Research Article
Print
Research Article
A new species of the genus Euxaldar Fennah, 1978 (Hemiptera, Fulgoromorpha, Issidae) from China and revision on the molecular phylogeny of the family
expand article infoLiang-Jing Yang‡§, Zhi-Min Chang§, Lin Yang§, Xiang-Sheng Chen§
‡ Liupanshui Normal College, Liupanshui, China
§ Guizhou University, Guiyang, China

Corresponding author: Xiang-Sheng Chen ( chenxs3218@163.com )

Academic editor: Mike Wilson
© 2021 Liang-Jing Yang, Zhi-Min Chang, Lin Yang, Xiang-Sheng Chen.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Yang L-J, Chang Z-M, Yang L, Chen X-S (2021) A new species of the genus Euxaldar Fennah, 1978 (Hemiptera, Fulgoromorpha, Issidae) from China and revision on the molecular phylogeny of the family. ZooKeys 1021: 19-35. https://doi.org/10.3897/zookeys.1021.35510
ZooBank: urn:lsid:zoobank.org:pub:DE22C878-1AE5-4798-84B5-8FCB4A37A73B
Open Access

Abstract

A new species Euxaldar daweishanensis Yang, Chang & Chen, sp. nov. is described and illustrated from southwestern China. The female genitalia of the genus Euxaldar is described and presented for the first time. A checklist and key to the known species of the genus are provided. A revised molecular phylogenetic analysis of the family Issidae based on combined partial sequences of 18S, 28S, COI, and Cytb is provided using both Maximum likelihood and Bayesian inference analyses.

Keywords

Checklist, DNA sequence, Hemisphaeriini, identification key, morphology, planthopper, taxonomy

Introduction

The planthopper genus Euxaldar Fennah, 1978 is a small group in the Issidae tribe Hemisphaeriini Melichar, 1906, established for a single species E. jehucal Fennah, 1978, recorded from Ninh Binh, Ha Noi, Vinh Phuc, Hoa Binh, and Haiphong Province in northern Vietnam (Fennah 1978; Gnezdilov and Constant 2012). Recently Gnezdilov et al. (2017a) reviewed the genus and described E. lenis Gnezdilov, Bourgoin & Wang, 2017 from Lam Dong Province (Da Lat) of southern Vietnam. Later, Zhang et al. (2018) recorded the genus for the first time from southeastern China and described E. guangxiensis Zhang, Chang & Chen, 2018 from Guangxi Province. Previously, Gnezdilov placed Euxaldar into the tribe Issini Spinola, 1839 (Gnezdilov 2013). However, Wang et al. (2016) moved it to Hemisphaeriini Mongolianina. Recently, this genus was placed in subgroups of Mongolianina: Mongoliana + (Euxaldar + Macrodaruma) by Zhao et al. (2019), but as shown in this study it is better placed in the subgroup (Retaldar + (Clypeosmilus + Eusudasina)) because all genera in this subgroup have the same characteristic protruded clypeus.

Below, we describe and illustrate a new species of Euxaldar from Yunnan Province in China, provide a checklist and key to Euxaldar species, and describe and photograph the female genitalia of the new species. The partial DNA sequences (16S, 28S (d6-d7), COI, Cytb) of the new species are briefly analyzed. A revised molecular phylogeny is analyzed by Bayesian and Maximum likelihood based on seven sequences of four genes (18S, 28S, COI and Cytb), providing molecular evidence of phylogenetic relationships within the Issidae and enabling a revaluation of the current classification of the family Issidae by Wang et al. (2016), Zhao et al. (2019) and Gnezdilov et al. (2020).

Materials and methods

The morphological terminology used for body appearance follows Chan and Yang (1994) and Anufriev and Emeljanov (1988). Forewing venation pattern follows Bourgoin et al. (2015). The terminologies of male and female genitalia follow Bourgoin (1987, 1993) and Chang et al. (2015). Body length (included forewings) is given in millimeters (mm).

The genital segments of the specimens were macerated in a boiling solution of 10% NaOH for about 5 minutes, washed in distilled water, then immersed in glycerine for observation, dissection, drawing, and photography. They were stored in a micro vial in glycerol for further examination. A Leica MZ 12.5 stereomicroscope was used for illustrations. A KEYENCE VHX-1000C was used to acquire photographs. All specimens studied are deposited in the Institute of Entomology, Guizhou University, Guiyang, China (GUGC).

The molecular phylogenetic study included 71 species belonging to 48 genera as ingroups from Issidae (Wang et al. 2016; Zhao et al. 2019; Gnezdilov et al. 2020) and five species as outgroups from the families Cixidae, Caliscelidae, Delphacidae, Dictyopharidae, Tropiduchidae. Data for the 71 included species were downloaded from NCBI. Five ingroup species including the new species were newly sequenced, for which total DNA was extracted using the Animal Tissue Genomic DNA Kit (Tiangen Biotech Company, Beijing, China). Primers and PCR procedures are listed in Tables 1, 2 and carried out in 30 μl volume reaction. Accession numbers for species used in the phylogenetic analysis are shown in Table 4.

The DNA sequencing was performed at Sangon Company (Shanghai, China). Sequence chromatograms were checked and assembled by Seqman from the package DNAstar v5.01 (www.dnastar.com), calculated by MEGA 6.06 and Notepad 7.6.2. The Maximum likelihood (ML) phylogenetic analysis was performed by IQtree v1.6.7 and visualized by Figtree v1.1.2. A Bayesian estimation search (BI) was performed using MrBayes (Ronquist et al. 2011) on the CIPRES Science Gateway V3.1 Portal (https://www.phylo.org/portal2/home.action). Best partitions and models were chosen by PartitionFinder 2 (Lanfear et al. 2017), running conditions as described in Appendix 1.

Table 1.
Download as
CSV
XLSX

Primers used for amplification and sequencing.

Gene Primer Sequence (5’–3’)
COI COI (LCO18)-PF GGTCAACAAATCATAAAGATATTG
COI (HCO29)-PR TAAACTTCAGGGTGACCAAAAAAT
16S (Clary and Wolstenholme 1985) 16S-PF GCCTGTTTATCAAAAACAT
16S-PR CCGGTCTGAACTCAGATCA
Cytb (Bourgoin et al. 1997) Cytb-PF TATGTACTACCATGAGGACAAATATC
Cytb-PR ATCTTAATGCAATAACTCCTCC
28S d6–d7 (Cryan et al. 2000) 28S EE CCGCTAAGGAGTGTGTAA
28S MM GAAGTTAGGGATCTARTTTG
28S d3–d5 (Belshaw and Quicke 2002) 28S Ai GACCCGTCTTGAAACACG
28S D4D5r GTTACACACTCCTTAGCGGA
Table 2.
Download as
CSV
XLSX

PCR procedures.

Gene COI 16S Cytb 28S d3-d5 28S d6-d7
Initial denaturation 94 °C 5 min 95 °C 7 min 94 °C 5 min 94 °C 3 min 94 °C 3 min
95 °C 7 min 94 °C 30 sec 95 °C 50 sec 94 °C 1 min 94 °C 1 min 94 °C 1 min
Annealing 55 °C 1 min 50 °C 1 min 47 °C 1 min 54 °C 1 min 55 °C 1 min
Extension 72 °C 1 min 72 °C 1 min 72 °C 1 min 72 °C 1 min 72 °C 1 min
Cycles 35 Cycles 35 Cycles 35 Cycles 35 Cycles 40 Cycles
Annealing 72 °C 10 min 72 °C 10 min 72 °C 10 min 72 °C 10 min 72 °C 10 min

Taxonomy

Euxaldar Fennah, 1978

Euxaldar Fennah, 1978: 267.

Type species

Euxaldar jehucal Fennah, 1978, by monotypy.

Diagnosis

Coryphe transverse, 2–3 times as wide as long. Metope flat and elongate, disc smooth or densely covered by pustules. Anteclypeus with distinct median carinae. Forewings with costal margin basally angled and convex below eyes, claval suture developed, venation hazily reticulate, CuP distinct. Hind tibia with 2 lateral spines. Spinal formula of hind leg (7–9)–(6–8)–2. Pygofer with posterior margin distinctly convex. Male anal tube apically enlarged or elongated in dorsal view. Periandrium asymmetrical.

Distribution

China, Vietnam.

Checklist of Euxaldar species

E. daweishanensis sp. nov. (Southwestern China: Yunnan Province)

E. guangxiensis Zhang, Chang & Chen, 2018 (Southeastern China: Guangxi Province)

E. jehucal Fennah, 1978 (Northern Vietnam: Ninh Binh, Ha Noi, Vinh Phuc, Hoa Binh, and Haiphong Provinces)

E. lenis Gnezdilov, Bourgoin & Wang, 2017 (Southern Vietnam: Lam Dong Province)

Key to male species of Euxaldar

Modified from Gnezdilov et al. (2017a) and Zhang et al. (2018).

1 Metope smooth. Forewings without coloured bands or spots (Gnezdilov et al. 2017a: fig. 23) E. lenis
– Metope with a row of distinct pustules along lateral margins. Forewings with coloured bands or spots (Figs 9, 11; Zhang et al. 2018: fig. 5; Gnezdilov et al. 2017a: figs 20, 33) 2
2 Metope without median carinae. Metopoclypeal suture incomplete medially. Hind wings rudimentary, shorter than half length of forewings (Zhang et al. 2018: fig. 5) E. guangxiensis
– Metope with weak median carinae running from upper margin to middle. Metopoclypeal suture complete, straightly, or weakly concave. Hind wings developed, longer than half length of forewings (Gnezdilov et al. 2017a: figs 20, 33) 3
3 Coryphe about 3 times as wide as long in the middle. Male anal tube enlarging from base to apical margin and deeply concave at posteromedial part in dorsal view (Gnezdilov et al. 2017a: fig. 6) E. jehucal
– Coryphe about 4 times as wide as long in middle. Male anal tube elongated in dorsal view, enlarging from base to apical fourth and narrowing at apical part, lateral margins with a triangular process in the upper half on each side (Figs 8, 13) E. daweishanensis sp. nov.

Euxaldar daweishanensis sp. nov.

http://zoobank.org/663A901A-6FF8-4BC9-A6B9-C9D1244AAB5B
Figs 1–7, 8–17, 19–26

Type material

Holotype : ♂, China: Yunnan Province, Pingbian County, Mt: Daweishan National Nature Reserve (23°07'N, 103°20'E), 8 August, 2017, Qiang Luo, Nian Gong, Y.-J Sui, Yan Zhi. Paratypes: 7♂♂ 36♀♀, same data as holotype.

Measurements

Total length (from apex of coryphe to tip of forewing): male 4.1–4.3 mm (N = 6), female 4.6–4.9 mm (N = 10); forewing length: male 3.8–4.0 mm (N = 7), female 4.2–4.4 mm (N= 10).

Diagnosis

This species differs from other Euxaldar species by the following characters: (1) coryphe about 2.3 times wider than long (less, or more than 2.3 times as wide as long in other species of Euxaldar); (2) first metatibiotarsal of hind leg with 8 intermediate spines (other species of Euxaldar with first metatarsomere of hind leg with 6 or 7 intermediate spines); (2) penis with 3 different ribbon-shaped processes at middle (Figs 16, 17, pp, paed), dorsal lobe of periandrium with 2 asymmetrical sword-shaped subapical processes in apical half (Figs 16, 17, sap) (other species without sword-shaped subapical processes in apical half of dorsal lobe of periandrium).

Figures 1–7. 

Euxaldar daweishanensis sp. nov. (adult) 1 male dorsal view 2 male lateral view 3 female dorsal view 4 female lateral view 5 male genitalia, lateral view 6 penis, left lateral view 7 penis, right lateral view. Scale bars: 0.5 mm.

Coloration

Male body brown yellowish, with irregular dark brown bands on forewings. Coryphe brown (Fig. 8). Metope with all margins, pustules, and median carinae pale yellow, disc dark brown (Fig. 9). Metopoclypeal suture light yellow. Anteclypeus straw yellow. Postclypeus pale yellow (Figs 9, 10). Rostrum and antenna straw yellow (Fig. 10). Eyes dark brown (Figs 8–10). Pronotum straw yellow. Mesonotum dark brown (Fig. 8). Forewings slightly hyaline, with 2 irregular brown bands (Figs 1, 2, 11): a large one derived from costal margin to almost C2 of radial cell, small one derived from apical half of median cell, extended to areola postica (anterior cubital area). Legs (Figs 2, 4) light brown. Abdomen brown, male genital segment light straw yellow. Females generally darker than males (Figs 3, 4).

Figures 8–18. 

Euxaldar daweishanensis sp. nov. (male adult) 8 head and thorax, dorsal view 9 face, front view 10 head and thorax, lateral view 11 forewings 12 hind wing 13 anal tube, dorsal view 14 pygofer, anal tube and genital style, lateral view 15 capitulum of gonostyli, dorsal view 16 penis, lateral view (left) 17 penis, lateral view (right) 18 penis, ventro-apical view. Abbreviations: aed–aedeagus; bp–basal process of the periandrium; dllp–dorso-lateral lobe of periandrium; paed–process of aedeagus; pp–process of periandrium; sap–subapical processes of periandrium; vlp–venteral lobe of periandrium. Scale bars: 0.5 mm

Head and thorax

Coryphe transverse, about 2.3 times wider than long, anterior margin weakly prominent in the middle, posterior margin angularly concave (Fig. 8). Metope flat, median carinae weak, running from upper margin and reaching middle, with a row of distinct pustules along lateral margins, disc with weak pustules (Fig. 9). Metopoclypeal suture complete (Fig. 9). Anteclypeus with distinct median carinae (Figs 9, 10). Pronotum with disc depressed (Fig. 8). Mesonotum about 2.1 times longer than pronotum. Forewings (Figs 1–4, 11) with distinct claval suture and CuP venation, the other venation reticulate, poorly recognizable. Hind wings about 0.7 times as long as forewings, venation reticulate (Fig. 12). Hind tibiae with 2 lateral teeth. Metatibiotarsal formula (9–8)–8–2.

Male genitalia

Anal tube (Fig. 13) enlarging from base to apical fourth in dorsal view, narrowing to apex, apical margin convex in the middle, laterally with 2 small triangular processes in apical fourth. Pygofer with hind margin distinctly convex (Figs 5, 14). Gonostyli triangular, hind margin convex, caudo-dorsal angle rounded (Fig. 14). Capitulum of gonostyli style with wide and short neck, with a wide lateral tooth and 2 apical teeth (Figs 14, 15). Corpus of connective rod-like (Figs 5–7, 16, 17), curved, cuticularized, reaching middle of periandrium; tectiductus of connective cup-shaped, third ventral part separated from corpus (Fig. 14). Periandrium asymmetrical (Figs 6, 7, 16, 17), suspensorium V-shaped in dorsal view, membranaceous in the middle; base with process claval (Figs 16, 17, bp), dorsal periandrium lobe with 2 ribbon-like processes in center near right edge (Figs 16, 17, pp), directed dorsad, respectively curved caudad and cephalad; dorsal lobe in left lateral view with 2 subapical processes near apex (Fig. 16, sap): one crescent-shaped, above base with another process shortly sword-shaped, directed caudad; in right lateral view (Fig. 17, sap) with two subapical processes derived from apical third, directed apically, one process base movable, sword-shaped, below base another process crutch-like and sclerotized. Ventral periandrium lobe (Fig. 18, vlp) with apical margin convex, shorter than dorso-lateral lobe of periandrium (Figs 16, 17, dllp, 18) in ventral view. Aedeagus (Figs 16, 17, aed) with dagger-shaped process, base slightly movable, directed dorsad, slightly inclined caudad (Figs 16, 17, paed).

Figures 19–26. 

Euxaldar daweishanensis sp. nov. (female adult) 19 female anal tube, dorsal view 20 sternite VII, ventral view 21, 22 gonocoxa VIII and gonapophysis VIII, ventral view 23 gonapophysis IX and gonaspiculum bridge, dorsal view 24 gonapophysis IX and gonaspiculum bridge, lateral view 25 gonoplacs, lateral view 26 gonoplacs, dorsal view Abbreviations: lf–lateral field of posterior connective lamina of gonapophyses IX; mdp–medial dorsal process; mf–medial field of posterior connective lamina of gonapophyses IX; pvd–posterior ventral lobes; slf–sublateral field of posterior connective lamina of gonapophyses IX. Scale bars: 0.5 mm.

Female genitalia

Anal tube ovate in dorsal view, about 1.3 times longer than maximal width at second part (Fig. 19). Anal style long, located at basal fifth of anal tube. In ventral view, Sternite VII with hind margin convex medially, without any process in ventral view, disc arched ventrad (Fig. 20). Anterior connective lamina of gonapophysis VIII nearly rectangular, with 3 or 4 apical teeth on inner lateral margin and 3 lateral teeth bearing 3 keels on outer lateral margin (Figs 21, 22); endogonocoxal lobe developed, membranous in distal part (Figs 21, 22). Posterior connective lamina of gonapophyses IX triangular in dorsal view (Fig. 23), narrowing; median field with leaf-like process bearing apical margin, deeply incised in the middle (Fig. 23, mdp); lateral field (Fig. 23, lf) without obvious process; distal parts of laminae (Fig. 23, slf) with tooth-like process on each lateral margin; posterior ventral lobes bent at slender angle (Figs 23, pvb, 24). Gonoplacs in lateral view irregularly elliptical (Fig. 25), without carinae, with apical half fused, apical margin membranous (Fig. 26).

Etymology

This new species is named after the type locality, Mt. Daweishan National Nature Reserve, Yunnan Province, China.

Distribution

China (Yunnan Province)

Remark

This new species resembles Euxaldar jehucal but differs from the latter by the following combined features: Anal tube with apical margin convex in the middle, lateral margin with a small triangular process in each side (anal tube wide, apical margin deeply concave medially in E. jehucal); periandrium with two asymmetrical subapical processes sword-shaped in apical half (periandrium with subapical processes not as sword-shaped in E. jehucal); aedeagus with one medial dagger-like process on lateral margins (aedeagus without any processes on lateral margins in E. jehucal).

Phylogenetical analysis

Four gene fragments of Euxaldar daweishanensis sp. nov. were sequenced and registered in GenBank with the accession numbers as follows: MK441660 (COI), MK426664 (16S), MK441661 (Cytb), MK441662 (28S d6-d7). Nucleotide compositions are listed in Table 3. A+T content of 16S is the highest (76.0%) and 28S (d6-d7) is the lowest (39.2%).

This study deals with more molecular markers from Oriental and Western Palaearctic, Nearctic and Neotropical regions than previous reviews by Wang et al. (2016) and Gnezdilov et al. (2020). BI (Fig. 27) and ML (Fig. 28) topologies were mostly congruent, and the monophyly of Issidae was reconfirmed. The Issidae had lower support in the ML tree (BS: 47) than Gnezdilov et al. (2020) and Wang et al. et al. (2016) and higher support in the BL analysis (PP: 88). Subfamilies Hysteropterinae Melichar, 1906 sensu (Gnezdilov et al. 2020) and Issinae Spinola, 1839 sensu (Gnezdilov et al. 2020) are both recovered (nodes 1 and 2: ML: 47, 67; BI: 88, 89, respectively).

Table 3.
Download as
CSV
XLSX

Nucleotide gene composition of Euxaldar daweishanensis Yang, Chang & Chen, sp. nov.

Gene A% T% G% C% A+T%
COI 33.2 36.3 17.8 12.7 69.5
16S 27.4 48.6 14.9 9.1 76.0
Cytb 35.3 34.5 11.6 18.6 69.8
28S d6-d7 20.4 18.9 33.7 27.0 39.2

Node 1 includes almost all tribal level genera group of the subfamily Hysteropterinae sensu Gnezdilov (2016a, b, 2020) and the tribe Thioniini Melichar, 1906 sensu (Gnezdilov 2018): 1) Node 4 (ML: 75, BI: 100) corresponds to the subtribe Thioniina sensu Gnezdilov (2018) with the inclusion of American taxa, characterized by hind wings reduced or rudimentary, A2 vein branched; 2) Nodes 5 and 6 corresponds to the monophyletic Kervillea, and Mycterodus genera group sensu Gnezdilov (2016 a, b); monophyly of the Hysteropterum genera group was not supported by this analysis (node 3).

Node 2 (ML: 67, BI: 89) includes five monophyletic tribes (nodes 7–11): Issini, Kodaianellini and Hemisphaeriini sensu (Gnezdilov 2020), Parahiraciini, and Sarimini sensu (Wang et al. 2016), while the monophyly of Sarimini and Parahiraciini was not supported by Gnezdilov (2020).

Figure 27. 

Maximum likelihood (ML) tree estimated from the combined based on combined sequences (18S, 28S, COI, Cytb). At each node, values indicate bootstrap supports.

Figure 28. 

Bayesian 50% consensus tree based on combined dataset. Nodes of the major clades are numbered and refer to text. Each node is documented with its posterior probability (PP) value.

Table 4.
Download as
CSV
XLSX

Species used in the phylogeny analysis with accession number. “*” denotes new added sequences in this study.

Species COI Cytb Gene 18S (A2–9R) Gene 28S (D3–D5) Gene 28S (D6–D7) Collection
Agalmatium flavescens (Olivier, 1791) MN194180 MN191521 MN165781 MN266987 MN266956 Russia
Anatolodus musivus Dlabola, 1982 MN194181 – MN165782 MN266988 MN266957 Turkey
Balduza una (Ball, 1910) – MN191522 MN165783 MN266989 MN266958 Mexico
Bootheca taurus (Oshanin, 1870) MN194182 MN191523 MN165784 MN266990 MN266959 Bulgaria
Bubastia josifovi Dlabola, 1980 – MN191524 MN165785 MN266991 MN266960 Bulgaria
Bubastia sp. – MN191525 MN165786 MN266992 MN266961 Greece
Caloscelis wallengreni Stål, 1863 KX702956 KX702901 KX702855 KX761436 KX702877 China
Celyphoma quadrupla Meng & Wang, 2012 KX702919 KX702906 KX761576 KX761444 KX702806 China
Ceratogergithus pseudotessellatus (Che, Zhang & Wang, 2007) KX761502 KX761513 KX761491 KX761532 KX761521 China
Ceratogergithus spinosus (Che, Zhang & Wang, 2007) KX761502 KX761513 KX761491 KX761532 KX761521 China
Choutagus longicephalus Zhang, Wang & Che, 2006 KX761460 – KX650620 KX761450 KX702810 China
Cixius sp. KR343731 KX702891 JQ982514 KX761413 France
Clypeosmilus centrodasus Gnezdilov & Soulier-Perkins, 2017 KX761470 KX761474 KX761575 – – Vietnam
Conosimus coelatus Mulsant & Rey, 1855 MN194183 MN191526 MN165787 MN266993 MN266962 France
Dicranotropis hamata (Boheman, 1847) KX76146 – KX702837 KX761409 – Austria
Dictyophara europaea (Linnaeus, 1767) KJ911190 KX702896 KX702851 KX761427 – Russia
Euroxenus vayssieresi (Bonfils, Attie & Reynaud, 2001) – – MN165789
MN266995 		MN266964 China, Reunion
Eusudasina nantouensis Yang, 1994 HM052838 HM452266 – – – China
Euxaldar daweishanensis sp. nov.* MK441660 MK441661 – – MK441662 China
Euxaldar lenis Gnezdilov, Bourgoin & Wang, 2017 – – KX761565 KX761412 – Vietnam
Falcidius limbatus (A. Costa, 1864) MN194185 – MN165790 MN266996 MN266965 Italy
Flavina hainana (Wang & Wang, 1999) – KX702912 KX702824 KX761453 MN381846 China
Fortunia sp. KX761498 KX761509 KX761487 KX761518 China
Gergithoides carinatifrons Schumacher, 1915 KX761555 KX702905 KX761538 – KX702805 China
Gergithoides caudospinosus Chen, Zhang & Chang, 2014* MN171521 MW233581 – MW228374 China
Gergithoides rugulosus (Melichar, 1906) HM052835 HM452279 – – – China
Gergithus frontilongus Meng, Webb & Wang, 2017* MN171522 MW233582 – MW228375 China
Gergithus parallelus Che, Zhang & Wang, 2007* MN171523 MW233583 – MW228376 China
Gergithus yunnanensis Che, Zhang & Wang, 2007 KX702924 KX702915 KX702831 KX761456 MN381848 China
Gnezdilovius sp.* MN171524 – – – MW228377 China
Hemisphaerius coccinelloides (Burmeister, 1834) KX702934 KX702884 KX702834 KX761405 KX702861 Philippines
Hemisphaerius lysanias Fennah, 1978 KX702933 KX702883 KX702833 KX761404 KX702860 Vietnam
Hemisphaerius palaemon Fennah, 1978 KX761497 KX761508 KX761486 KX761526 KX761517 China
Hemisphaerius rufovarius Walker, 1858 KX702923 KX702913 KX702825 KX761454 KX702812 China
Hemisphaerius sp. KX761556 KX702885 KX702835 KX761406 KX702862 Laos
Hemisphaerius testaceus Distant, 1906 HM052831 HM452258 – – – China
Hysteropterum dolichotum Gnezdilov & Mazzoni, 2004 – – MN165791 MN266997 MN266966 France
Issus coleoptratus (Fabricius, 1781) KX702932 KX761550 KX761568 KX761403 KX761560 France
Issus lauri Ahrens, 1814 – MN191528 MN165793 MN266999 MN266968 Italy
Kervillea conspurcata (Spinola, 1839) MN194187 MN191529 MN165794 MN267000 MN266969 Slovenia
Kodaianella bicinctifrons Fennah, 1956 KX761458 KX702902 KX702814 KX761441 KX702802 China
Kodaianellissus intorqueus Wang, Bourgoin & Zhang, 2017 – KX761472 KX761476 KX761480 KX761482 China
Latematium latifrons (Fieber, 1877) MN194188 MN191530 MN165795 MN267001 MN266970 Bulgaria
Latilica antalyica (Dlabola, 1986) – MN191531 MN165796 MN267002 MN266971 Greece
Latissus dilatatus (Fourcroy, 1785) – MN191532 MN165797 MN267003 MN266972 Greece
Macrodaruma pertinax Fennah, 1978 KX702931 KX702882 KX702832 KX761402 KX702859 Vietnam
Macrodaruma sp. KX702927 KX702881 KX702828 KX761399 KX702857 China
Maculergithus multipunctatus (Che, Zhang & Wang, 2007) KX702918 KX702904 KX702816 KX761443 KX702804 China
Maculergithus nonomaculatus (Meng & Wang, 2012) KX761503 KX761514 KX761492 KX761533 KX761522 China
Mongoliana serrata Che, Wang & Chou, 2003 HM052830 HM452272 – – – China
Mongoliana sinuata Che, Wang & Chou, 2003 KX761459 KX702908 KX702820 KX761448 – China
Mongoliana sp. 2 – – KX761566 KX761534 MN381849 China
Mongoliana sp.1 – MN332233 MN422135 MN381854 – Thailand
Mongoliana triangularis Che, Wang & Chou, 2003 – KX761510 KX761561 KX761528 – China
Mulsantereum maculifrons (Mulsant & Rey, 1855) KX702928 KX761551 KX761569 KX761400 MN381847 France
Mycterodus drosopoulosi Dlabola, 1982 MN194189 MN191533 MN165798 MN267004 MN266973 Greece
Mycterodus goricus (Dlabola, 1958) MN194190 MN191534 MN165799 MN267005 MN266974 Greece
Neodurium hamatum Wang & Wang, 2011 KX702920 – KX702818 KX761446 MN381844 China
Neogergithoides tubercularis Sun, Meng & Wang, 2012 KX761558 KX702910 KX702822 KX761451 MN381845 China
Ophthalmosphaerius trilobulus (Che, Zhang & Wang, 2006) KX761462 KX702914 KX702826 KX761455 KX702813 China
Palmallorcus punctulatus (Rambur, 1840) KX761462 KX702914 MN165800 MN267006 MN266975 Greece
Proteinissus bilimeki Fowler, 1904 MN194193 MN191537 MN165803 MN267009 MN266978 Greece
Retaldar yanitubus sp. nov. MN381857 MN332232 MN381856 MN381853 MN381851 China
Rhombissus sp. MN332231 MN381855 MN381852 MN381850 China
Sarima bifurca Meng & Wang, 2016 KX702921 KX761552 KX702819 KX761447 KX702808 China
Scorlupaster heptapotamicum Mitjaev, 1971 – – – MN267010 MN266979 Kazakhstan
Scorlupella discolor (Germar, 1821) – – MN165804 MN267011 MN266980 Bulgaria
Tetrica sp. KX702922 KX702909 KX702821 KX761449 KX702809 China
Thalassana ephialtes (Linnavuori, 1971) MN194194 MN191538 MN165805 MN267012 MN266981 Turkey
Tingissus guadarramense (Melichar, 1906) KX702935 KX702886 MN165806 MN267013 MN266982 Portugal
Traxus fulvus Metcalf, 1923 MN194195 MN191539 MN165807 MN267014 MN266983 Mexico
Trypetimorpha occidentalis Huang & Bourgoin, 1993 KX702957 – KX761546 KX761437 – Kazakhstan
Tshurtshurnella bicolorata Gnezdilov & Oezgen, 2018 MN194196 MN191540 MN165808 MN267015 MN266984 Turkey
Tshurtshurnella zelleri (Kirschbaum, 1868) – MN191541 MN165809 MN267016 MN266985 Italy
Zopherisca penelopae (Dlabola, 1974) – – MN165810 MN267017 MN266986 Greece

Discussion

According to our analysis, the tribe Thioniini was recovered as monophyletic, split from the subfamily Issinae sensu Gnezdilov et al. (2020), and placed in the subfamily Hysteropterinae sensu Gnezdilov et al. (2020). Herein, we suggest that the subtribe Thioniina sensu Gnezdilov et al. (2020) should be a tribe of Hysteropterinae (Thioniini + tribal level groups of genera (Gnezdilov 2016a, b)), sharing the common characteristic of this subfamily: hind wings reduced or rudimentary. Conversely, most taxa of the subfamily Issinae Spinola, 1839 sensu Gnezdilov et al. (2020) have developed hind wings. The Issinae, including five tribes distributed in the Oriental Region, is recovered and well supported in the following topology (node 2): [(Kodaianellini, Issini) + (Sarimini, Parahiraciini) + Hemisphaeriini)].

The monophyletic tribe Hemisphaeriini Melichar, 1906 is confirmed by our data, characterized by hemispherical forewings and single-lobed or rudimentary hind wings (Gnezdilov et al. 2020). The monophyly of the subtribes Hemisphaeriina and Mongolianina Wang et al. (2016) is not supported: the genus Gergithus shows a sister relationship with (Hemisphaeriina + Mongolianina) in this analysis (ML: 97, BI: 89).

Mongoliana serrata Che, Wang & Chou, 2003 is isolated from Mongoliana Distant, 1909 (ML:58, BI:89), confirming the hypothesis of Meng et al. (2017) that the genus Mongoliana could be divided into two species groups. It probably contains two different genera: one of them M. serrata is a new genus with the smooth frons, pale brown tegmina having dark fasciae and spots and the ventral hooks of the aedeagus variable in shape and usually unparallel. Gergithus yunnanensis and G. parallelus show a sister relationship with Ophthalmosphaerius Gnezdilov, 2017, probably belonging to a new genus with Ophthalmosphaerius; this finding agrees with Gnezdilov (2017c) and Zhao et al. (2019), but we still consider it incertae sedis until more evidence is presented.

The third lineage of Mongolianina (Zhao et al. 2019) is recovered only in our ML analysis. Euxaldar daweishanensis sp. nov. and E. lenis are grouped into a different cluster in our research: the genera of the cluster ((E. daweishanensis sp. nov. + Retaldar) + (Clypeosmilus + Eusudasina)) share a protruded clypeus, and forewings CuP clear; another cluster (E. lenis + Macrodaruma) recovered by Zhao et al. (2019) share a smooth metope without pustules, and sexual dimorphism. Euxaldar lenis probably belongs to a new genus.

Euxaldar is similar to the genus Paramongoliana Chen, Zhang & Chang, 2014 which is here formally placed in the subtribe Mongolianina according to Wang et al. (2016), but differs by the following characters: metope smooth or with pustules (metope roughly corrugated, without pustules in Paramongoliana, see Chen et al. 2014: figs 2–33E); forewings with CuP distinct (forewings with CuP poorly recognizable in Paramongoliana, see Chen et al. 2014: figs 2–33A, B, F); anal tube with apical margin not straight (anal tube nearly quadrilateral, apical margin straight in Paramongoliana, see Chen et al. 2014: figs 2–33H).

The genus Euxaldar is also similar to the genus Clypeosmilus (Gnezdilov et al. 2017b) in having forewings with reticulate venation and a distinct claval suture, but can differ from the latter in the following characters: postclypeus with complete median carina and anteclypeus with distinct median carina (Clypeosmilus with postclypeus large, flattened laterally, bearing a thick chisel-like median carina); periandrium asymmetrical (periandrium symmetrical, with pair of long and narrow subapical processes directed apically).

Euxaldar daweishanensis sp. nov., E. jehucal, and E. guangxiensis share several compelling characters: 1) E. daweishanensis sp. nov., E. jehucal, and E. guangxiensis share a metope disc with relatively weak pustules distributed in a row along the lateral margins; and 2) E. daweishanensis sp. nov. and E. guangxiensis have an anal tube with a triangular process on each lateral margin (Fig. 13; Zhang et al. 2018: figs 12, 13). Other noteworthy characters: 1) E. guangxiensis exhibits a vestigial hind wing; 2) E. lenis has a smooth metope without pustules, and sexual dimorphism. All species of this genus probably belong to different species groups or even different genera. More molecular data and other convincing morphological evidence are expected in the future, enabling further discussion of the taxonomic status of Euxaldar.

Acknowledgements

We thank Dr V. M Gnezdilov for proofreading the manuscript. This work was supported by the National Natural Science Foundation of China (No. 31601886), the Program of Science and Technology Innovation Talents Team, Guizhou Province (No. 20144001), the Program of Excellent Innovation Talents, Guizhou Province (No. 20154021), the Science and Technology Project of Guiyang (No. 2017525), the Program of Science and Technology Program in Guizhou Province (No. 20177267) and the New Academic Seedlings Cultivation and Innovation Exploration Special Project of Guizhou University (No. 20175788).

References

  • Anufriev GA, Emeljanov AF (1988) Cicadinea (Auchenor rhyncha). In: Lehr PA (Ed.) Key to the insects of the Far East of the USSR, 2. Leningrad, Nauka, 12–495.
  • Belshaw R, Quicke DLJ (2002) Robustness of ancestral state estimates: evolution of life history strategy in ichneumonoid parasitoids. Systematic Biology 51: 450–477. https://doi.org/10.1080/10635150290069896
  • Bourgoin T (1987) A new interpretation of the homologies of the Hemiptera male genitalia, illustrated by the Tettigometridae (Hemiptera, Fulgoromorpha). Proceedings of the 6th Auchenorrhyncha Meeting, Turin (Italy), September 1987, 113–120.
  • Bourgoin T (1993) Female genitalia in Hemiptera Fulgoromorpha, morphological and phylogenetic data. Annales de la Société Entomologique de France 29(3): 225–244.
  • Bourgoin T, Steffen-Campbell JD, Campbell BC (1997) Molecular phylogeny of Fulgoromorpha (Insecta, Hemiptera, Archaeorrhyncha) the enigmatic Tettigometridae: evolutionary affiliations and historical biogeography. Cladistics-the International Journal of the Willi Hennig Society 13(3): 207–224. https://doi.org/10.1111/j.1096-0031.1997.tb00316.x
  • Bourgoin T, Wang RR, Asche M, Hoch H, Soulier-Perkins A, Stroiński A, Yap S, Szwedo J (2015) From micropterism to hyperpterism: recognition strategy and standardized homology driven terminology of the forewing veins patterns in planthoppers (Hemiptera: Fulgoromorpha). Zoomorphology 134(1): 63–77. https://doi.org/10.1007/s00435-014-0243-6
  • Chan ML, Yang CT (1994) Issidae of Taiwan (Homoptera: Fulgoroidea). Chen Chung Book, Taichung, 188 pp.
  • Chang ZM, Yang L, Zhang ZG, Chen XS (2015) Review of the genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae) with description of two new species. https://doi.org/10.11646/zootaxa.4057.3.2
  • Clary DO, Wolstenholme DR (1985) The mitochondrial DNA molecule of Drosophila yakuba: nucleotide sequence, gene organization, and genetic code. Journal of Molecular Evolution 22(3): 252–271. https://doi.org/10.1007/BF02099755
  • Chen XS, Zhang ZG, Chang ZM (2014) Issidae and Caliscelidae (Hemiptera: Fulgoroidea) from China. Guizhou Science and Technology Publishing House, Guiyang, 242 pp.
  • Cryan JR, Wiegmann BM, Deitz LL, Dietrich CH (2000) Phylogeny of the treehoppers (Insecta: Hemiptera: Membracidae): evidence from two nuclear genes. Molecular Phylogenetics & Evolution 17(2): 317–334. https://doi.org/10.1006/mpev.2000.0832
  • Fennah RG (1978) Fulgoroidea (Homoptera) from Vietnam. Annales Zoologici 34(9): 207–279.
  • Gnezdilov VM (2003) Review of the family Issidae (Homoptera, Cicadina) of the European fauna, with notes on the structure of ovipositor in planthoppers. Chteniya pamyati NA Kholodkovskogo [Meetings in memory of NA Cholodkovsky], St. Petersburg 56(1): 1–145. [In Russian with English summary]
  • Gnezdilov VM, Constant J (2012) Review of the family Issidae (Hemiptera: Fulgoromorpha) in Vietnam with description of a new species. Annales Zoologici 62(4): 571–576. https://doi.org/10.3161/000345412X659632
  • Gnezdilov VM (2013) Modern classification and the distribution of the family Issidae Spinola (Homoptera, Auchenorrhyncha, Fulgoroidea). Entomologicheskoe obozrenie 92(4): 724–738. [English translation published in Entomological Review 94(5): 687–697.] https://doi.org/10.1134/S0013873814050054
  • Gnezdilov VM (2016a) Planthoppers of the family Issidae (Hemiptera, Fulgoroidea) of Western Palaearctic. Thesis of Doctoral Dissertation (Dr. Sci. habilitation), St.-Petersburg, 44 pp. [In Russian]
  • Gnezdilov VM (2016b) Notes on phylogenetic relationships of planthoppers of the family Issidae (Hemiptera, Fulgoroidea) of the Western Palaearctic fauna, with description of two new genera. Entomologicheskoe Obozrenie 95(2): 362–382. [In Russian] [English translation published in Entomological Review (2016) 96(3): 332–347] https://doi.org/10.1134/S0013873816030106
  • Gnezdilov VM, Soulier-Perkins A (2017b) Clypeosmilus centrodasus gen. et sp. nov., a new genus and species of family Issidae (Hemiptera: Fulgoroidea) from Northern Vietnam. Proceedings of the Zoological Institute RAS 321(1): 25–31.
  • Gnezdilov VM (2017c) Addenda to the revisions of the genera Gergithus Stål and Hemisphaerius Schaum (Hemiptera, Auchenorrhyncha, Fulgoroidea, Issidae). Entomological Review 97(9): 1338–1352. https://doi.org/10.1134/S0013873817090123
  • Gnezdilov VM (2018) To the revision of the genus Thionia Stål (Hemiptera, Fulgoroidea, Issidae), with description of new genera and new subtribe. Zootaxa 4434(1): 158–170. https://doi.org/10.11646/zootaxa.4434.1.10
  • Gnezdilov VM, Konstantinov FV, Bodrov SY (2020) New insights into the molecular phylogeny and taxonomy of the family Issidae (Hemiptera: Auchenorrhyncha: Fulgoroidea). Proceedings of the Zoological Institute RAS 324(1): 146–161. https://doi.org/10.31610/trudyzin/2020.324.1.146
  • Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B (2017) PartitionFinder 2: New Methods for Selecting Partitioned Models of Evolution for Molecular and Morphological Phylogenetic Analyses. Molecular Biology Evolutionary 34(3): 772–773. https://doi.org/10.1093/molbev/msw260
  • Wang ML, Zhang Y, Bourgoin T (2016) Planthopper family Issidae (Insecta: Hemiptera: Fulgoromorpha): linking molecular phylogeny with classification. Molecular Phylogenetics and Evolution 105: 224–234. https://doi.org/10.1016/j.ympev.2016.08.012
  • Meng R, Webb MD, Wang YL (2017) Nomenclatural changes in the planthopper tribe Hemisphaeriini (Hemiptera: Fulgoromorpha: Issidae), with the description of a new genus and a new species. European Journal of Taxonomy 298: 1–25. https://doi.org/10.5852/ejt.2017.298
  • Zhao S, Bourgoin T, Wang M (2019) The impact of a new genus on the molecular phylogeny of Hemisphaeriini (Hemiptera, Fulgoromorpha, Issidae). ZooKeys 880: 61–74. https://doi.org/10.3897/zookeys.880.36828

Appendix 1

Partitions and models used for the Maximum likelihood tree in IQtree and Bayesian 50% consensus tree.

#nexus

begin sets;

charset Subset1 = 1–1899;

charset Subset2 = 1900–2617;

charset Subset3 = 2618–3473;

charset Subset4 = 3474–4194;

charset Subset5 = 4195–4861;

charpartition PartitionFinder = GTR+I+G: Subset1, GTR+I+G: Subset2, GTR+I+G: Subset3, GTR+G: Subset4, GTR+I+G: Subset5;

end;

begin mrbayes;

log start filename = log.txt;

outgroup Caliscelis wallengreni;

outgroup Cixius sp;

outgroup Dicranotropis hamata;

outgroup Dicranotropis europaea;

outgroup Trypetimorpha occidentalis;

charset Subset1 = 1–1941;

charset Subset2 = 1942–2732;

charset Subset3 = 2733–3576;

charset Subset4 = 3577–4302;

charset Subset5 = 4303–4929;

partition PartitionFinder = 5: Subset1, Subset2, Subset3, Subset4, Subset5;

set partition = PartitionFinder;

lset applyto = (1) nst = 6 rates = invgamma;

lset applyto = (2) nst = 6 rates = invgamma;

lset applyto = (3) nst = 6 rates = invgamma;

lset applyto = (4) nst = 6 rates = invgamma;

lset applyto = (5) nst = 6 rates = invgamma;

prset applyto = (all) ratepr = variable revmatpr = dirichlet (1, 1, 1, 1, 1, 1) statefreqpr = dirichlet (1, 1, 1, 1);

unlink statefreq = (all) revmat = (all) shape = (all);

mcmcp ngen = 30000000 nruns = 2 relburnin = yes burninfrac = 0.25 printfreq = 1000 samplefreq = 1000 nchains = 4 savebrlens = yes;

mcmc;

sumt;;

end;

login to comment