compared to its morphological allies, typically occurring under intertidal boulders moderately to highly exposed to water movement. The only other species in association with living organisms is P. gertrudae, occasionally found on Zoanthus sociatus (Ellis, 1768) (see Werding 1996). The vermetid conglomerates where P. virgilius was found in Santa Marta and the Gulf of Urabá are cemented to a beachrock platform exposed to strong waves, which provide the vermetids and associated fauna with oxygen and nutrients. This singular vermetid habitat provides shelter to other porcellanid species of genera Neopisosoma Haig, 1960, and Clastotoechus Haig, 1960. The new species seems to have evolved in tight association to intertidal vermetid formations exposed to extremely strong water movement.

Including the new species, the genus Petrolisthes now comprises 111 species and the family Porcellanidae 305 species.

We thank the following colleagues for their contributions to this manuscript: H.A. Lessios for commenting on the manuscript, and L. Geyer, L. Rivera, and A. Calderón (STRI) for support in the laboratory; J. Lazarus (Universidad del Valle, Cali) for collecting part of the crab material; E. Macpherson (Centro de Estudios Avanzados de Blanes - CEAB), E. Campos (Universidad Autónoma de Baja California) and I. Wehrtmann (Universidad de Costa Rica) for improving an earlier version of this manuscript; C. Arteaga, E. Montoya, and M. Martelo (INVEMAR) for logistic help. This study was supported by a Smithsonian Postdoctoral Fellowship to A.H.