Research Article
Print
Research Article
Molecular data reveal a new species of Rhopalias Stiles & Hassall, 1898 (Digenea, Echinostomatidae) in the Common opossum, Didelphis marsupialis L. (Mammalia, Didelphidae) in the Yucatán Peninsula, Mexico
expand article infoJorge López-Caballero‡, Rosario Mata-López‡, Gerardo Pérez-Ponce de León‡
‡ Universidad Nacional Autónoma de México, Mexico, Mexico

Corresponding author: Gerardo Pérez-Ponce de León ( ppdleon@ib.unam.mx )

Academic editor: David Gibson
© 2019 Jorge López-Caballero, Rosario Mata-López, Gerardo Pérez-Ponce de León.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: López-Caballero J, Mata-López R, Pérez-Ponce de León G (2019) Molecular data reveal a new species of Rhopalias Stiles & Hassall, 1898 (Digenea, Echinostomatidae) in the Common opossum, Didelphis marsupialis L. (Mammalia, Didelphidae) in the Yucatán Peninsula, Mexico. ZooKeys 854: 145-163. https://doi.org/10.3897/zookeys.854.34549
ZooBank: urn:lsid:zoobank.org:pub:F870F686-0B4B-4B24-8583-73757950FDB1
Open Access

Abstract

A new species of Rhopalias Stiles & Hassall, 1898 is described from the small intestine of the Common opossum, Didelphis marsupialis Linnaeus from the Yucatán Peninsula, Mexico. Rhopalias oochi sp. nov. is morphologically very similar to the type species of the genus, Rhopalias coronatus (Rudolphi, 1819) Stiles & Hassall 1898, a species widely distributed in opossums across Mexico. A molecular phylogenetic analysis using a mitochondrial gene (cox1), and the nuclear ribosomal internal transcribed spacer region (ITS1-5.8S-ITS2), of specimens of R. coronatus collected in several localities of Mexico revealed that those from the Yucatán Peninsula, originally recorded on morphological grounds as R. coronatus actually represented an independent genetic lineage. Maximum Likelihood and Bayesian Inference analyses were performed for each data set independently, and for the concatenated data set (ITS1-5.8S-ITS2 + cox1). All phylogenetic analyses showed that the specimens from Yucatán represented a monophyletic lineage, with high bootstrap support and Bayesian posterior probabilities. In addition, the genetic divergence estimated between R. oochi sp. nov. and two species of Rhopalias, R. coronatus, and R. macracanthus Chandler, 1932 that also occur in Mexican marsupials ranged between 7–8% and 16–17%, for cox1, and between 0.1–0.2% and 7% for the ITS region, respectively. The molecular evidence gathered in this study (reciprocal monophyly in both phylogenetic analyses, and estimated genetic divergence) suggested that the specimens found in the intestine of D. marsupialis originally reported as R. coronatus from Yucatán, actually represent a new species. Morphological evidence was found through light and scanning electron microscopy to support the species distinction based on molecular data.

Keywords

DNA, integrative taxonomy, phylogeny, Trematoda

Introduction

The genus Rhopalias Stiles & Hassall, 1898 includes six species of digenetic trematodes that infect the small intestine of didelphimorph marsupials of the New World (Haverkost and Gardner 2008). Members of this genus of echinostomatid trematodes (see Tkach et al. 2016) are distinguished by having two anterior tentacles armed with spines, which can be invaginated into a muscular pouch, one on each side of oral sucker (Kostadinova 2005). In a taxonomic review of the species of the genus Rhopalias, Haverkost and Gardner (2008) discussed the morphological characters that could be used for distinguishing among congeneric species, concluding that the number and size of tentacle spines, the presence or absence of oral and/or flanking spines, and the length of the muscular pouches are the most reliable characters. Nevertheless, they cautioned that a more extensive sampling of each species of Rhopalias was necessary to support the use of these characters for the species delimitation. Furthermore, with the exception of the sequence of the 28S rRNA gene from an individual of R. macracanthus Chandler, 1934, a parasite of the Virginia opossum, D. virginiana Kerr from the U.S. (Tkach et al. 2016), and genetic information about the other species of Rhopalias is lacking. The main objective of this study was to explore the genetic diversity among specimens of R. coronatus collected throughout a geographical range across southern Mexico, following a molecular prospecting approach in the search for cryptic species (sensu Blouin 2002). Molecular data were used in combination with a morphological study of newly sampled specimens of R. coronatus, and those deposited at the Colección Nacional de Helmintos (CNHE) to describe a new species of Rhopalias. Specimens originally recorded as R. coronatus from the Yucatán Peninsula by Acosta-Virgen et al. (2015) corresponded with an undescribed species. We describe the new species herein.

Materials and methods

Specimen sampling

In total, 44 specimens of opossums were collected between August 2011 and November 2013, in seven localities across southeastern Mexico (Fig. 1, Table 1). Hosts were collected under the collecting permit FAUT-0057 issued to GPPL by the Secretaría del Medio Ambiente y Recursos Naturales. The mammals were sacrificed with an overdose of pentobarbital sodium, necropsied, and all organs were separated in Petri dishes with 0.85% saline, and examined under a stereomicroscope. A small piece of host tissue was taken from each individual and saved for further DNA studies. These tissues are available upon request. Trematodes were removed from the intestine of their hosts, and washed in saline for 3–5 min. Some specimens were fixed by sudden immersion in hot 4% formaldehyde and stored in 70% ethanol for morphological analyses. For molecular study, eight specimens were washed with saline solution, preserved in 100% ethanol, and stored at -20 °C. These specimens were used for DNA extraction, including four specimens that were cut in half and the posterior half processed for morphology (hologenophores, sensu Pleijel et al. 2008), and four complete specimens. The four hologenophores and remaining seven specimens (paragenophores) were stained in Mayer’s paracarmine and mounted as permanent slides in Canada balsam. Specimens of Rhopalias were morphologically identified either as R. coronatus or R. macracanthus according with the description and morphometrical traits reported by Haverkost and Gardner (2008).

Figure 1. 

Sample collection sites of specimens of Rhopalias spp. in opossums across southeastern Mexico. 1 Tlacotalpan, Veracruz (TL) 2 Los Tuxtlas, Veracruz (LT) 3 Cunduacán, Tabasco (CU) 4 Agua Fría, Chiapas (AF) 5 Teapa, Tabasco (TE) 6 Soyaltepec, Oaxaca (SO) 7 Rancho Hobonil, Tzucacab, Yucatán (TZ). Numbers refer to map ID in Table 1.

Table 1.
Download as
CSV
XLSX

Collecting localities, host species (Didelphidae) by locality, GenBank and Colección Nacional de Helmintos (CNHE) accession numbers. Map ID corresponds with numbers in Fig. 1.

Map ID Locality (abbreviation) Coordinates Host (sample size) Species GenBank CNHE
cox1 ITS1-5.8S-ITS2
1 Tlacotalpan, Veracruz (TL) 18°37'40"N, 95°40'40"W D. marsupialis (5) R. coronatus MK982742–57 MK982805–06 9502, 9503
D. virginiana (4)
P. opossum (2) R. macracanthus MK982783–85 MK982815 9509
2 Los Tuxtlas, Veracruz (LT) 18°34'21"N, 95°04'30"W D. marsupialis (5) R. coronatus MK982674–99 MK982813–14 9499, 9500, 9501
D. virginiana (1)
P. opossum (2)
3 Cunduacán, Tabasco (CU) 17°34'17"N, 92°57'09"W D. virginiana (3) R. coronatus MK982700, MK982702 – 9497
4 Agua Fría, Chiapas (AF) 16°15'26"N, 93°53'55"W D. marsupialis (3) R. coronatus MK982703–41 MK982786–96 9488, 9489, 9491
D. virginiana (2)
P. opossum (11)
5 Teapa, Tabasco (TE) 17°33'49"N, 92°45'40"W D. marsupialis (3) R. coronatus MK982701 MK982801 9498
6 Soyaltepec, Oaxaca (SO) 18°15'28"N, 96°24'00"W D. virginiana (2) R. coronatus MK982758–74 MK982797–99,
MK982807–12		 9495
7 “Rancho Hobonil” Tzucacab, Yucatán (TZ) 20°00'58"N, 89°01'12"W D. marsupialis (1) R. oochi sp. nov. MK982775–82 MK982800, MK982802–04 9504, 10926, 11069

Amplification and sequencing of DNA

Individual worms fixed in 100% ethanol (or the posterior portion in some cases) were placed in tubes and digested overnight at 56 °C in a solution containing 10 mM Tris-HCl (pH 7.6), 20 mM NaCl, 100 mM Na2 EDTA (pH 8.0), 1% Sarkosyl, and 0.1 mg/mL proteinase K. Following digestion, DNA was extracted from the supernatant using DNAzol reagent (Molecular Research Center, Cincinnati, Ohio) according to the manufacturer’s instructions. A fragment of the mitochondrial cytochrome c oxidase subunit 1 (cox1), and ITS1-5.8S-ITS2 were amplified by PCR, using the primers shown in Table 2.

Table 2.
Download as
CSV
XLSX

Primers used in the present study.

Locus Primer Sequence (5’–3’) Use Reference
cox1 MplatCOX1dF TGTAAAACGACGGCCAGTTTWCITTRGATCATAAG PCR† Moszczynska et al. 2009
BARCOXR ATAAACCTCAGGATGCCCAAAAAA PCR Razo-Mendivil (pers. comm.)
M13F TGTAAAACGACGGCCAGT SEQ‡ Messing (1993)
(ITS1-5.8S-ITS2) BD1 GTCGTAACAAGGTTTCGGTA PCR & SEQ Bowles and McManus (1993)
BD2 TATGCTTAAATTCAGCGGGT PCR & SEQ Bowles et al. 1995
BD3 GAACATCGACATCTTGAACG SEQ Hernández-Mena et al. 2014
BD4 ATAAGCCGACCCTCGGC SEQ Hernández-Mena et al. 2014

† = amplification; ‡ = sequencing.

All PCRs were performed at a final volume of 25 μl consisted of 2.5 μl of 10× PCR buffer, 2.5 μl of 10 mM of dNTPs mixture (200 μl each), 1.25 μl MgCl2 (50 mM), 1.0 μl each primer (10 pmol), 2 μl DNA template, and 1 unit of Taq DNA polymerase (Biogenica, Mexico City), and the remaining volume of sterilized distilled water. The amplification program for cox1 consisted of: initial denaturation at 96 °C for 3 min, followed by 35 cycles at 94 °C for 1 min, annealing at 50 °C for 45 s, extension at 72 °C for 1 min, followed by 10 min at 72 °C for final elongation. For the ITS1-5.8S-ITS2, the PCR conditions were: initial denaturation at 96 °C for 3 min, followed by 35 cycles at 94 °C for 1 min, annealing at 53 °C for 1 min, extension at 72 °C for 1 min, followed by a final elongation at 72 °C for 10 min. PCR products were treated with Exo–SAP–IT (Thermo Scientific), according to the manufacturer’s instructions. Cox1 and ITS1-5.8S-ITS2 products were sequenced in both strands using the primers mentioned in the Table 2, by the High Throughput Genomics Unit at the University of Washington, USA, (http://www.htseq.org./index.html). Contigs were assembled using the platform Geneious v.5.1.7 (Drummond et al. 2010). As an additional check on accuracy, cox1 nucleotide sequences were translated using Mesquite v.2.75 (Maddison and Maddison 2011), and trematode mitochondrial genetic code. All the cox1 and ITS1-5.8S-ITS2 sequences generated in this study were deposited in the GenBank (Table 1).

Phylogenetic analyses

DNA fragments of the cox1 and ITS region were aligned separately using the software Clustal W2 (Thompson et al. 1994) with a final manual adjusting in Mesquite v.2.75. The concatenated data set was aligned using the same software. Sequences of cox1 and ITS region of other species included within superfamily Echinostomatoidea Looss, 1899 available in the GenBank were used as outgroups. Maximum Likelihood (ML) and Bayesian Inference (BI) analyses were performed for each data set, and for the concatenated data set (ITS1-5.8S-ITS2 + cox1) partitioned by gene. The program jModeltest v.3.0 (Posada and Crandall 1998) was used for inferring the best model of evolution for each data set using the Akaike information criterion. The TVM + I + G and TPMuf + G substitution model were the best models for cox1 and ITS region, respectively. The ML trees were inferred using RAxML v.7.0.4 (Stamatakis 2006). Bootstrap resampling with 10,000 replicates assessed ML clade support. Additionally, Bayesian analyses were performed with the program MrBayes v.3.2.1 (Ronquist et al. 2012). The settings were two simultaneous runs with four Markov chains Monte Carlo (MCMC) for 10 million generations, sampling every 200 generations, a heating parameter value of 0.2 and a ‘burn-in’ of 10%. A 50% majority-rule consensus tree representing the posterior probability distribution of clades was produced of the sampled trees. Phylogenetic trees were displayed with the program FigTree v.1.4.2 (Rambaut 2006). Finally, genetic divergence (p-value) was calculated for each data set using MEGA v.6.0 (Tamura et al. 2013).

Morphological analyses

Representative specimens of the species of Rhopalias were stained with Mayer’s paracarmine or Gomori’s trichrome, dehydrated through a graded ethanol series (70%, 80%, 90% [twice], and 100%), cleared in methyl salicylate, and mounted in Canada balsam. The specimens were observed using an Olympus BX81 light microscope. Some worms were drawn with the aid of a drawing tube attached to an Olympus BX53 light microscope. Likewise, in order to obtain a complete digital record of the morphological traits, specimens were observed through the Differential Interference Contrast method (DIC), using an Olympus Provis AX70 microscope. Photomicrographs of the specimens were obtained with a digital camera Evolution 5.0 MP. All specimens were measured using the software Image Pro-Plus v.7.0. Measurements are presented in micrometres (μm) unless otherwise stated. For scanning electron microscope studies (SEM), the specimens were dehydrated in a graded series of alcohol solutions and then critical point dried with carbon dioxide. Specimens were mounted on metal stubs with carbon adhesive, and then gold coated and examined at 15kV in a Hitachi Stereoscan Model SU1510 SEM (Hitachi Ltd., Tokyo, Japan). Digital images of these specimens were obtained using digital imaging software attached to a computer. Specimens of the new species of Rhopalias were deposited in the Colección Nacional de Helmintos (CNHE), Instituto de Biología, Universidad Nacional Autónoma de México, Mexico City (Table 1).

Results

Phylogenetic analysis

Cox1. One hundred twelve sequences of cox1 were obtained in the present study, including 101 of R. coronatus, three of R. macracanthus, and eight of the new species. The final alignment included seven sequences from GenBank (as outgroups), and consisted of 119 sequences with 666 bp. Phylogenetic trees reconstructed by ML and BI yielded similar topologies with high bootstrap support and Bayesian posterior probabilities, respectively (see Suppl. material 1: Figure S1). The tree obtained with both reconstruction methods shows three major clades, the same ones that were obtained in the concatenated data set (Fig. 2). Clade I, corresponding to R. coronatus according to their morphology, included 101 sequences from six localities: 26 isolates from Los Tuxtlas (LT), 16 isolates from Tlacotalpan (TL), 17 from Soyoltepec (SO), 39 from Agua Fría (AF), two isolates from Cunduacán (CU) and one from Teapa (TE). Clade II included eight sequences from a single locality: Rancho Hobonil, Tzucacab (TZ), representing the new species. Finally, Clade III was composed by three isolates from Tlacotalpan (TL), which were morphologically determined as R. macracanthus. This last clade was recovered as the sister group of clades I and II (see Suppl. material 1: Fig. S1).

Figure 2. 

Tree inferred with the concatenated data set (ITS1-5.8S-ITS2 + cox1), using Maximum Likelihood (-ln likelihood 4605.087967), and Bayesian Inference. The numbers at the nodes represent ML bootstrap support and posterior probability values. Terminals show the locality (abbreviation as in Table 1), and host species where each isolate was collected.

ITS. A subsample of 30 sequences of ITS1-5.8S-ITS2 region were obtained in this study from some specimens corresponding with each of the three genetic lineages of Rhopalias from the cox1 analysis; samples included 25 individuals of R. coronatus, one of R. macracanthus, and four sequences of the new species. In addition, ITS sequences of other species included in the superfamily Echinostomatoidea were downloaded from GenBank and used as outgroups. The final alignment consisted of 32 sequences with 1093 bp. Phylogenetic analyses by ML and BI yielded the same topology (see Suppl. material 2: Figure S2). Both topologies showed two major clades (and not three as the cox1 tree), and relationships are supported by high bootstrap and posterior probability values. Clade I included 29 sequences from six localities: two isolates from Los Tuxtlas (LT), two isolates from Tlacotalpan (TL), nine from Soyoltepec (SO), eleven from Agua Fría (AF), one from Teapa (TE) and four isolates from Tzucacab (TZ). However, these four sequences formed a small subclade within Clade I, corresponding with the isolates of the new species; Clade II was composed by only one sequence of R. macracanthus from Los Tuxtlas (LT).

Concatenated data set. This data set consisted of ITS1-5.8S-ITS2 plus the cox1 gene sequences. The final alignment included 32 sequences with 1759 bp. Phylogenetic analyses of this concatenated data set were also conducted using ML and IB methods, yielding the same topologies. The ML tree is shown in Figure 2. The tree yielded three major clades well supported by bootstrap and Bayesian posterior probability values. The first one included all samples of R. coronatus: two specimens from Los Tuxtlas (LT), two specimens from Tlacotalpan (TL), nine specimens from Soyoltepec (SO), eleven specimens from Agua Fría (AF), and one from Teapa (TE). The second clade included four isolates from Rancho Hobonil, Tzucacab (TZ), representing the new species. Clade III included only one sequence from Tlacotalpan (TL), corresponding with R. macracanthus. All the individuals sequenced from each of these three Rhopalias species, sampled in most of their geographic distribution in Mexico, formed monophyletic groups, with R. coronatus and the new species grouped as sister species (Fig. 2).

Genetic divergence. The genetic divergence estimated among populations of the new species with respect to R. coronatus and R. macracanthus ranged between 7–8% and 16–17%, for cox1, respectively; for the internal transcribed spacers, interspecific divergence between the new species and the other two species of Rhopalias varied 0.1–0.2% and 7%, respectively. The intraspecific divergence among isolates of the three species of Rhopalias ranged from 0–1% for cox1, was null for ITS.

Family Echinostomatidae Looss, 1899

Genus Rhopalias Stiles & Hassall, 1898

Rhopalias oochi sp. nov.

http://zoobank.org/2AFA9155-52CE-4436-A95F-2B0E85F93C72
Figures 3A–D, 4 A, D, E, 5A, D

Synonym

Rhopalias coronatus of Acosta-Virgen et al. (2015). Specimens deposited in the CNHE (9504).

Type host

Didelphis marsupialis Linnaeus, Common opossum (Mammalia: Didelphidae).

Type locality

Rancho Hobonil, Tzucacab, Yucatán state, Mexico (20°00'58"N, 89°01'12"W).

Site in host

Small intestine.

Prevalence and intesity of infection

100% (1 of 1 opossum), infected with 15 trematodes.

Type specimens

Holotype: CNHE 9504; paratypes: CNHE 10926 (3 specimens) and hologenophores CNHE 11069 (4 specimens).

Etymology

The specific epithet refers to the common name of the host where the new species was found. In the Mayan language, “ooch” means opossum.

Description

Based on 11 adult specimens (including 4 hologenophores). Measurements are given in Table 3. Trematodes with a long body, forebody concave, wider than hindbody, with a pair of armed retractile tentacles with 4–7 spines (Fig. 3A, B, C). Tegument covered with spines reaching posterior end of body (Fig. 4A). Tegument spines U-shaped, with distal tip pectinated (Fig. 4D, E). Oral and flanking spines present (Figs 3C, 5A, 5D). Muscular sacs long, reaching far beyond posterior margin of pharynx, and may or may not reach the anterior margin of ventral sucker (Fig. 3A, B). Oral sucker subterminal, rounded, well-developed, short prepharynx, pharynx muscular, and relatively long oesophagus; caecal bifurcation at short distance anterior to genital pore (Fig. 3B); long caeca extending to the posterior end of body (Fig. 3A). Ventral sucker muscular and subspherical, in the first third of body, larger than oral sucker (Figs 3A, B, 4A). Testes two, elongated, in tandem, contiguous, no overlapped, located in mid-body; anterior testis shorter than posterior testis (Fig. 3B). Cirrus sac long, claviform, containing a well-developed prostate complex and seminal vesicle, extending beyond ventral sucker and terminating near anterior border of ovary. Genital pore between ventral sucker and caecal bifurcation. Ovary slightly oval, postacetabular, pretesticular. Uterus intercaecal, between ovary and genital pore. Metraterm long (Fig. 4D). Vitelline follicles in lateral fields, beginning at mid-level between ventral sucker and ovary, ending at posterior end. Gravid specimens with few eggs, oval-shaped, operculated; embryonated eggs with thin shell.

Figure 3. 

Rhopalias oochi sp. nov., parasite of Didelphis marsupialis from Yucatán, Mexico. A Microphotograph, ventral view of entire body B Line drawing, ventral view C Detail of the oral, flanking and tentacle spines, ventral view D Cirrus sac, vagina, and eggs, ventral view. Scale bars: 10 μm (A–C); 400 μm (D).

Figure 4. 

SEM micrographs of Rhopalias species. A–C Ventral view of the body of adult specimens showing the distribution of spines D–I Detail of the spines shape on the ventral surface of hindbody A, D, E R. oochi sp. nov. B, F, G R. coronatus C, H, I R. macracanthus. Scale bars: 100 μm (A–C); 50 μm (D, E); 10 μm (F, G); 20 μm (H, I).

Remarks

The genus Rhopalias currently contains six species as parasites of New World marsupials (Haverkost and Gardner 2008), i.e., Rhopalias coronatus, the type species; Rhopalias horridus (Diesing, 1850) Stiles and Hassall 1898; Rhopalias baculifer Braun, 1901; Rhopalias macracanthus Chandler, 1932; Rhopalias caballeroi Kifune & Uyema, 1982; and Rhopalias caucensis Rivillas, Caro, Carvajal & Vélez, 2004. Rhopalias oochi sp. nov. represents the seventh described species and is readily distinguished from five of the congeneric species, excepting R. coronatus by having tentacle sacs extending far beyond the posterior margin of pharynx. In their detailed morphological revision of the genus Rhopalias, Haverkost and Gardner (2008) provided a key to species of the genus and found that this character is reliable to distinguish between two groups of species. In R. horridus, the tentacle sacs surpass the posterior margin of pharynx to reach the mid-level of oesophagus; however, they never extend beyond the caecal bifurcation. In R. oochi sp. nov. the tentacle sacs extend to reach the anterior margin of ventral sucker. Rhopalias horridus further differ from the new species, and the remaining congeners by the large number of tentacle spines (> 30) (see key in Haverkost and Gardner 2008). The new species most closely resembles the type species, R. coronatus; in fact the specimens upon which the description of the new species is based were originally recorded as R. coronatus (see Acosta-Virgen et al. 2015). Genetic data revealed that they might actually represent a different species. In R. coronatus as in the new species tentacle sacs extend far beyond the posterior border of pharynx; in R. coronatus, both sacs usually surpass the anterior border of ventral sucker (although our observation of numerous voucher specimens indicate that the extension is variable among individuals); in the new species, the tentacle sacs consistently extend to almost reach the anterior border of ventral sucker, but never surpass it. Additionally, R. coronatus differ from the new species by having larger oral spines (at least four times larger), and by the distribution of vitelline follicles. In R. coronatus follicles extend between the posterior end of body and the posterior border of ventral sucker; instead, in R. oochi sp. nov. vitelline follicles do not reach the posterior end of body, and in the forebody, they reach the mid-level of cirrus sac. Morphometrically, most measurements are clearly overlapped between the new species and R. coronatus (except in oral spines size). We observed and measured 21 individuals of R. coronatus deposited at the CNHE. Our measurements, and those reported in other studies (see Table 3) indicate that R. coronatus is morphometrically quite variable. Furthermore, SEM study of the ultrastructure of the body surface provided additional evidence to distinguish the new species from R. coronatus and R. macracanthus; for these two species we collected specimens and some were fixed for a comparative SEM study (Fig. 4). In the three species body spines are denser in the forebody; however, the extension, size, and shape of spines clearly distinguish the three species. In R. oochi sp. nov., spines are robust and pectinate and they extend along the body almost to the posterior end (Fig. 4A, D, E); meanwhile, in R. coronatus spines are distributed to the mid-level of hindbody and are entire and tongue-shaped (Fig. 4B, F, G) and in R. macracanthus, even though spines extend more posteriorly, they are not as robust as in the new species; spines in R. macracanthus are pectinate and arrow-shaped (Fig. 4C, H, I).

Discussion

Specimens of Rhopalias studied in the present study were identified morphologically either as R. coronatus or R. macracanthus following the descriptions by Haverkost and Gardner (2008). Identification was based on the length of the muscular sacs. The species R. coronatus possess muscular sacs almost reaching the anterior end of ventral sucker; meanwhile in R. macracanthus muscular sacs are short and slightly overpass the pharynx level. Additionally, spines of the retractile tentacles are very large in R. macracanthus (see Suppl. material 3: Figure S3C) in comparison with those of R. coronatus. Morphometrically, specimens of the three species are also different (see Table 3). Our study followed a molecular prospecting approach by considering R. coronatus as a trematode species that infects three species of marsupials distributed across a wide geographical range in southeastern Mexico (Blouin 2002; Criscione et al. 2005; Vilas et al. 2005). Our analyses showed that the specimens from the Yucatán Peninsula actually represented a separate species; phylogenetic trees showed all isolates from that locality as a reciprocally monophyletic assemblage, separated from isolates of R. coronatus, and this two as the sister taxa of R. macracanthus. Even though the internal transcribed spacers (ITS1-5.8S-ITS2) exhibited lower resolution, the mitochondrial gene (cox1) revealed relatively high genetic divergence values (7–8%) supporting the distinction of the new species. This level of genetic divergence has been found in studies with other members of the superfamily Echinostomatoidea. For instance, Saijuntha et al. (2011) reported divergence levels of 8–16% between two species of Echinostoma Rudolphi, 1809. Even though the pertinence of using a genetic yardstick to distinguish parasite species has been questioned (Nadler and Pérez-Ponce de León 2011), the species delimitation criteria followed in our study is also based on a hypothesis-testing framework (see Adams 2002; Nadler 2002).

Table 3.
Download as
CSV
XLSX

Measurements of Rhopalias spp. Measurements are presented in micrometers (µm) unless otherwise noted. Measurements above 1000 µm are expressed in millimeters.

R. oochi sp. nov. (Present study) N= 7 R. coronatus (Present study) N= 15 R. coronatus (Haverkost & Gardner 2008) N= 22 R. macracanthus (Present study) N= 6
n Mean Range n Mean Range n Mean Range n Mean Range
Body L 4 6.64 mm 6.42–6.70 15 4.69 2.94–6.66 22 4.440 2.160–9.360 6 3.36 2.78–3.75
Body W 4 727 622–810 15 611 320–770 22 735 219–1.58 6 680 514–680
VS L 7 484 420–543 15 330 190–530 22 376 150–840 6 308 257–340
VS W 7 417 355–464 15 330 190–480 22 350 150–816 6 304 273–332
OS L 6 177 168–189 15 180 100–245 22 183 93–344 6 159 141–174
OS W 6 160 139–194 15 167 99–200 22 180 88–325 6 162 149–174
Cirrus sac L 6 1.30 1.14–1.43 15 931 332–1.50 22 970 563–2.219 4 960 871–1.03
Cirrus sac W 6 283 248–317 15 281 132–400 20 203 119–500 4 319 174–431
Anterior testis L 4 528 500–572 15 386 255–515 21 333 156–625 6 277 195–356
Anterior testis W 4 149 146–154 15 189 135–227 21 167 100–281 6 220 130–350
Posterior testis L 4 722 672–770 15 535 322–655 21 499 256–919 5 412 299–520
Posterior testis W 4 140 137–147 15 175 112–232 21 149 75–281 5 164 123–217
Ovary L 5 222 112–233 14 175 75–232 21 169 75–344 6 151 97–175
Ovary W 5 178 162–193 14 162 95–217 20 178 88–350 6 149 86–180
Tentacle sac L 7 741 654–798 14 710 423–990 21 693 375–1.188 6 301 271–347
Tentacle sac W 7 155 137–189 14 146 109–200 21 137 63–238 6 132 125–143
Prepharynx L 5 103 90–118 15 80 30–120 22 39 0–313 6 78 56–97
Pharynx L 6 173 151–212 15 156 105–200 22 202 115–425 6 162 147–182
Pharynx W 6 96 84–111 15 81 47–135 21 104 30–244 6 99 91–112
Oesophagus L 4 312 300–339 15 285 200–422 20 186 0–606 6 19 10–30
Egg number 5 6 0–12 15 30 22–90 22 24 0–75 6 25 10–75
Eggs L 12 83 66–96 58 89 70–113 94 90 70–108 30 86 60–100
Eggs W 12 51 41–55 58 50 30–62 94 51 38–70 30 54 39–93
VS/OS ratio L 6 1:2.70 1:2.60–2.87 15 1:1.83 1:1.90–2.20 1:2.0* 1:1.61–2.44* 6 1:1.93 1:1.82–1.95
VS/OS ratio W 6 1:2.70 1:2.60–2.80 15 1:1.00 1:1.90–2.40 1:1.94* 1:1.70–2.50* 6 1:1.87 1:1.83–1.90
ANTVIT 4 1.66 mm 1.56–1.75 15 1.31 715–2.72 22 1.16 331–3.60 6 1.10 1.05–1.20
VSVIT 4 248 176–328 14 38 -130–237 22 51 -200–480 6 40 0–10
GP to anterior end 5 821 795–853 15 660 430–760 NM NM 6 525 430–589
Oral spines L 14 9 7–12 30 39 22–58 NM NM 24 10 12–20
Oral spines W 14 8 5–10 30 11 7–14 NM NM 24 12 7–17
Tentacle spines L 18 23 15–32 30 36 33–55 22 56 32–67 24 135 112–152
Tentacle spines W 18 11 8–14 30 19 14–30 NM NM 24 25 20–32

VS = Ventral Sucker; OS = Oral Sucker; ANTVIT = distance from the anterior end to the anterior margin of the vitellarium; VSVIT = distance from the anterior margin of the vitellarium to the posterior margin of the Ventral Sucker; GP = Genital Pore; NM = No mentioned; * = Values estimated from original measurements in Haverkost and Gardner (2008).

A closer look at the morphology of the specimens from Yucatán using light and scanning electron microscopy corroborated the molecular results, and the new species was described as a parasite of the Common opossum, D. marsupialis. Rhopalias oochi sp. nov. represents the seventh described species in the genus, and the 5th in marsupials distributed in Mexico. With the exception of R. macracanthus, a species described by Chandler (1932) in the Nearctic biogeographical region, from the Virginia opossum, in the U.S.A., all the other species included in the genus Rhopalias were originally described in marsupials from the Neotropical region. However, R. macracanthus was later found in South American marsupials, particularly in the Department of Santa Cruz, Bolivia (Haverkost and Gardner 2008). The type species, R. coronatus was described from the Common opossum, D. marsupialis in Brazil; R. horridus from the Water opossum, Chironectes minimus (Zimmerman) also in Brazil; R. baculifer from D. marsupialis in Brazil; R. caballeroi from D. marsupialis and from the Grey four-eyed opossum, Philander opossum (Linnaeus) in Brazil; and R. caucensis from P. opossum in Colombia (see Haverkost and Gardner 2008). According to García-Prieto et al. (2012) four species of Rhopalias have been recorded in Mexico, R. baculifer and R. caballeroi in restricted localities in the tropical rain forest of Los Tuxtlas, Veracruz, and other two species more widely distributed parasitizing three species of marsupials (P. opossum, D. virginiana and D. marsupialis), R. coronatus, and R. macracanthus in nine and 12 localities, respectively. A few additional records were more recently provided by Acosta-Virgen et al. (2015). Interestingly, in the region of Los Tuxtlas, Veracruz, where the three species of opossums are found in sympatry (see Cervantes et al. 2010), the four species of Rhopalias have been recorded. In our study, even though we sampled five individuals of D. marsupialis, one of D. virginiana and two of P. opossum from the same locality, we only collected specimens of R. coronatus and R. macracanthus.

Marsupials occurring across Mexico are heavily parasitized by helminths; at least 16 helminth taxa have been recorded for D. marsupialis, 30 for D. virginiana, and 17 for P. opossum across their distributional ranges in Mexico (Acosta-Virgen et al. 2015). The only study where DNA sequences were used to establish a more robust species delimitation for the helminth parasite fauna of marsupials is that of López-Caballero et al. (2015). These authors uncovered three genetic lineages for the acanthocephalan Oligacanthorhynchus microcephalus (Rudolphi, 1819) Schmidt, 1972, a species allegedly with a distribution from Brazil, where it was originally described, extended to the USA The fact that we detected another new species of a marsupial parasite through the use of DNA sequences clearly indicated that future studies should consider the use of molecular tools that greatly enhance our ability to delimit species, and this will increase our understanding of the species diversity of marsupial parasites.

Finally, we consider that the use of SEM is fundamental in determining reliable characters that distinguish among echinostomid species because the presence of a wide array of spines along the body and around the oral sucker. In this case, SEM was very important in showing that the species R. macracanthus do possess oral spines, although they are not completely visible using light microscopy (see Fig. 5C–F). For instance, Figure 5C shows the presence of 16 tongue-shaped oral spines in R. macracanthus, and these spines contrast in size and shape with flanking spines which are more visible. Haverkost and Gardner (2008) taxonomic key pointed out the lack of oral spines in R. macracanthus. However, our study demonstrated that these spines are present. Overall, the integrative taxonomy approach, where several sources of information are used to establish more robust species delimitation criteria, is highly recommended for a complete understanding of parasite diversity.

Figure 5. 

Anterior end of Rhopalias species. showing the detail of the oral and flanking spines. A–C SEM micrographs D–F DIC micrographs, dorsal view A, D R. oochi sp. nov. B, E R. coronatus C, F R. macracanthus. Scale bars: 100 μm (A, B); 50 μm (C); 40 μm (D–F).

Acknowledgements

We thank David Osorio, Luis García, Virginia León, Luis J. García, Sergio Guillén, Uriel Garduño, Karla Acosta, Manuel Servín, Samantha Contreras, and Sara Ramírez for their support during field work. To Rosamond Coates and David Cervera kindly granted permissions for sampling in the Estación de Biología Tropical, Los Tuxtlas, Veracruz and Rancho Hobonil, Tzucacab, Mérida, Yucatán, respectively. JLC thanks to families Medina-Castillo in Agua Fría, Chiapas, and Hernández in Finca Brasil, Tapachula, Chiapas. We are grateful with Berenit Mendoza Garfias for her technical support taking the SEM pictures and Ana Isabel Bieler Antolin for assitance taking DIC microphotographs; David Hernández-Mena for obtaining of ITS sequences and Laura Márquez and Nelly López, LaNaBio, for obtaining sequences with the automatic sequencer. JLC also thanks CONACyT for the scholarship received to complete his PhD studies within Posgrado en Ciencias Biológicas, UNAM. This study was partly founded by the Programa de Apoyo a Proyectos de Investigación e Innovación Tecnológica (PAPIIT-UNAM) IN202617 and 220113 to GPPL and RML, respectively.

References

  • Acosta-Virgen K, López-Caballero J, García-Prieto L, Mata-López R (2015) Helminths of three species of opossums (Mammalia, Didelphidae) from Mexico. ZooKeys 511: 131–152. https://doi.org/10.3897/zookeys.511.9571
  • Adams BJ (2002) The species delimitation uncertainty principle. Journal of Nematology 33: 153–160.
  • Blouin MS (2002) Molecular prospecting for cryptic species of nematodes: mitochondrial DNA versus internal transcribed spacer. International Journal for Parasitology 32: 527–531. https://doi.org/10.1016/S0020-7519(01)00357-5
  • Braun M (1901) Zur Kenntnis der Säugetiere. Zoologische Jahrbücher Systematik 14: 311–348.
  • Cervantes FA, Arcangeli-Álvarez J, Hortelano-Moncada Y, Borisenko AV (2010) DNA barcodes effectively identify the morphologically similar Common Opossum (Didelphis marsupialis) and Virginia Opossum (Didelphis virginiana) from areas of sympatry in Mexico. Mitochondrial DNA 21: 44–50. https://doi.org/10.3109/19401736.2010.538051
  • Chandler AC (1932) Notes on helminth parasites of the opossum (Didelphis virginiana) in Southeast Texas with description of four new species. Proceedings of the United States National Museum 81: 1–15. https://doi.org/10.5479/si.00963801.81-2939.1
  • Diesing CM (1850) Systema helminthum. Vindobonae, Vienna, 588 pp.
  • Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, Duran C, Field M, Heled J, Kearse M, Markowitz S, Moir R, Stones-Havas S, Sturrock S, Thierer T, Wilson A (2010) Geneious v5.0.4. http://www.geneious.com/
  • García-Prieto L, Falcón-Ordaz J, Guzmán-Cornejo C (2012) Helminth parasites of wild Mexican mammals: list of species, hosts and geographical distribution. Zootaxa 3290: 1–92. https://doi.org/10.11646/zootaxa.3290.1.1
  • Haverkost TR, Gardner SL (2008) A review of species in the genus Rhopalias (Rudolphi, 1819). Journal of Parasitology 94: 716–726. https://doi.org/10.1645/GE-1423.1
  • Hernández-Mena DI, García-Prieto L, García-Varela M (2014) Morphological and molecular differentiation of Parastrigea (Trematoda: Strigeidae) from Mexico, with the description of a new species. Parasitology International 63: 315–323. https://doi.org/10.1016/j.parint.2013.11.012
  • Kifune T, Uyema N (1982) Report of the Fukuoka University Scientific Expedition to Peru, 1976. Part 3. Taxonomical studies on trematodes from marsupials and rodents with records of two crabs. Medical Bulletin of Fukuoka University 9: 241–256.
  • Kostadinova A (2005) Family Echinostomatidae Looss, 1899. In: Jones A, Bray RA, Gibson DI (Eds) Keys to the Trematoda, vol. 2. CABI. Publishing and the Natural History Museum, Wallingford and London, UK, 9–64. https://doi.org/10.1079/9780851995878.0009
  • Looss A (1899) Weitere Beiträge zur Kenntnis der Trematoden-Fauna Aegyptens zugleich Versuch einer natürlichen Gleiderung des Genus Distomum Retzius. Zoologische Jahrbücher. Abteilung für Systematik, Geographie und Biologie der Tiere 12: 521–784. https://doi.org/10.5962/bhl.part.2037
  • López-Caballero J, Mata-López R, García-Varela M, Pérez-Ponce de León G (2015) Genetic variation of Oligacanthorhynchus microcephalus (Acanthocephala: Archiacanthocephala: Oligacanthorhynchidae), parasite of three species of opossums (Mammalia: Didelphidae) across central and southeastern Mexico. Comparative Parasitology 82: 175–186. https://doi.org/10.1654/4742.1
  • Moszczynska A, Locke SA, McLaughlin JD, Marcogliese DJ, Crease TJ (2009) Development of primers for mitochondrial cytocrome c oxidase I gene in digenetic trematodes (Platyhelminthes) illustrates the challenge of barcoding parasitic helminths. Molecular Ecology Resources 9: 75–82. https://doi.org/10.1111/j.1755-0998.2009.02634.X
  • Nadler SA, Pérez-Ponce de León G (2011) Integrating molecular and morphological approaches for characterizing parasite cryptic species: implications for parasitology. Parasitology 138: 1688–1709. https://doi.org/10.1017/S003118201000168X
  • Pleijel F, Jondelius U, Norlinder E, Nygren A, Oxelman B, Schander C, Sundberg P, Thollesson M (2008) Phylogenies without roots? A plea for the use of vouchers in molecular phylogenetic studies. Molecular Phylogenetics and Evolution 48: 369–371. https://doi.org/10.1016/j.ympev.2008.03.024
  • Rambaut A (2006) FigTree v1.3.1. Institute of Evolutionary Biology. University of Edinburgh, UK.
  • Rivillas C, Caro E, Carvajal H, Vélez I (2004) Algunos trematodos digeneos (Rhopaliasidae, Opistorchiidae) de Philander opossum (Marsupialia) de la costa pacífica colombiana, incluyendo Rhopalias caucensis sp. n. Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales 28: 591–600.
  • Ronquist F, Teslenko M, Van Der Mark P, Ayres LD, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes v3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Systematics Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029
  • Rudolphi CA (1809) Entozoorum sive vermium intestinalium. Historia Naturalis 1: 1–527.
  • Saijuntha W, Sithithaworn P, Duenngai K, Kiatsopit N, Andrews RH, Petney TN (2011) Genetic variation and relationships of four species of medically important echinostomes (Trematoda: Echinostomatidae) in South-East Asia. Infection, Genetics and Evolution 11: 375–381. https://doi.org/10.1016/j.meegid.2010.11.009
  • Schmidt GD (1972) Revision of the Class Archiacanthocephala Meyer, 1931 (Phylum Acanthocephala), with emphasis on Oligacanthorhynchidae Southwell et MacFie, 1925. Journal of Parasitology 58: 290–297. https://doi.org/10.2307/3278091
  • Stiles CW, Hassall A (1898) Notes on parasites, an inventory of the genera and subgenera of the trematode family Fasciolidae. Archives de Parasitologie 1: 81–99.
  • Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis v6.0. Molecular Biology and Evolution 30: 2725–29. https://doi.org/10.1093/molbev/mst197
  • Thompson J, Higgins D, Gibson T (1994) Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673–4680. https://doi.org/10.1093/nar/22.22.4673
  • Tkach VV, Kudlai O, Kostadinova A (2016) Molecular phylogeny and systematics of the Echinostomatoidea Looss, 1899 (Platyhelminthes: Digenea). International Journal for Parasitology 46: 171–185. https://doi.org/10.1016/j.ijpara.2015.11.001
  • Vilas R, Criscione CD, Blouin MS (2005) A comparison between mitochondrial DNA and the ribosomal internal transcribed regions in prospecting for cryptic species of platyhelminth parasites. Parasitology 131: 1–8. https://doi.org/10.1017/S0031182005008437

Supplementary materials

Supplementary material 1 

Figure S1. Tree inferred with cox1 data set, using Maximum Likelihood and Bayesian Inference

Jorge López-Caballero, Rosario Mata-López, Gerardo Pérez-Ponce De León

Data type: phylogenetic tree

Explanation note: The numbers at the nodes represent ML bootstrap support and posterior probability values. Clade terminals represent localities and hosts from the worms were collected.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (1.47 MB)
Supplementary material 2 

Figure S2. Tree inferred with ITS region (ITS1 + 5.8S + ITS2) data set, using Maximum Likelihood and Bayesian Inference

Jorge López-Caballero, Rosario Mata-López, Gerardo Pérez-Ponce De León

Data type: phylogenetic tree

Explanation note: The numbers at the nodes represent ML bootstrap support and posterior probability values. Clade terminals represent localities and hosts from the worms were collected.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (734.74 kb)
Supplementary material 3 

Figure S3

Jorge López-Caballero, Rosario Mata-López, Gerardo Pérez-Ponce De León

Data type: species images

Explanation note: Rhopalias coronatus ex Didelphis virginiana from Los Tuxtlas, Veracruz. (A) Line drawing, ventral view (B) Microphotograph, ventral view of entire body. Rhopalias macracanthus ex Philander opossum from Tlacotalpan, Veracruz (C) Line drawing, ventral view. (D) Microphotograph, ventral view of entire body. Scale bars 1 mm (A, C); 20.2 mm (B, D).

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (15.63 MB)
login to comment