ZooKeys 252: 1–209, doi: 10.3897/zookeys.252.3588
Phylogenetic treatment and taxonomic revision of the trapdoor spider genus Aptostichus Simon (Araneae,  Mygalomorphae, Euctenizidae)
Jason E. Bond 1,†
1 Department of Biological Sciences, Auburn University Museum of Natural History, Auburn, Alabama, United States of America

Corresponding author: Jason E. Bond (jbond@auburn.edu)

Academic editor: M. Kuntner

received 15 August 2012 | accepted 21 November 2012 | Published 19 December 2012

(C) 2012 Jason E. Bond. This is an open access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

For reference, use of the paginated PDF or printed version of this article is recommended.


This systematic study documents the taxonomy, diversity, and distribution of 40 species of the predominately Californian trapdoor spider genus Aptostichus Simon, 1891. Thirty-three of these species are newly described: Aptostichus dantrippi, Aptostichus cabrillo, Aptostichus pennjillettei, Aptostichus asmodaeus, Aptostichus nateevansi, Aptostichus chiricahua, Aptostichus icenoglei, Aptostichus isabella, Aptostichus muiri, Aptostichus barackobamai, Aptostichus sinnombre, Aptostichus hedinorum, Aptostichus aguacaliente, Aptostichus chemehuevi, Aptostichus sarlacc, Aptostichus derhamgiulianii, Aptostichus anzaborrego, Aptostichus serrano, Aptostichus mikeradtkei, Aptostichus edwardabbeyi, Aptostichus killerdana, Aptostichus cahuilla, Aptostichus satleri, Aptostichus elisabethae, Aptostichus fornax, Aptostichus lucerne, Aptostichus fisheri, Aptostichus bonoi, Aptostichus cajalco, Aptostichus sierra, Aptostichus huntington, Aptostichus dorothealangeae, and Aptostichus chavezi. Most of these species are restricted to the California Floristic Province, a known biodiversity hotspot. Of the 40 recognized species, over half are considered to be imperiled or vulnerable and two have likely gone extinct over the past half-century; the conservation status of only 11 species is considered to be secure. Using 73 quantitative and qualitative morphological characters I propose a preliminary phylogeny for the genus that recognizes four major lineages: the Atomarius, Simus, Hesperus, and Sierra species groups. Additionally, the phylogenetic analysis indicates that adaptations favoring the invasion of the arid desert habitats of southern California have evolved multiple times across the group. The existence of both desert and non - desert species in three of the four species groups makes this genus an ideal candidate for the study of the evolutionary ecology of desert arthropods. A set of molecular characters based on the contiguous mitochondrial DNA genes 16S-tRNA valine-12S is used in an independent analysis to assist in placement of specimens into species. The taxonomy section explicitly identifies the concept employed in species delimitation. Niche based distribution models are constructed to predict the ranges of species for which an adequate number of sampling sites were known.


Biodiversity, Biodiversity hotspot, Cladistics, California Floristic Province, Conservation, DNA taxonomy, DNA barcoding, New species, Spider taxonomy, Aptostichus, Euctenizidae, Mygalomorphae


The mygalomorph family Euctenizidae is a geographically widespread group of fossorial spiders most of whom capture prey at the entrance of a burrow covered by a silken - soil trapdoor. Raven (1985) originally established this group as a subfamily of the Cyrtaucheniidae, however a number of phylogenetic treatments of the infraorder Mygalomorphae (Bond and Opell 2002, Bond and Hedin 2006, Hedin and Bond 2006, and Bond et al. 2012b) indicated that the family was a classical dumping ground, comprising a number of genera and species that were difficult to place. A recent phylogenetic treatment by Bond et al. (2012b) concluded that Raven’s subfamily Euctenizinae, a group that included all of the North American cyrtaucheniids, was a monophyletic taxon that is closely related to idiopids and should be elevated to the family rank. This group comprises the eastern North American genus Myrmekiaphila Atkinson, 1886 (recently revised by Bond and Platnick 2007, also see Bailey et al. 2010 and Bond et al. 2012a), and the southwestern genera Neoapachella, Bond & Opell 2002, Eucteniza Ausserer, 1875, Promyrmekiaphila Schenkel, 1950 (recently revised by Stockman and Bond 2008, but also see Stockman and Bond 2007), Entychides Simon, 1888, Apomastus Bond & Opell, 2002, and Aptostichus Simon, 1891. Although the basal euctenizid lineages are probably relatively old (Bond and Hedin 2006) most of the genera are depauperate with respect to morphological and species diversity. Many consist of very few species and two, Neopachella and Promyrmekiaphila, are either monotypic (Bond and Opell 2002) or comprise only two morphological species (Stockman and Bond 2008). That said, morphological assessments likely underestimate the evolutionary diversity contained within these groups (Bailey et al. 2010, Bond et al. 2001, Bond and Stockman 2008, Starrett and Hedin 2006, Stockman and Bond 2007).

In terms of diversity the trapdoor spider genus Aptostichus, the subject of this revision, is an anomaly with respect to high species diversity relative to the other euctenizid genera and many other mygalomorph groups. Itcomprises > 40 species restricted primarily to the state of California, with additional, species, in the states of Nevada and Arizona (one and two respectively). Among southwestern mygalomorph genera (save theraphosids, tarantulas), this diversity is rivaled only by the antrodiaetid genus Aliatypus Smith, 1908 that contains a third as many species. Aptostichus species range widely in size (carapace length 3 - 7.5 mm), coloration, and habitat type. These features, and others (described below) make the genus very interesting from an evolutionary and ecological perspective. Although relatively restricted geographically its species are found in disparate habitats (Figs 1–6), ranging from Mediterranean climates to the arid Mojave and Colorado deserts. Their apparent ecological specialization coupled with high species diversity makes these spiders ideal for investigations of the evolution of characters associated with desert adaptations. The “trapdoor spider desert adaptation paradigm” has been addressed by others (Main 1978, Coyle and Icenogle 1994) but never in an explicit phylogenetic context. Additionally, the distribution of this genus across the unique taxonomically and geologically diverse Californian Floristic Province (Myers et al. 2000), a region recognized as a biodiversity hotspot, provides an important and well-studied system in which to consider questions about the geography of speciation and adaptation and makes this group of high conservation interest.

Figures 1–6.

Breadth of diversity of Aptostichus species habitat types in the California Floristic Province. 1 alpine habitat, Sierra Nevada Mountain Range, Fresno County 2 northern coastal dunes, Humboldt County 3 chaparral, Riverside County 4 Joshua Tree National Park, Riverside County 5 Panamint Valley, Inyo County 6 Pisgah Crater, San Bernardino County.

Although Aptostichus may be noteworthy from an evolutionary and conservation perspective, its taxonomy has been largely neglected. Since the original description of the genus by Simon (1891) only three species of Aptostichus were subsequently described during the 20th Century (Smith 1908; Chamberlin 1917, 1919). Largely through the efforts of Mr. Wendell Icenogle and Dr. Willis Gertsch during the late 1960’s through the 1970’s, many Aptostichus specimens were collected and the high diversity in this group began to come to light. It is apparent from letters and preliminary taxonomic worksheets created during the 1970’s that Gertsch had intended to revise the genus, a project that never reached fruition. More recently, molecular studies focusing on a speciation pattern and process within the Aptostichus atomarius species complex, a widespread, morphologically homogenous species distributed broadly throughout southern and western California (Bond and Stockman 2008), have resulted in the description of an additional three species (Aptostichus stephencolberti, Aptostichus miwok, and Aptostichus angelinajolieae). These results were consistent with earlier molecular studies of the coastal dune endemic species Aptostichus simus (Bond et al. 2001) that likewise seemed to indicate species crypsis.

The covert behavior and simple morphology of many mygalomorph groups (Coyle 1971), particularly when compared to many other more “advanced” araneomorph spider groups, is probably why Aptostichus has been overlooked by other spider workers. Like many mygalomorph groups, itis perhaps even more difficult to study because females of many species lack obvious distinguishing morphological features altogether (humorously characterized as “hopeless” by Gertsch in lit.). Additionally, many species can be collected only during certain times of the year and collecting typically requires that the burrows be excavated, an activity that is often very time-consuming. Because Aptostichus species construct flimsy, thin wafer trapdoors (Figs 7–10) that often have plant debri attached rendering them cryptic, these doors cannot easily be detected by simply searching a substrate for a thin door outline. Therefore, one must sometimes use a “scraping” technique to find burrows by removing the first few centimeters of topsoil, thereby exposing the silk lined burrow. This technique however, is not very effective in sandy desert habitats. The only way to find desert Aptostichus females appears to be after winter rains when the spiders extend, or clean out their burrows, leaving a small mound of sand at the burrow entrance. In contrast, males are much easier to distinguish than females and have been widely collected in standard pitfall traps. This sex-specific disparity is reflected herein in that some female specimens were impossible to accurately assign to a species on the basis of morphology alone; that is, molecular data were sometimes necessary to assign specimens to a taxon.

Figures 7–10.

Aptostichus icenoglei sp. n. burrow; specimen MY2465, adult female, excavated from roadside bank north of Fallbrook on DeLuz Road (San Diego County). 7 burrow with trapdoor closed 8,  9 trapdoor propped open frontal and side views 10 burrow excavated.

The objectives of this systematic study are two-fold. First, I aim to provide a first taxonomic treatment of the genus Aptostichus. This taxonomic study seeks to answer basic questions about species delineation and distribution, thereby providing the information necessary for future studies of speciation pattern and process, character evolution, adaptation, and biogeography in this incredibly diverse and interesting group of trapdoor spiders. Second, I propose an interspecific phylogeny for Aptostichus; however, caution that this phylogeny should be considered as preliminary. Although over 70 morphological characters are used, many of these are thought to be homoplasic a priori(e.g., features like carapace and abdomen coloration are obvious psammophilic characteristics). And, many of the characters are single sex genitalic features; both sexes are unknown for about one-third of the species. This introduces a suite of characters for which the states cannot be assessed for a large proportion of species, undoubtedly affecting the results of phylogenetic analysis presented herein. All caveats aside, this phylogeny and taxonomic revision describes 33 new species of Aptostichus, establishes four monophyletic species groups and provides the phylogenetic framework needed to guide future studies of this group’s taxonomy and evolution.

Abbreviations, materials and methods

The following institutional and quantitative morphological abbreviations used in this paper are defined as follows:


AMNH (American Museum of Natural History; New York, New York), AUMNH (Auburn University Museum of Natural History; Auburn, Alabama), CAS (California Academy of Sciences; San Francisco, California), DUB (personal collection of Darrell Ubick; San Francisco, California), ICE (personal collection of Wendell Icenogle; Winchester, California), MCZ (Museum of Comparative Zoology, Harvard; Boston, Massachusetts), MEL (personal collection of Mel Thompson), MNHN (Muséum National D’Histoire Naturelle, Paris), SCW (Personal collection of Scott C. Williams, deposited in the AMNH), UCR (University of California Riverside; Riverside, California).

Quantitative morphological

ANTd: number of teeth on the anterior margin of the female cheliceral fang furrow.

Cl, Cw: carapace length and width (Fig. 11). Carapace length taken along the midline dorsal most posterior position to the anterior front edge of the carapace (chelicerae are not included in length). Carapace width taken at the widest point.

LBl, LBw: labium length and width taken from the longest and widest points, respectively (Fig. 12).

MF1, MT1, MM1, MA1: lengths of male leg I femur, tibia, metatarsus, and tarsus (Fig. 13).

MF4, MT4: length of male leg IV femur and tarsus (Fig. 14) taken from the prolateral aspect.

PTl, PTw: male palpal tibia length and width (Fig. 15).

Bl: palpal bulb length from embolus tip to the bulb base, taken in the ventral plane at its longest point (Fig. 16).

PTLs, TBs: number of female prolateral patella and tibial spines leg III.

STRl, STRw: sternum length and width. Sternum length from the base of the labium to its most posterior point. Width taken across the widest point, usually between legs II and III (Fig. 12).

TSrd, TSp, TSr: number of tibia I spines on the distal most retrolateral, prolateral, and midline retrolateral positions.

Measurement, characterization, and illustration of morphological features

Unique voucher numbers were assigned to all specimens (alphanumeric designations beginning with AP or MY); these data were added to each vial and can be used to cross-reference all images, measurement, and locality data. All measurements are given in millimeters and were made with a Wild M8 or Leica M9.5Z dissecting microscope equipped with an ocular micrometer scale. Appendage measurements, quantitative and meristic, were based on left appendages in the retrolateral (unless otherwise stated) view using the highest magnification possible. Measurements of large structures (e.g., leg article lengths, carapace and sternum dimensions, etc.) are accurate to 0.03–0.015 mm. Measurements of smaller structures (e.g., palpal bulb and labial dimensions) are accurate to 0.0075 mm. Lengths of leg articles were taken from the mid–proximal point of articulation to the mid–distal point of the article (sensu Coyle 1995 Figure 1; Figs 11–16). Leg I article measurements are listed in the species descriptions in the following order: femur, tibia, metatarsus, tarsus and metatarsus ventral excavation (Fig. 13); leg IV measurements are femur and tarsus only (given in that order). Carapace and leg coloration are described semi-quantitatively using Munsell® Color Charts (Windsor, NY) and are given using the color name and color notation (hue value/chroma).

Figures 11–16.

Diagrammatic representation of quantitative measurements of morphological features and leg articles. 11, 12 carapace, labium, sternum length and width 13 lengths of leg I femur, tibia, metatarsus, tarsus, metatarsal proximal/ventral excavated region, number of tibia distal retrolateral spines 14 lengths of leg IV femur and tarsus 15 male palpal tibia length and width 16 male copulatory bulb length.

Figures 17–20.

Box plots for quantitative measurements used in phylogenetic analysis and species diagnosis; ratios are given in values multiplied by 100 (y-axis); characters states are indicated above and below horizontal line bisecting graph; species abbreviations (x-axis) defined in Table 1. 17 sternum length to width 18 labium length to width 19 leg IV tarsus length to femur length 20 leg I tibia length to femur length.

Figures 21–24.

Box plots for quantitative measurements used in phylogenetic analysis and species diagnosis; ratios are given in values multiplied by 100 (y-axis); characters states are indicated above and below horizontal line bisecting graph; species abbreviations (x-axis) defined in Table 1. 21 leg I metatarsus length to femur length 22 leg I tarsus length to femur length 23 male palpal tibia width to length 24  palpal tibia length to carapace length.

Figures 25–27.

Box plot and counts for quantitative and meristic measurements used in phylogenetic analysis and species diagnosis; ratio given in values multiplied by 100 (y-axis); characters states are indicated above and below horizontal line bisecting graph; species abbreviations (x-axis) defined in Table 1. 25 male copulatory bulb length to carapace length 26 number of male, leg I tibia retrolateral spines 27 number of male, leg I tibia prolateral spines.

Quantitative measurements are based on a minimum of five individuals of each sex when a sufficient number of specimens were available. When more than five specimens were available individuals were sampled from across the species’ geographical and size distribution (i.e., every attempt was made to select specimens that represented the range of sizes available in the collection). Species descriptions and material examined sections were generated using two simple Python scripts written specifically for generating homogenous species accounts [SPEEDM and MATex (Brewer and Bond (2012) available for download from the Dryad Data Repository at doi: 10.5061/dryad.3b95n)]. Characters for the phylogenetic analysis were scored from the type specimens, with the exception of the quantitative characters, which were scored on the basis of multiple specimens. Outgroup taxa were scored using the euctenizid specimens listed in Bond and Opell (2002) and in Bond and Hedin (2006) as exemplars. Quantitative values were taken from each of these exemplar taxa.

Mating clasper and palpal line drawings were made for some specimens (when needed to further clarify spination patterns) with the aid of a dissecting scope equipped with a camera lucida. Line drawings were scanned as digital images and converted to vector drawing objects in Adobe Illustrator (Adobe Systems Inc.). Digital images of specimens were made using a Visionary Digital Imaging System (Visionary DigitalTM, Richmond, VA) where images were recorded at multiple focal planes and then assembled into a single focused image using the computer program Helicon Focus (Helicon Soft, Ltd., Ukraine). The female genital region was removed from the abdominal wall and tissues dissolved using trypsin; spermathecae were examined and photographed in the manner described above. Habitus illustrations were constructed from whole body images that were bisected, copied, and reflected in Adobe Photoshop (Adobe Systems, Inc.) to produce a roughly symmetrical image; the actual raw image on which the habitus illustration is based has been deposited in Morphbank and its record number noted in the figure legend (value in square [ ] brackets). For scanning electron microscopy, specimens were air-dried and sputter-coated with gold prior to viewing on an FEI Quanta 200 scanning electron microscope.

Evaluation of quantitative morphological characters for diagnosis and phylogenetic analyses

Quantitative morphological features that were determined to have discrete, non-overlapping ranges for individual subsets of species were scored as phylogenetic characters and were used as features for morphological diagnosis of species. The criterion that employs only non-overlapping features limits the number of quantitative features and character states available to our analysis; these non-overlapping characters were chosen from a much larger suite of morphological measurements, many of which lacked discrete non-overlapping ranges (but may have differed statistically). Coyle (e.g., 1994, 1995) has frequently used an analysis of variance method to delineate states of quantitative characters for mygalomorph phylogenetic analyses. Mean values that statistically differ are scored as discrete states, regardless of potentially overlapping ranges. This approach is not uncommon and a number of other authors have likewise proposed methods for scoring overlapping quantitative characters (e.g., Chappill 1989, Goldman 1988, Thiele 1993, Wiens 2001, Goloboff et al. 2006). The use of these quantitative data has received some “conceptual” scrutiny, both negative (Farris 1990) and positive (e.g., Goloboff et al. 2006; see Garcia-Cruz and Sosa 2006 for detailed assessment of various approaches). However, the utility of overlapping quantitative character states has not been adequately tested (but see Hendrixson and Bond 2009). For this reason and others, I am hesitant to use these data as such in this present study. However, acknowledge that the approach I have employed here is not without certain problems. For example, in the case of species represented by only a few specimens, additional collecting could add specimens whose features expand the range of some characters and possibly negate, or change the scoring of said characters.

Morphological characters scored

General morphological and spinning features

1. Thorax: flat = 0; sloping = 1 (see Bond and Beamer 2006; figs 1A, 1C).

2. Carapace pubescence: absent = 0; light = 1; heavy = 2 (Fig. 96).

3. Posterior edge of male carapace: aspinose = 0; with a distinct fringe of heavy spines and/or setae = 1 (Fig. 53).

4. Posterior thorax sclerotization: normal = 0; light = 1. See Bond and Opell (2002) for a detailed explanation of this character and its states.

5. AME and PME: subequal in diameter = 0; AME diameter greater = 1.

6. Eye tubercle: absent = 0; present, low = 1; present, high = 2.

7. Male thoracic groove: transverse = 0; recurved = 1; procurved = 2.

8. Sternal shape (Fig. 17): normal (STRw/STRl > 74.0) = 0; rounded and raised in the ventral plane = 1; long (STRw/STRl < 73.8) = 2.

9. Rastellum: on a distinct process = 0; consisting of large spines not on a process = 1.

10. Rastellar spines: normal = 0; enlarged = 1.

11. Rastellum retrolaterally offset spine (Fig. 189): absent = 0; present = 1.

12. Endite cuspules: restricted to medial posterior aspect = 0 (Fig. 256); widespread = 1.

13. Male labial cuspules: absent = 0; present = 1.

14. Male palpal endite cuspules: absent = 0; present = 1.

15. Labium shape (Fig. 18): wider than long/subquadrate (LBw/LBl > 42.5) = 0; very wide (LBw/LBl < 42.5).

16. Sternal sigilla: large = 0 (Fig. 188); small = 1 (Fig. 256).

17. Sternal sigilla: widely spaced = 0; closely spaced or contiguous = 1 (Fig. 188).

18. Carapace coloration: light = 0 (Figs 88–90); dark = 1 (Figs 79–81).

19. Abdominal color pattern: solid or with solid striping = 0; mottled striping = 1 (Fig. 80).

20. Abdomen coloration: light = 0 (Fig. 105); dark = 1 (Fig. 95).

21. Cheliceral dentition: single promarginal row of large teeth with retromarginal row of small denticles = 0; both margins with larger teeth = 1.

22. Pumpkiniform spigots (see Bond and Opell 2002): absent = 0; present = 1.

23. Spigot bases: with invaginations = 0; without invaginations = 1.

Male leg and microstructural characters

24. Tarsus IV length (Fig. 19): short (MA4/MF4 < 60.0) = 0; long (MA4/MF4 > 60) = 1.

25. Tarsus I pseudosegmentation (Fig. 279): absent = 0; present = 1.

26. Tarsus I: straight = 0; curved = 1 (Fig. 308).

27. Tarsus IV pseudosegmentation: absent = 0; present = 1.

28. Tarsus IV: straight = 0; curved = 1.

29. Tarsus I: stout (diameter equal to or greater than metatarsus) = 0; slender (diameter less than metatarsus) = 1.

30. Tarsus ventral spines: absent = 0; present = 1 (Fig. 311).

31. Leg I coloration: uniform = 0; distal 1/2 metatarsus and tarsus light in color = 1.

32. Tibia I length (Fig. 20): short (MTI/MFI < 79.53) = 0; long (MTI/MFI > 79.53).

33. Metatarsus I length (Fig. 21): short (MMI/MFI < 77.5) = 0; long (MMI/MFI > 77.5) = 1.

34. Tarsus I length (Fig. 22): short (MAI/MFI < 49.72) = 0; long (MAI/MFI > 49.72) = 1.

35. Tarsal scopulae: thin = 0; thick = 1.

36. Tarsal scopulae on leg IV: present = 0; absent = 1.

37. Bifid STCI basal tooth: absent = 0; present = 1.

Female leg and microstructural characters

38. Female tarsal scopulae: light = 0; dense = 1.

39. Metatarsus IV preening comb: absent = 0; present = 1 (Figs 45, 62).

40. Metatarsus III preening comb: absent = 0; present = 1.

Secondary sexual and genitalic characters

41. Palpal tibia (Fig. 23): stout (PTw/PTl > 50) = 0; slender (PTw/PTl < 50) = 1.

42. Palpal tibia (Fig. 24): short (PTl/Cl < 36) = 0; long (PTl/Cl > 36) = 1.

43. Palpal tibia spines: long and ventrally positioned = 0 (Fig. 71); short and retrolaterally positioned = 1 (Fig. 278).

44. Palpal tibia megaspines: present = 0 (Figs 341, 349); absent = 1.

45. Male tibia I ventral megaspine: absent = 0; present = 1.

46. Male metatarsus I mating apophysis: absent/non - distinct = 0 (Fig. 333); rectangular = 1 (Figs 149, 160); triangular = 2 (Fig. 192); triangular and hooked = 3 (Fig. 69).

47. Male metatarsus I mating apophysis spine: absent = 0; present = 1 (Fig. 160).

48. Male metatarsus I: straight = 0; anteverted when viewed in retrolateral aspect = 1 (Fig. 266).

49. Male metatarsus I proximal excavation: absent = 0 (Fig. 333); present = 1 (Fig. 107).

50. Embolus serration: absent = 0 (Figs 68, 72); present = 1 (Figs 49, 50, 277).

51. Embolus shape: single bend = 0 (Fig. 126); sigmoidal = 1 (Fig. 72).

52. Embolus: thin = 0 (Fig. 72); stout = 1 (Fig. 277).

53. Embolus shape: cylindrical = 0 (Fig. 72); dorsal - ventrally compressed = 1 (Fig. 277).

54. Sperm duct directly below bulb embolus junction: straight = 0; looped = 1.

55. Tip of embolus: normal, gradual taper = 0; tapers sharply into a very thin terminus = 1 (Fig. 335).

56. Male pedipalp distal prolateral tibial spine: absent = 0; present = 1 (Fig. 271).

57. Palpal bulb (Fig. 25): short (Bl/Cl < 17) = 0; long (Bl/Cl > 17) = 1.

58. Prolateral cymbial lobe: normal = 0; extended = 1.

60. Retrolateral, distal most aspect of cymbium forms a distinct process: no (normal) = 0; yes = 1 (Fig. 278).

61. Retrolateral cymbium spine row: absent = 0; present = 1 (Figs 246, 248).

62. Retrolateral distal tibial spines: absent = 0 (Fig. 165); present = 1 (Fig. 55).

63. Retrolateral distal tibial spines: absent = 0; short = 1 (Fig. 194); long = 2 (Fig. 123).

64. Retrolateral distal spines: absent = 0; arranged distally = 1 (Figs 73–75); offset behind distal margin = 2 (Fig. 167).

65. Retrolateral distal tibial spines: uniform, non-overlapping = 0 (Figs 73–75); uniform = 1 (Fig. 160); absent = 2.

66. Tibia I, 1 - 1 - 1 spination pattern: absent = 0; present = 1 (Fig. 70).

67. TSr (Fig. 26): few (TSr < 10) = 0; many (TSr > 10) = 1.

68. TSp (Fig. 27): few (TSp < 7) = 0; many (TSp > 7) = 1.

69. Spines on prolateral surface of male patella I: few (<7); many large spines (>7; Figs 139, 144).

70. Spermathecal lateral base: absent = 0; present = 1 (Figs 76–78).

71. Secondary spermathecal bulb: absent = 0; present = 1.

72. Median spermathecal stalk: short, approximately as long as wide = 0 (Fig. 76); long, much longer than wide = 1 (Fig. 202).

73. Median spermathecal bulb: large (exceeds diameter of median stalk) = 0 (Fig. 76); small (diameter of bulb and median stalk subequal) = 1 (Fig. 202).

74. Median spermathecal stalk: straight = 0 (Fig. 76); sinuous = 1 (Fig. 203).

Morphological and molecular character matrix construction and phylogenetic analyses

Phylogenetic analyses of Aptostichus relationships were conducted using molecular and morphological data sets employing parsimony, Bayesian, and likelihood optimality criteria. Molecular data sets analyzed include data drawn from previous smaller studies (Bond et al. 2001, Bond and Stockman 2008, Bailey et al. 2010) and from newly collected data. Handling of tissues, DNA preparation, and sequencing followed procedures outlined in Bond and Stockman (2008). Legs were removed from specimens and preserved in RNAlater (Qiagen, Valencia, CA) and stored at −80C; whole specimens were preserved for morphological studies in 80% ethanol. Genomic DNA was extracted using the Qiagen DNeasy Tissue Kit. Standard PCR protocols were used to amplify an approximately 1500–base pair region of the mitochondrial genome spanning the region coding for the 12S rRNA, val-tRNA, and 16S rRNA genes. Amplification products were produced using the primers LR-J-12887 CCGCTCTGAACTCAGATCACGT and SR-N-14612spid AAGACAAGGATTAGATACCCT. After agarose gel verification and purification using ExoSAP-IT (USB, Cleveland, Ohio), products were sequenced on an ABI 3130 automated sequencer (Applied Biosystems, Foster City, CA) directly using the PCR primers and an additional internal sequencing primer (LR-J-13XXXa GGCAAATGATTATGCTACC). Sequence data were edited using the computer program Sequencher (Genecodes, Madison, WI) and then aligned using the software package Muscle (Edgar 2004) with default opening and gap extension penalties; minor adjustments to the alignment were made manually using the computer program Mesquite (Maddison and Maddison 2010). Molecular analyses primarily focused on identification of specimens, particularly juveniles, to species by phylogenetic association; that is, evidence of common ancestry with specimens identified by other means (e.g., morphological or cohesion species criteria). Given the paucity of species for which molecular data were available (less than half), it would be unwise to infer intra-generic relationships among species from these analyses.

Phylogenetic analyses of the molecular data comprised Bayesian and likelihood analyses. For Bayesian analyses the appropriate model of DNA substitution for each of the mtDNA data partitions was chosen using the computer program Kakusan 3 (Tanabe 2007) by Bayesian Information Criterion (BIC). MrBayes ver. 3.1.2 (Ronquist and Huelsenbeck 2003, Huelsenbeck and Ronquist 2001) was used to implement a Bayesian inference of phylogeny using the substitutions models indicated by BIC. Analyses comprised four concurrent Markov Chain Monte Carlo (MCMC) chains run for 40, 000, 000 generations with trees saved every 1, 000 generations. The two independent runs were considered to have converged when the standard deviation of split frequencies value was < 0.01. Topologies were discarded as burn-in following visual inspection in the program Tracer (Rambaut and Drummond 2007); clade posterior probabilities were computed from the remaining trees. The reported likelihood score and post burn-in tree topology was computed using the sump and sumtcommand with the option contype=allcompat, respectively. Likelihood analyses were conducted using the computer program RAxML ver. 7.2.8 (Stamatakis 2006). Parameters employed in the analysis included 1000 random addition sequence replicates with the general time reversible model and gamma model of site heterogeneity (-m = GTRGAMMA, -# = 1000). Branch support values were computed via 1000 non-parametric bootstrap replicates. Bootstrap bipartitions were drawn onto the best tree topology obtained in the previous analysis.

Phylogenetic analyses of the morphological data set were performed using PAUP* version 4.0b10 (Swofford 2002). All binary characters were treated as reversible, multistate characters and were treated as unordered, and all characters were initially weighted equally. Heuristic searches were performed using random stepwise addition (1000 replicates) of taxa followed by TBR (tree bisection-reconnection) branch swapping held to one million rearrangements per replicate. Branches with a maximum length of zero were collapsed. The preferred tree topology (presented herein) is based on the search conducted in PAUP* using the “Goloboff Fit Criterion” (Goloboff 1993a, b, c, 1995) with the search parameters described above. Solutions using an array of concavity function constants (k= 3-12) were explored.

For the purposes of evaluating the evolution of habitat type, species were scored for seven habitat type character states: (0) mixed forest and coastal range; (1) chaparral; (2) alpine meadow; (3) desert; (4) coastal dune; (5) mixed redwood; (6) dry steppe. Character scorings were based on personal observations and ecoregion types assessed in the computer program ArcGIS (ESRI, Redlands, CA) using the 2007 EcoRegionsCalifornia07_3 GIS data set (Cleland et al. 2007) downloaded from http://www.fs.fed.us/r5/rsl/projects/gis/data/calcovs/EcoregionsCalifornia07_3.html . Taxa found in multiple habitat types were scored as polymorphic. Character state reconstructions using parsimony were evaluated on the preferred tree topology (Fig. 29) using the computer program MacClade ver. 4.05 (Maddison and Maddison 2000).

Figure 28.

Summary tree based on an analysis of 337 individuals scored for the 12S-tRNA valine-16S mtDNA gene region comprising 1618 base pairs. Solid dots on internal branches denote strong posterior probability (PP) and bootstrap support (BS); half-shaded dots are nodes with bootstrap values < 74%.

Figure 29.

Preferred tree topology based on the analysis of 72 morphological characters employing implied weights (k = 7). The inferred tree recovers four monophyletic species groups: Atomarius, Hesperus, Simus, and Sierra clades. Inset figures illustrate exemplar mating clasper and pedipalp morphologies for each of the four major clades.

Locality data, georeferencing, generation of niche-based distribution models, and conservation status

Latitude and longitude for all collecting localities were recorded in the field using a Garmin® Global Positioning System receiver (Garmin International Ltd., Olathe, KS) using WGS84 map datum. For previously collected specimens (e.g., loaned museum specimens) locality data were georeferenced by hand by finding the approximate locality on United States Geological Survey topographic maps (NAD83 map datum) or Google Earth (WGS84 datum). All georeferenced and field recorded locality data (latitude, longitude, elevation) were crosschecked by hand in Google Earth prior to generating distribution map illustrations and database entry. Distribution maps were constructed using ArcGIS using NAD83 map datum. Because many older collecting labels lack sufficient locality information, many georeferenced values are imprecise and should be used with caution. Data for labels that document only county and/or town information were georeferenced to the approximate geographic center of the locality given. Precision for each georeferenced point is annotated as a superscript in each material examined section of the species’ taxonomy using the confidence value scheme employed by Murphey et al. (2004): 1 = exact coordinates given; 2 = amended exact coordinates (i.e., exact coordinates given but were emended on validation); 3 = public land survey system (or herein geographic place name); 4 = within 1km radius; 5 = within 5km radius; 6 = within 10km radius; 7 = to county or > 10km; 8 = to state; 9 = to project region. Latitude and longitude are recorded to the 4th decimal place as an indication of the precision in the point assigned by us (i.e., where I have assigned the locality place-holder for the specimen in question), not precision in the recording of the value or to specify the exact point of collection. Actual precision of the record is to be inferred from the numbering system described above. Detailed locality and associated GIS data as supplemental data files in spreadsheet and KML file format can be downloaded online from the Dryad Data Repository at doi: 10.5061/dryad.3b95n.

As an approach to facilitating species discovery and determination, niche-based distribution models (DM’s) were constructed for species for which sufficient locality data were available (> 5 points). Niche-based DM’s provide estimates for the probability of finding a species at a location on the landscape given the set of correlate ecological and climatic parameters used to construct the model. Locality coordinates for each specimen were imported into ArcMap (ESRI, Redlands, CA) and converted into shape files. Following the procedure outlined in Bond and Stockman (2008), DM’s were constructed using environmental layers thought to “likely influence the suitability of the environment” (Phillips et al. 2006) based on our previous analyses of Aptostichus atomarius species complex distributions (see Stockman and Bond 2007, for further justification of layer choice). Seven climatic layers were obtained from the WORLDCLIM data set (Hijmans et al. 2005): annual precipitation, precipitation seasonality, annual maximum temperature, annual minimum temperature, temperature seasonality, and mean precipitation during the driest and wettest quarters. A seventh layer, elevation, was constructed from a mosaic of Digital Elevation Models (DEMs) derived from the National Elevation Dataset (USGS). DEMs were converted to Raster format in ArcMap and resampled from 30-m resolution to 1-km resolution using bilinear interpolation. All seven layers were clipped to the same extent, cell size, and projection. Niche-based (DMs) were created using the computer program Maxent (Phillips et al. 2006). Maxent employs a maximum likelihood method that estimates a species’ distribution that has maximum entropy subject to the constraint that the environmental variables for the predicted distribution must match the empirical average (Elith et al. 2006; Phillips et al. 2006). Parameters for all Maxent analyses used the default values: convergence threshold = 10−5, maximum iterations = 500, regularization multiplier = 1, and auto features selected. Additional larger values of the regularization multiplier were used to ensure that models were not overfitting the data.

A hypothesized conservation status of all species has been included with each description. I have used the NatureServe ranking scheme–secure, apparently secure, vulnerable, imperiled, critically imperiled, and extinct–to describe perceived status. The designations provided are not based on any formal calculations (see Faber-Langendoen et al. 2009 for explicit criteria) and thus should not be viewed as formal status declarations. Many Aptostichus species are rare in collections and very difficult to collect, consequently parameters like rarity and abundance are impossible to accurately assess at this time. As such, I have based conservation status designations on extent of distribution and apparent threats to habitat (e.g., is the species known only from a highly impacted area?); a brief rationale is provided with each determination. These designations are likely to be very conservative and may belie the imperiled nature of some species. Future studies will seek to formally evaluate conservation status.

Species delimitation and conceptualization

Although often not discussed, any taxonomic revision contains an implicit concept of a species. The general convention within spider taxonomy is a “diagnosable” species concept (Nelson and Platnick 1981, Nixon and Wheeler 1990) wherein populations are delineated as species as a consequence of sharing a set of qualitative, fixed differences. For the vast majority of spider species described these differences are essentially morphological, usually features related to differences in genitalia (male pedipalps, female spermathecae). Alternatively, one could simply think of this as a “morphological” species construct–if populations differ in a set of morphological characters they are delimited as separate species.

As discussed in number of papers related to species delineation in mygalomorph taxa, morphological stasis seems to be more the rule rather than the exception. That is, the prevailing hypothesis is that extreme geographic structuring due to limited dispersal capability may lead to speciation in the absence of morphological or apparent ecological divergence (Bond et al. 2001). As such a number of studies (e.g., Stockman and Bond 2007, Bond and Stockman 2008, Bailey et al. 2010) advocate that an integrative approach to mygalomorph spider species delimitation must be employed if an accurate representation of evolutionary diversity is to be achieved.

Ideally an integrative approach to species delimitation would use data from many sources (e.g., genetic, ecological, and traditional morphological) taken together to formulate species hypotheses. Such an approach serves to more thoroughly document evolutionary diversity whereas an approach that focuses on a single character system (e.g., genitalic features) may overlook species diversity but is easier to implement and is pragmatic both in terms of species documentation and discovery, and subsequent identification by non-specialists. Reflected in the amount of data available for any given set of specimens/populations, the species reported herein generally represent one of three construct classes–morphological, or traditionally delineated species, phylogenetic species, or “cohesion species”. Traditional morphologically delineated species are defined as those populations that represent qualitative differences in phenotype that differ in a discrete manner from other populations groups. Cohesion species follow Templeton’s (1989) concept wherein a species is defined as lineages that are genetically or demographically interchangeable. Cohesion species are those for which genetic and or ecological data has been considered in concert with the distribution of species (see Bond and Stockman 2008) and morphological characteristics. Each species’ account notes the species concept that has been applied. In a number of instances additional phylogenetic information, based on molecular analyses was available and considered as corroborative support for the species hypothesis being put forth. As such I have applied a phylogenetic species concept wherein individuals (populations) share common ancestry in a molecular phylogenetic analysis and thus are mutually exclusive and diagnosably distinct (Cracraft 1989). Operationally, I simply employ the phylogenetic information from this single gene analysis as corrabotive support for hypothesized morphological species when they are recovered as a clade on the gene tree; that is, these data are not necessarily used exclusively to delineate species.

Data resources

The data underpinning the analysis reported in this paper (see below) were deposited on 19 November 2012 in the Dryad Data Repository at doi: 10.5061/dryad.3b95n and at GBIF, the Global Biodiversity Information Facility, http://ipt.pensoft.net/ipt/resource.do?r=aptostichus_locality_data . Images associated with species descriptions have been deposited in Morphbank (http://www.morphbank.net ); Morphbank image record numbers are noted in brackets by each figure in the figure legend.

Results and discussion
Summary of taxodiversity

At present the genus Aptostichus comprises 40 species, 33 of which are newly recognized herein. Table 1 summarizes species, type localities, and material available for each species described; >2000 specimens in total were examined. Of these 33 new species, 12 are known only from male specimens; of these, three are described on the basis of a single specimen. Such a sex-based disparity and lack of material for rare taxa has been noted in taxonomic revisions of other mygalomorph groups (e.g., the migid genus Moggridgea O. P. Cambridge, 1875; Griswold 1987) and is not uncommon in systematic works in general (Huber 2003, Lim et al. 2011). As already discussed the number of species will likely increase dramatically as more is learned about this group of spiders; molecular studies to date suggest that “morphological” species, particularly those that are widely distributed, likely disguise a great deal of evolutionary and ecological diversity. Moreover, some underestimation may in part be due to the lack of males collected for populations of unplaced female specimens.

Table 1.

Summary of Aptostichus species diversity. Columns summarize nominal species and conservation status (see footnote); three-letter identifier; US state and county of type locality; latitude and longitude of type locality; characterization of (sex of specimens) and amount of material available for examination.

Species id State: Co. Lat/Long Material
Aptostichus atomarius ato CA: San Bernardino 34.1774, -117.2736 >10; ♂♀
Aptostichus stephencolberti ste CA: San Mateo 37.2659, -122.4121 >10; ♂♀
Aptostichus angelinajolieae ang CA: Monterey 36.29045, -121.4659 >10; ♂♀
Aptostichus miwok miw CA: Humboldt 41.01333, -124.1092 >10; ♂♀
Aptostichus stanfordianus sta CA: San Mateo 37.4845, -122.3992 >10; ♂♀
Aptostichus dantrippi§ dan CA: Kern 35.3947, -119.0313 >10; ♂♀
Aptostichus pennjillettei pen NV: Clark 37.0890, -116.0618 >10; ♂
Aptostichus asmodaeus asm CA: Contra Costa 37.8530, -121.9291 8; ♂♀
Aptostichus nateevansi nat CA: Los Angeles 33.3707, -118.3496 7; ♂♀
Aptostichus chiricahua chi AZ: Cochise 31.9136, -109.1408 1♂
Aptostichus icenoglei ice AZ: Riverside 33.7149, -117.0922 >10; ♂♀
Aptostichus cabrillo§ cab CA: San Diego 32.6681, -117.2423 >10; ♂♀
Aptostichus isabellaµ isa CA: Kern 35.5689, -118.4383 1♂
Aptostichus muiriµ mui CA: Mariposa 37.4668, -119.9384 1♂, 1♀
Aptostichus barackobamai§ bar CA: Mendocino 40.3167, -122.3499 >10; ♂♀
Aptostichus hesperus hes CA: Los Angeles 34.0968, -117.7195 >10; ♂♀
Aptostichus hedinorum hed CA: San Diego 32.7104, -116.1170 >10; ♂♀
Aptostichus cahuilla cah CA: Riverside 33.7149, -117.0922 >10; ♂♀
Aptostichus killerdana kil CA: Orange 33.4819, -117.7206 1♂; 4♀
Aptostichus serrano ser CA: Riverside 33.9102, -115.9931 >10; ♂♀
Aptostichus aguacaliente agu CA: Riverside 33.8964, -116.6251 >10; ♂♀
Aptostichus chemehuevi che CA: San Bernardino 34.7465, -116.3755 >10♂
Aptostichus sarlacc sar CA: San Bernardino 35.7553, -117.5006 2♂
Aptostichus derhamgiulianii der CA: Inyo 37.3333, -118.0167 3♂
Aptostichus mikeradtkei mik CA: San Diego 32.64195, -117.03608 >10; ♂♀
Aptostichus edwardabbeyi§‡ edw AZ: Cochise 32.0044, -109.3561 2♂; 1♀
Aptostichus anzaborrego anz CA: San Diego 32.86852, -116.23807 2♂
Aptostichus sinnombre sin CA: San Diego 32.86923, -116.23740 2♂
Aptostichus simus§‡ sim CA: San Diego 32.6346, -117.1400 >10; ♂♀
Aptostichus satleriµ sat CA: Kern 35.5689, -118.4383 4♂
Aptostichus elisabethae§‡ eli CA: San Bernardino 34.7465, -116.3755 >10; ♂♀
Aptostichus fornax for CA: Inyo 36.09167, -117.2591 1♂, 1♀
Aptostichus lucerne luc CA: San Bernardino 34.47221, -117.122 2♂
Aptostichus bonoi bon CA: San Bernardino 34.0401, -116.3102 1♂, 1♀
Aptostichus fisheri fis CA: Kern 35.39752, -117.99797 3♂
Aptostichus cajalco caj CA: Riverside 33.8256, -117.4957 >10; ♂♀
Aptostichus sierra sie CA: Fresno 37.1129, -119.3095 1♂
Aptostichus huntington hun CA: Fresno 37.2379, -119.2295 3♂
Aptostichus dorothealangeae§‡ dor CA: Kern 35.3947, -119.0313 >10; ♂♀
Aptostichus chavezi cha CA: Tulare 36.488, -118.837 >10; ♂♀

Conservation status: secure √; vulnerable §; imperiled ‡; vulnerable/imperiled §‡; presumed to be extinct †; undertermined µ.

The genus Aptostichus has diversified within an extensive area that spans the California Floristic Province. Species are found in virtually every habitat type (see discussion of ecological evolution below) including extreme arid desert environments, mesic montane and coastal habitats, to high elevation alpine habitats of the Sierra Nevada Mountains. Without question the genus represents a classical adaptive radiation where lineages have diversified and apparently adapted to inhabit a set of disparate environments, climates, and habitat types. Ecological factors that may influence Aptostichus diversity and distributions include climatic suitability during dispersal, prey type and availability, water and temperature, and soil type (to name a few). Given their close ties to the substrate, as fossorial organisms, parameters associated with burrow architecture and design (depth, thickness of silk lining, trap door design, etc.), it is not surprising that many of these features vary from species to species.

Understanding of Aptostichus ecology and behavior is severely limited at this time. To date approximately 15 of the 40 species have been collected only from pitfall traps thus female burrows have never been observed. Of these about half are known from only a few specimens and thus are quite rare in collections. Moreover, some species like Aptostichus derhamgiulianii and Aptostichus sierra have not been collected since they were first discovered over 40 years ago and at least two species are now presumed extinct (Aptostichus killerdana, Aptostichus lucerne). Alternatively, recent collecting efforts have uncovered a number of new morphologically distinct species (e.g., Aptostichus satleri, Aptostichus isabella, Aptostichus cajalco). Given how narrowly endemic many species are there is likely to be considerable diversity that both awaits discovery but is also threatened due to development and habitat destruction throughout the California Floristic Province biodiversity hotspot.

Aptostichus phylogeny

Figure 28 summarizes the maximum likelihood and Bayesian inference analyses of the mtDNA data set. The data set comprises 337 individual specimens representing 15 of the 40 species documented herein, sequenced for the mitochondrial region spanning the 16S-tRNA-valine-12S genes; of these 206 were newly generated sequences (GenBank Accession numbers: JX103235-JX103440). The matrix is an aligned 1618 base pairs; Kakusan chose the GTRGAMMA model for each of the three partitions. The –ln likelihood value for the best tree from the RAxML analysis is -59821.7255. The Bayesian analysis was run for 40, 000, 000 generations with half of the trees discarded as burnin. The harmonic and arithmetic means of the post-burnin tree topology likelihoods were -60532.81 and -60373.61, respectively. The summary tree (Fig. 28) supports the basal placement of Aptostichus simus, the monophyly of the Atomarius Sibling Species Complex, and general placement of other species into species groups delineated on the basis of the morphological analysis (see below). However, as discussed earlier these data were used principally to place undetermined individuals into species rather than formulate hypotheses of deeper relationships across the tree; that is, many of the internal nodes are not strongly supported. Using the results from this analysis in combination with specimens, particularly males that could be identified to species, many female and juvenile Aptostichus atomarius, Aptostichus stanfordianus, Aptostichus angelinajolieae, Aptostichus icenoglei, and Aptostichus barackobamai specimens were determined. This analysis indicates that Aptostichus stanfordianus likely comprises more than one species (previously noted by Bond and Stockman 2008) and that specimens collected from Madera County may be an undescribed species related the Aptostichus simus (A. sp. Madera, Fig. 28). However, mature males and females are not currently available and thus the status of these specimens remains unanswered.

The morphological matrix comprised 72 characters scored for all 40 Aptostichus species. Figures 17–27 summarize the quantitative character scorings for all taxa but Aptostichus satleri, Aptostichus isabella, and Aptostichus sinnombre. Table 2 summarizes the results for the parsimony analysis based on characters equally weighted (EW) and the implied weighting analyses (IW) using a range of concavity function constants (k=3-12). The EW analysis resulted in > 440, 000 trees comprising 238 steps whereas the implied weights analyses resulted in considerably fewer trees with tree lengths ranging from 238–241 steps.

Table 2.

Summary of results from phylogenetic analyses of the morphological data set scored for all 40 Aptostichus and six outgroup taxa. Table summarizes the number of trees, steps, consistency (CI) and retention indices (RI) and Goloboff fit (Gfit) values recovered from parsimony analyses employing equal weights (wts.) and the Goloboff fit criterion (with array of concavity function constants).

Analysis # trees Steps CI RI Gfit
Equal wts. 446684 238 0.353 0.764 ---------
k=3 17222 241 0.349 0.760 -52.564
k=4 17210 241 0.349 0.760 -55.071
k=5 17168 241 0.349 0.760 -57.007
k=6 453 239 0.351 0.763 -58.562
k=7 824 239 0.351 0.763 -59.836
k=8 493 239 0.351 0.763 -60.898
k=9 294 239 0.351 0.763 -61.798
k=10 296 238 0.353 0.764 -62.574
k=11 245 238 0.353 0.764 -63.248
k=12 228 238 0.353 0.764 -63.839

The preferred tree topology is based on the analysis using IW with a concavity function constant of k=7 (Fig. 29). The EW and IW analyses were moderately incongruent with respect to the tree topologies. The EW analysis failed to recover an Aptostichus clade that was monophyletic with respect to Apomastus. A strict consensus of the >440, 000 resulted in a largely unresolved tree (towards the tips) that recovered the Sierra, Simus, and Hesperus clades, or species groups (Fig. 29); the Atomarius clade was paraphyletic with respect to the Hesperus clade. Implied weighting analyses that employed concavity function constants k=3-5 resulted in trees that recovered a monophyletic Aptostichus, Sierra, Simus, and Hesperus clades but like the EW analysis the Atomarius clade was paraphyletic. Tree topology stabilized for IW analyses where k=6-12 recovering a pattern similar to that illustrated in Figure 29 where all four major species groups are monophyletic. These clades are largely delineated on the basis of shared male mating clasper and pedipalp differences (illustrated for each species group in Fig. 29).

Both molecular and morphological data matrices and associated trees (all trees recovered and consensus), formatted as Nexus and Phylip files can be downloaded from the Dryad Data Repository at doi: 10.5061/dryad.3b95n..

Character support of major clades and Aptostichus species groups

Table 3 summarizes the unambiguous character state support for each of the major nodes in the preferred tree topology (Fig. 29). I summarize below the support for only the major nodes in the analysis and formally diagnose the four nominal Aptostichus species groups. At this time it would be premature to overemphasize resolution among all of the terminal relationships within Aptostichus because of the incomplete nature of the data set due to missing taxa and few female representatives of some species.

Table 3.

List of unambiguous character state changes for major clades recovered in the preferred tree topology using implied weights (k=7).

Clades Characters and state changes
Aptostichus monophyly 19: 0→1; 31: 0→1; 58: 0→1; 59: 0→1
Simus + Sierra 42: 1→0; 51: 1→0
Sierra 8: 0→2; 33: 0→1;
Simus 14: 1→0; 41: 1→0; 43: 0→1; 52: 0→1; 53: 0→1; 60: 0→1
Atomarius + Hesperus 48: 0→1; 57: 0→1; 62: 0→1; 63: 0→2; 64: 0→1; 65: 2→0
Atomarius 2: 1→2; 38: 0→1; 71: 0→1
Hesperus 11: 0→1; 18: 1→0; 20: 1→0; 72: 0→1; 74: 0→1

Four characters (given parenthetically following the description of the state) provide unambiguous support for the monophyly of Aptostichus: a mottled, striped abdominal color pattern (19), distal 1/2 of the male metatarsus I lighter in color (31), extended prolateral cymbial lobe (58), and a cymbium with spines (59). Two characters support the monophyly of the clade that comprises the Sierra and Simus species groups: a short male palpal tibia (42), and an embolus with a single distinct bend (51). Six synapomorphies support the node that unites the Hesperus and Atomarius species groups: a anteverted male metatarsus I (48), a long palpal bulb (57), the presence of a male retrolateral distal tibial spine (62), long male retrolateral distal tibial spines (63), a triangular male mating apophysis (64), and uniform, non-overlapping male retrolateral distal tibial spines (65).

Sierra Species Group.Four species comprise the Sierra species group, which is supported by two synapomorphies: long sternum (8) and a long male metatarsus I (33).

Sierra Species Group.Eight species comprise the Simus species group, the monophyly of which is supported by six synapomorphies: absence of cuspules on male endites (14), male palpal tibia stout (41), male palpal tibia spines short and positioned retrolaterally (43), stout embolus that is dorsal - ventrally compressed (52, 53), and retrolateral, distal most aspect of the cymbium formed as a distinct process (61).

Hesperus Species Group.Thirteen species comprise this diverse species group. The key distinguishing feature of this group is the presence of an offset retrolateral rastellar spine (character 11). Additionally, four other characters support the monophyly of this species group: lighter carapace and abdominal coloration (18, 20) and a long and sinuous spermathecal stalk (72, 74).

Atomarius Species Group.Fifteen species comprise the Atomarius species group, the monophyly of which is supported weakly by three synapomorphies: heavy carapace pubescence (2), dense female tarsal scopulae (38) and a distinct secondary spermathecal bulb (71).

Desert adaptation in Aptostichus

Aptostichus is an ideal group for evaluating changes in spider morphology and behaviors associated with invasions of arid, desert and other habitat types (e.g., coastal dunes). Figure 30 maps habitat type on the preferred tree topology (Fig. 29) using parsimony; alternative optimization criteria were not possible due to the polytomies in the preferred tree. The current phylogeny requires at least three independent derivations of strictly desert habitation for 15 species occurring in three of the four species groups. Additional independent derivations of arid habitat are required if chaparral is classified similarly to desert habitats (i.e., all arid habitats are grouped together).

Figure 30.

Optimization of habitat type on preferred tree topology (morphology, implied weighting, k=7).

Main (1978) suggested eight adaptations that may allow trapdoor spiders to survive in very arid habitats: 1) larger body size, 2) deeper burrows, 3) increasing foraging area achieved by burrow rim modifications, 4) differential timing of breeding and dispersal, 5) the tendency of brooding females to plug their burrows, presumably for water retention, 6) aestivation of young in sealed burrows, 7) mature non-brooding females that do not plug burrows and are therefore able to feed sporadically, and 8) increased longevity of females. Concentrated efforts to obtain female specimens and additional natural history data will be required to address these questions more thoroughly for this group. Moreover, a complete molecular phylogeny for the genus will likely go further to resolve relationships among the species and will help to abrogate any confounding issues that morphological characters and attendant homoplasy associated with habitat may have.

Type genus:

Eucteniza Ausserer, 1875

Subfamily Apomastinae Bond & Hedin, subfam. n.


Type genus.

Apomastus Bond & Opell, 2002


Defined as a euctenizid subfamily comprising the genera Myrmekiaphila, Apomastus, and Aptostichus in Bond et al. (2012b), the new designation, despite considerable phylogenetic support was dismissed as a nomen nudum in an online catalog (Platnick 2012) due to the absence of a formal diagnosis. To correct this oversight, I formally diagnose below the newsubfamily Apomastinae and again provide a list of included genera. As was originally intended, authorship is to be attributed to Bond and Hedin.


Apomastinae, a lineage defined in extensive phylogenetic analyses that include multiple lines of evidence that comprises genes and morphology (Bond and Hedin 2006; Bond et al. 2012b) can be morphologically distinguished from all other euctenizids by having a patch of endite cuspules that is restricted to the proximal inner margin (Fig. 38; rather than being uniformly distributed across the endite face, see Stockman and Bond 2008, fig. 10) and by having two distinct posterior median spinneret spigot types (as opposed to a single type, Stockman and Bond 2008, fig. 24).

Figures 31–38.

Standard light microscopy views of female an Aptostichus simus specimen (MY3432). 31 side view 32 ventral view, sternum 33 dorsal view, carapace 34–35 eye group, dorsal and lateral views 36 leg I prolateral view 37 leg IV retrolateral view 38 palpal endite.

Included genera.

Myrmekiaphila Atkinson, 1886

Aptostichus Simon, 1891

Apomastus Bond and Opell, 2002

Genus Aptostichus Simon, 1891



Figs 31–68, Map 1
Aptostichus Simon, 1891: 317 (type species by monotypy Aptostichus atomarius female lectotype from CA, San Bernardino; specimen AR4263 in MNHP, examined).–E. Simon 1892: 108.–E. Simon 1903: 901.–P. Smith 1908: 220–221–Bond & Opell 2002.
Actinoxia Simon, 1891: 318 (type species by monotypy Actinoxia versicolor Simon juvenile holotype in MNHP, examined).–E. Simon 1892: 109. P. Smith 1908: 214 (Smith considered Actinoxia to be a junior synonym of Entychides Simon).–R. Chamberlin 1937: 9.–Synonymized by Bond & Opell 2002: 518.
Nemesoides Chamberlin, 1919: 1–2 (Nemesoides hespera Chamberlin female holotype in MCZ, examined).–Synonymized by Bond & Opell 2002: 518.

Males of this genus can be recognized by the presence of three or more spines on the distal most surface of the palpal cymbium (Figs 49, 56, 68) and a number of large, very thick spines on the distal-prolateral aspect of tibia I (Figs 48, 55). Tibia I spines are more offset proximally in the Simus and Sierra group species (Fig. 55). Entychides males have similar spination, however their spines are borne on a low apophysis whereas those of Aptostichus are not (Bond and Opell 2002). Aptostichus females have cuspules on both the labium and palpal endites; labial cuspules are generally few and/or restricted to the inner margins of the endites (Figs 38, 39). This condition is similar to that for Apomastus, however Apomastus species appear to lack labial cuspules and the distinctive Aptostichus abdominal coloration, which consists of a mottled chevron pattern (Fig. 51).

General description.

Small to medium sized trapdoor spiders. Cephalothorax longer than wide, sloping posteriorly, moderate pubescence in most species (Figs 31, 54). Carapace sclerotization equal across its length. Thoracic groove intermediate to wide, procurved or straight (Fig. 33) and deep. In some males the thoracic groove is transverse or recurved (Fig. 51). Carapace of males fringed in stout black setae (Fig. 53). Eyes on a low tubercle (Fig. 35). AME and PME subequal diameter, except in a few species, particularly in some Simus group species where the PME diameter is noticeably less than that of AME. PME row slightly procurved or straight, AME row slightly recurved (Fig. 34). Caput moderately high (Fig. 31). Carapace of ethanol preserved specimens appears orangish-yellow. The coloration of living spiders tends to be a darker brown, however there is considerable variation in the intensity of coloration. Male coloration in most specimens is dark reddish-brown. Female and male abdominal coloration very distinctive consisting of light brown or gray background with a dark mottled chevron like pattern (Fig. 51). This pattern is less distinctive in Aptostichus simus, closely related species and is reduced in most desert-adapted species.

Sternum wider posteriorly, sometimes wider than in other euctenizids, tapering anteriorly (Figs 32, 52). Posterior sigilla large and positioned mid-posteriorly in most species (Fig. 32), in some species contiguous (e.g., Aptostichus hesperus). Anterior margin of sigilla has a rounded margin. Palpal endites longer than wide often with only a few cuspules, which are restricted to the posterior margin, except in Aptostichus simus that has many cuspules arranged in a characteristic pattern (Figs 38–39). Labium wider than long, with a few, to a moderate number of cuspules (Fig. 32). Chelicerae dark brown. Rastellum consists of numerous spines not borne on a distinctive mound (Fig. 57). Fangs long and slender. Cheliceral furrow promargin with row of very large teeth. Retromarginal row consists of a patch of denticles.

Apical PLS article short, digitiform (Fig. 64). Spinnerets mostly with pumpkiniform spigots with several articulated spigots interspersed on apical and median articles of PLS and the PMS (Fig. 65). Two to three large, articulated spigots on apical most aspect of the PLS. PMS article robust. See Bond and Opell (2002) for more detailed descriptions of these spigot types.

Anterior leg articles slender relative to posterior. Tarsi short and robust (Fig. 36). Female scopulae long, dense, asymmetrical, extending full length of tarsus, no further than the metatarsus (Figs 36, 44, 60). Scopulae extend no further than the tarsus of the pedipalp. Posterior legs lack distinct scopulae. Pedipalp claw with a few (Fig. 40) to many teeth (Fig. 58). Male tarsi I and II with short sparse scopulae that are restricted to the ventral surface. In some species male tarsi are slightly bent, elongate and pseudosegmented (e.g., Aptostichus simus). Basal palpal tooth and STC I–IV basal tooth elongate and positioned on the median keel but not bifid (Figs 41, 59, 61). STC IV with 5 or more teeth (Fig. 61). Female anterior legs with very few ventral spines (Fig. 36). Prolateral surface of female patella III covered in numerous thick spines. Distal ventral aspect of tarsus IV with short, sparse spine patch. Preening combs on distal most retrolateral surface of metatarsus IV (Figs 37, 45, 62). Tarsal trichobothria arranged in a zigzag pattern with typical base (Fig. 43); low tarsal organ with central pit (Figs 42, 63). Spermathecae with an elongate base that forms a secondary spermathecal bulb in some species (Figs 46, 47, 66, 67).

Male mating clasper morphology is distinctive. Articles of leg I bear a number of large, thickened spines positioned retrolaterally on the distal aspect of the tibia (Fig. 55), except members of the Sierra and Simus species groups whose tibial spines are more concentrated proximally (Fig. 55). In most species, metatarsus I with proximal ventral to prolateral excavation bordered distally by a low mound (Fig. 55). Tibia I with 3-5 elongate spines distributed retrolaterally except in some species which have denser spine patches. Palpal cymbium with four or more dorsal spines (Figs 49, 56, 68). Palpal bulb normal (Fig. 68), embolus of some Simus group species with serrations (Fig. 50). Palpal femur short with a dorsal row of thin spines, tibia short and robust in some species (e.g., Aptostichus simus) there is a distinctive prolateral spine patch on the palpal tibia.

Figures 39–50.

Scanning electron micrographs of Aptostichus simus specimens (female AP097, 39–47; male AP819, 48–50). 39 palpal endite, arrow indicates cuspule pattern 40 left pedipalp claw, retrolateral aspect 41 leg I, tarsal claws, retrolateral aspect 42 leg I, tarsus, dorsal aspect, tarsal organ (arrow) 43 leg I, tarsus, dorsal aspect, trichobothrial base (arrow) 44 leg I, tarsal scopulae 45 leg IV, ventral junction of tarsus and metatarsus, preening comb 46, 47 cleared spermathecae and close up of left spermathecal lobe 48 leg I, retrolateral distal aspect of tibia 49 pedipalp, ventral aspect 50 serrated edge of palpal embolus.

Figures 51–56.

Standard light microscopy views of Aptostichus atomarius male specimens (51–54 MY2979; 55, 56 AP357). 51 dorsal habitus view 52 ventral habitus view 53 carapace 54 lateral habitus view 55 leg I, retrolateral aspect 56 pedipalp, retrolateral aspect.

Figures 57–68.

Scanning electron micrographs of Aptostichus atomarius specimens (female MY3432, 57–67; male MY2979 68). 57 left chelicerae, anterior ventral aspect 58 left pedipalp claw, retrolateral aspect 59 leg I, tarsal claw, retrolateral aspect 60 tarsal scopulae, leg I 61 leg IV tarsal claws, retrolateral aspect 62 leg IV preening comb, tarsus/metatarsus junction 63 leg I, tarsus, dorsal aspect, tarsal organ 64 spinnerets 65 spinning field, distal aspect of PLS 66, 67 cleared spermathecae and close-up of left lobe 68 pedipalp, retrolateral aspect, arrow indicates position of spines on cymbium.


Distributed primarily throughout the California Floristic Province with the greatest number of species known from Southern California; a few species are recorded from Nevada and Arizona (Table 1, Map 1).

Map 1.

Distribution of type localities for all known species of Aptostichus. Three letter identifiers are defined in Table 1; inset shows approximate scope of study area.

Key to species groups and to males

Note. Like many mygalomorph taxa, species identification is a non-trivial task. These spiders generally lack distinctive somatic differences that render development of a key to females virtually impossible and a key to males difficult at best. Although, I have attempted to provide a key to male specimens, I would caution that it is far from perfect and thus suggest that the key be used in conjunction with careful examination of specimens, the species description, knowledge of from where the specimen was collected (many species are narrowly endemic), and molecular characters (if available). Generally speaking no single characteristic should be taken as definitive evidence of a species’ determination. Because species placed in the Atomarius Sibling Species Complex have been delineated on the basis of a combination of biogeographic, general somatic, ecological, and molecular characteristics, the provided key to these taxa relies heavily on data taken from the geographic location and habitat from which the specimen was collected.

1 Mid - ventral apophysis of metatarsus I triangular (Fig. 69), knob-like (Fig. 128), or absent (Fig. 333) 4
Mid - ventral apophysis of metatarsus I rectangular (Fig. 147) Atomarius species group, in part- 2
2 Tibia I retrolateral spine(s) arranged along the distal most retrolateral aspect of the article (Fig. 147) 3
Tibia I retrolateral spines slightly behind (proximal) the distal most aspect of the article (Fig. 165) Aptostichus isabella
3 TSrd > 4 Aptostichus cabrillo
TSrd≤ 3 Aptostichus icenoglei
4 Tibia I spines arranged along the distal most retrolateral aspect of the article, and/or with prolateral spines arranged in one or two rows along the prolateral surface of tibia I (Fig. 69) 16
Tibia I spines absent along the most distal retrolateral aspect with the prolateral spines not arranged in such a fashion (Fig. 275) 5
Tibia I spines slightly behind (proximal) the distal most retrolateral aspect of the article, prolateral spines arranged in a single row along the medial prolateral surface of tibia I. Numerous distal tibia I spines (TSrd) offset slightly proximal from the distal margin (Fig. 175) Aptostichus barackobamai
5 Palpal endites lack cuspules, PTw/PTl > 0.5, palpal tibia spines short and prolaterally positioned, embolus short, thick and appears to be compressed in the dorsal/ventral plane (Figs 277, 278) Simus species groups- 6
Palpal endites with cuspules, PTw/PTl < 0.5, palpal tibia spines long and ventrally positioned, palpal tibia with very distinct megaspines on the mid - retrolateral region, embolus thin (Figs 339, 341) Sierra species group- 13
6 Sternum longer than wide, widest point usually between coxae III and IV (Fig. 283) 7
Sternum as wide as it is long, generally appears to be round in shape Aptostichus cajalco
7 TSr < 10 8
TSr > 10 9
8 AME and PME subequal in diameter Aptostichus satleri
PME less than AME in diameter Aptostichus elisabethae
9 Embolus lacks serrations Aptostichus fornax
Embolus serrated (Fig. 306) 10
10 Tarsus I lacks ventral spines, also lacks elongate ventral tibia I spines (Fig. 275) Aptostichus simus
Tarsus I with short ventral spines (Figs 317, 322) 11
11 AME & PME diameter subequal, MA4/MF4 ≥ 60 Aptostichus lucerne
AME diameter less than PME diameter, MA4/MF4 < 60 12
12 MT1/MF1 > 79 Aptostichus fisheri
MT1/MF1 < 75 Aptostichus bonoi
13 TSr > 18 Aptostichus chavezi
TSr ≤ 18 14
14 Sternum noticeably long and thin (Fig. 340) 15
Sternum shape normal Aptostichus sierra
15 Tarsus I and IV straight, PTl/Cl > 3 Aptostichus dorothealangeae
Tarsus I and IV curved, PTl/Cl < 3.6 Aptostichus huntington
16 Rastellum with a single spine offset retrolaterally (Fig. 189) Hesperus species group- 17
Rastellum lacking an offset retrolateral spine Atomarius species group- 29
17 Coloration darker, non psammophilic form, mottled abdominal striping (Fig. 191) 18
Coloration lighter, psammophilic form, abdominal striping reduced to just a few stripes or mottled blotches (Fig. 197) 22
18 Sternal sigilla contiguous (Fig. 188) Aptostichus hesperus
Sternal sigilla separated 19
19 Sternum as wide as it is long, appears round and raised (Fig. 256) Aptostichus mikeradtkei
Sternum longer than wide with widest point between coxae III and IV 20
20 Leg I retrolateral distal tibia spine pattern comprises < 4 spines, non-overlapping Aptostichus killerdana
Leg I retrolateral distal tibial spine pattern comprises > 3 spines that overlap 21
21 Cl < 4.4, collected from southern California Aptostichus cahuilla
Cl > 4.8, collected from southeastern Arizona Aptostichus edwardabbeyi
22 Retrolateral surface of cymbium with spines (Figs 246, 248) 23
Retrolateral surface of cymbium lacks spines 25
23 AME and PME subequal in diameter Aptostichus sarlacc
PME less than AME in diameter 24
24 Metatarsus mating apophysis armed with a distinct spine, tarsus convex in shape (Fig. 266) Aptostichus sinnombre
Metatarsus mating apophysis not armed with a distinct spine, tarsus straight Aptostichus derhamgiulianii
25 4 or more spines arranged along dorsal/prolateral surface of leg I metatarsus, spines form a distinct row 26
3 or fewer spines arranged along dorsal/prolateral surface of leg I metatarsus, not forming a distinct row 27
26 Distinct spine patch on prolateral surface of leg I patella, comprising multiple heavy spines (> 8) (Fig. 264) Aptostichus anzaborrego
Leg I patella armed with only a few thin spines (usual condition, < 3) Aptostichus chemehuevi
27 Innermost rastellar spines are much larger than those more prolaterally positioned Aptostichus serrano
Innermost and prolateral spines are equal in size 28
28 Tibia I retrolateral distal spination pattern consists of multiple spines (> 3), often overlapping and a metatarsal mating apophysis armed with a single small spine Aptostichus aguacaliente
Tibia I retrolateral distal spination pattern comprises 3 or fewer spines, metatarsal mating apophysis not armed with a spine Aptostichus hedinorum
29 Metatarsus mating apophysis triangular in shape 30
Metatarsus mating apophysis rounded or knob-like (Fig. 128) Aptostichus asmodaeus
30 Dense, heavy spination on leg I prolateral surface of tibia and patella (Fig. 139) 31
Spination on prolateral surface of leg I patella and tibia comprises only a few spines 32
31 Metatarsus leg I with a distinct row of heavy dorsal spines, collected from southeastern Arizona Aptostichus chiricahua
Metatarsus leg I lacks a distinct row of heavy dorsal spines, collected from central California Aptostichus nateevansi
32 Lightly colored carapace and abdomen, abdominal striping reduced comprising a set of light distinct bands, found in western Nevada (Fig. 120) Aptostichus pennjillettei
Carapace and abdomen usually darkly pigmented, abdomen with distinct heavy, mottled pattern of stripes (e.g., Fig. 106) 33
33 3 or fewer distal retrolateral tibial spines on leg I, palpal tibia slender, distributed further to the north in California, proximity of the Yosemite Valley Aptostichus muiri
More than three distal retrolateral tibial spines on leg I, palpal tibia more robust, distributed throughout southern California and the coastal ranges to the west Atomarius Sibling species complex- 34
34 Collected from inland habitats, usually (but not always) darker in color with distinct mottled abdominal striping pattern (Fig. 81) 35
Collected from coastal dune habitat, always lighter in coloration and generally lacking distinct mottled abdominal striping pattern (Fig. 82) 37
35 Restricted to the Monterey Bay area, distributed west of the Salinas River Valley Aptostichus angelinajolieae
Not restricted to the Monterey Bay area, found east and south of the Salinas River Valley 36
36 Known from along the banks of the Kern River (Kern Co., Bakersfield, California) and the southern extent of the Transverse Ranges. Specimens from the Bakersfield area often much lighter in coloration with significantly reduced abdominal patterning Aptostichus dantrippi
Distributed throughout the coastal ranges of central California, bounded to the east by the Central Valley Aptostichus stanfordianus
Widely distributed throughout southern California Aptostichus atomarius
37 Distributed in California coastal dune habitat from San Luis Obispo County northward to San Francisco County Aptostichus stephencolberti
Distributed in California coastal dune habitats from Marin County northward to Humboldt County and on Farallon Island Aptostichus miwok
The Atomarius species group

Included species.

Aptostichus atomarius Simon, 1891

Aptostichus stephencolberti Bond, 2008

Aptostichus angelinajolieae Bond, 2008

Aptostichus stanfordianus Smith, 1908

Aptostichus miwok Bond, 2008

Aptostichus dantrippi Bond sp. n.

Aptostichus pennjillettei Bond sp. n.

Aptostichus asmodaeus Bond sp. n.

Aptostichus nateevansi Bond sp. n.

Aptostichus chiricahua Bond sp. n.

Aptostichus icenoglei Bond sp. n.

Aptostichus cabrillo Bond sp. n.

Aptostichus isabella Bond sp. n.

Aptostichus muiri Bond sp. n.

Aptostichus barackobamai Bond sp. n.

The Atomarius Sibling Species Complex

The Atomarius Sibling Species Complex (Bond and Stockman 2008) comprises six closely related sibling species: Aptostichus atomarius, Aptostichus stephencolberti, Aptostichus angelinajolieae, Aptostichus stanfordianus, Aptostichus miwok Bond, and Aptostichus dantrippi sp. n. With the exception of a number of coastal dune and desert-adapted lineages these species are relatively morphologically homogenous (see analysis of morphological variation in Bond and Stockman 2008) and are difficult to distinguish; modifications to the male leg I tibia and metatarsus are indistinguishable among species. However, all species in this complex have non-overlapping ranges and thus can be ascribed to species on the basis of collecting locality and habitat; examination of diagnostic molecular markers should be employed to definitively confirm any determinations made solely on the basis of geography. Molecular studies to date further indicate Aptostichus atomarius, as defined below, may actually comprise 2–3 species; sampling at the time was insufficient to formulate these additional hypotheses with rigor.

Aptostichus atomarius Simon, 1891

‘The San Bernardino Hills Trapdoor Spider’



Figures 69–81, Map 2, 3
Aptostichus atomarius Simon, 1891: 317; female lectotype (AR4263) from California, San Bernardino; specimen in MNHP, examined–P. Smith 1908: 220–221.–Bond & Opell 2002: 518–519.
Actinoxia versicolor Simon, 1891: 318, synonymized by Bond & Opell 2002: 518.

Like all Atomarius Sibling Species Complex males, Aptostichus atomarius can be diagnosed by virtue of having a sharp triangular metatarsal mating apophysis and four or more TSrd spines arranged linearly without overlapping (Figs 69–73). Male pedipalp morphology relatively homogenous, comprising a slender palpal tibia that lacks a retrolateral spine patch (Fig. 74) and a simple unserrated bulb (Fig. 75). Females can be distinguished by having a secondary spermathecal bulb that extends below the horizontal plane of the lateral spermathecal base (Figs 76–78). Specimens in life have a mottled abdominal coloration pattern and tend to have carapace and legs with an orange tint (Figs 79–81) whereas other sympatric species (e.g., Aptostichus icenoglei) have darker leg and carapace coloration. Aptostichus atomarius females also tend to have a narrower sternum than Aptostichus icenoglei, however, this difference is very subtle and not quantifiable. Generally, individuals of this species are difficult to distinguish from other Atomarius Sibling Species Complex members on the basis of morphological features alone but can be diagnosed on the basis of a set of unique mtDNA site substitutions (see Bond and Stockman 2008). The distribution of Aptostichus atomarius is restricted to Southern California and does not overlap with other closely related sibling species (Map 2).


Female originally described by Simon (1891); Male described and female redescribed by Bond and Opell (2002).

Material examined.

United States: California: Inyo Co.: Summit Creek, 8km S 4.8km W Olancha, 36.2109, -118.06765, 1951m, D Giuliani 16.iv.1989 [AP169, 1♂, CAS]; Los Angeles Co.: ~3.2km SE of Tujunga, ~91m NW of intersection Lowell & Honolulu Ave, now site HWY 210, 34.230626, -118.2702624, 515m, W Icenogle 12.x.1972 [AP195, 1♀ 78juv, CAS; AP203, 1♀ 38 juv., AMNH]; Alamos CG (Hard Luck) Rd, lower Hungry Valley, 34.702, -118.80161, 860m, M Hedin, J Satler, J Starrett, C Richart 16.ii.2009 [MY3767, 3769 1♀ 1juv, AUMNH]; Altadena, 34.1792, -118.10933, 340m, M Thompson 1.xi.1969 [AP614, 1♂, AMNH]; Altadena, 34.1897, -118.13117, 430m, 2.xii.1985 [AP1245, 1♂, CAS]; Angeles National Forest, San Gabriel Mtns, ~4.8km (road) W Mt Baldy Village, 70m S Glendora Ridge Rd S side Cow Canyon, 34.2237, -117.72393, 1237m, W Icenogle 21.v.1974 [AP200, 1♀, CAS]; Baldwin Hills, 34.0114, -118.36864, 125m, G Morris 1.xii.1944 [AP181, 1♀ 1♂, AMNH], 28.viii.1947 [AP490, 1♀, AMNH]; Baldwin Park, 34.0854, -117.96475, 111m, R Crandall 18.x.1962 [AP001, 1♂, AMNH]; Chatsworth, intersection Lassen St & Valley Circle Blvd, ravine just E Oakwood Cemetery, 34.2512, -118.62274, 315m, W Icenogle 28.viii.1966 [AP191, 1♀ 91juv, CAS], 13.x.1966 [AP477, 1♀, CAS], 23.x.1966 [AP183, 1♂, AMNH]; Claremont, Palmer Canyon Rd, 34.1593, -117.69966, 817m, 9.ix.1923 [AP462, 1♀ 1juv, AMNH]; E Fork San Gabriel Canyon in Burro Canyon, 34.2366, -117.83923, 432m, K Kinulan 6.x.1968, [AP664, 1♀, AMNH]; Eaton Canyon Park, 34.1783, -118.09514, 298m, D Marqua 18.xi.1965 [AP157, 1♂, AMNH]; Henninger Flats, 34.1925, -118.08941, 775m, J Bond, C Spruill, D Beamer 15.iv.2004, [MY2634, 1juv, AUMNH]; Henninger Flats, 34.19266, -118.08753, 792m, D Marqua 18.xi.1967 [AP613, 1♂, AMNH]; Lady Bug Canyon, San Gabriel Mountains, 34.2685, -118.1175, 1225m, 1.iii.1971 [AP152, 1♂, AMNH]; Little Dalton Canyon, Glendora Mountain Rd, 34.1637, -117.83891, 380m, J Bond, C Spruill, D Beamer 16.iii.2004 [MY2610, 2612, MY2616, 2juv, 1♀]; Los Angeles, 1220 Williams Rd, 34.0570, -118.14073, 159m, D Lowrie 21.xi.1959 [AP168, 1♂, CAS]; Malibu Canyon, Malibu Canyon Rd 160m from intersection Piuma Rd, 34.0799, -118.70361, 149m, J Bond, C Spruill, D Beamer 14.iv.2004 [MY2636, 1juv, AUMNH]; Mt Baldy Rd, ~0.2 km N jct N Mountain Ave, 34.1773, -117.67671, 800m, M Hedin, J Satler, J Starrett, C Richart 15.ii.2009 [MY3764, 1juv, AUMNH]; Near Los Angeles, 34.0522, -118.24287, 85m, G Jenko 11.viii.1939 [AP471, 1♀, AMNH]; Pacific Palisades, near Santa Monica, 34.0553, -118.52886, 113m, G Morris 1.ii.1945 [AP308, 1♀, AMNH]; Pasadena, Eaton Canyon Park, 34.1807, -118.0954, 325m, B Crandall 31.xii.1963 [AP151, 1♂, AMNH], M Thompson 1.xi.1964 [AP153, 4♂, AMNH], 7.ii.1965 [AP161, 1♀ 2♂, CAS], 3.xi.1967 [AP165, 1♂, AMNH], 1.xii.1967 [AP174, 1♂, AMNH], 17.x.1969 [AP615, 1♂, AMNH], 10.xi.1969 [AP612, 1♂, AMNH]; Puente Hills, intersection Azusa & Tomich Rd, 33.9816, -117.93351, 210m, J Bond, C Spruill, D Beamer 14.iii.2004 [MY2591, 1♀, AUMNH]; Puente Hills, near Diamond Bar, Pitfall array PUE-6, 33.9785, -117.84361, 269m, R Fisher 1.xi.1998 [AP829, 2♂, CAS], 1.x.1999 [AP830, 1♂, CAS], 1.xi.2002 [AP831, 1♂, CAS]; Puente Hills, near Diamond Bar, Pitfall array PUE-7, 33.9802, -117.84431, 271m, R. Fisher 1.xi.1998 [AP832, 1♂, CAS]; Puente Hills, north of Powder Canyon, 33.96812, -117.923471, 273m, USGS-BRD San Diego Sta. 1.xi.1998 [AP933, 1♂, CAS]; Puente Hills, S Roland Heights, Pitfall array PUE-10, 33.969, -117.92681, 294m, R Fisher 1.iv.1998 [AP833, 1♂, CAS], 1.x.1999 [AP834, 1♂, CAS]; Puente Hills, S Sycamore Canyon, 33.9985, -118.03391, 268m, R Fisher 1.x.1999 [AP836, 3♂, CAS]; Puente Hills, S Sycamore Canyon, 33.998, -118.0311, 273m, R Fisher 1.x.1999 [AP837, 1♂, CAS]; Puente Hills, S Sycamore Canyon 2, 34.0001, -118.04241, 196m, R Fisher 1.x.1999 [AP838, 2♂, CAS], 1.xi.2002 [AP839, 1♂, CAS]; Puente Hills, S Sycamore Canyon 4, 34.0001, -118.02911, 673m, R Fisher 1.x.1999 [AP842, 1♂, CAS]; Puente Hills, Sycamore Canyon, 34.0023, -118.03721, 161m, R Fisher 1.xi.1998 [AP840, 1♂, CAS], 1.x.1999 [AP841, 1♂, CAS]; Puente Hills, Sycamore Canyon, E Whittier, 34.0027, -118.03051, 200m, USGS-BRD San Diego Sta. 1.x.1999 [AP934, 1♂, CAS]; Puente Hills, S Roland Heights 1, 33.9688, -117.92881, 266m, R Fisher 1.x.1999 [AP835, 1♂, CAS]; Rincon Fire Station, San Gabriel Canyon, 34.2379, -117.86331, 477m, J Bond, C Spruill, D Beamer 15.iii.2004 [MY2618, 1♀, AUMNH]; Rollings Hills, 33.7604, -118.34335, 275m, J Buttram [AP1266, 1♀, AMNH]; San Clemente Island, E face Mount Thirst, 32.884, -118.4515, 584m, J Boyen 22.iii.1972 [AP176, 1♂, CAS]; San Gabriel Mountains, shortcut AC Hwy, 34.2737, -118.03856, 1402m, M Thompson 26.iv.1964 [AP660, 1♀, AMNH]; San Gabriel Mtns, Angeles National Forest, Big Tujunga Canyon Rd, ~1.2 km W Vogel Flat Rd, 34.2949, -118.23651, 600m, M Hedin, J Satler, J Starrett, C Richart 15.ii.2009 [MY3765, 1juv, AUMNH]; Santa Catalina Island, Avalon, 33.3444, -118.33345, 66m, V Roth, [AP272, 1♂, AMNH]; Santa Monica Mnts., Beverly Glen Canyon, 34.1091, -118.44595, 255m, F Hovore 11.xi.1965 [AP150, 1♂, AMNH]; Santa Monica Mnts, Sepulveda Pass, 34.1228, -118.48245, 394m, F Hovore 27.xi.1969 [AP310, 1♀, AMNH]; Toyon Bay, Santa Catalina Island, 33.3707, -118.34964, 1♂, M Ramirez 12.viii.1988 [AP470, 1♀, CAS]; UCLA, 34.0723, -118.4483, 117m, 1.xi.1952 [AP003, 1♂, AMNH]; Orange Co.: Bauer Peak, 33.8012, -117.79531, 228m, USGS-BRD San Diego Sta. 1.xi.1999 [AP1052, 1053, 2♂, CAS]; Bauer Peak, 33.802, -117.79381, 227m, USGS-BRD San Diego Field Sta. 1.xi.1998 [AP1051, 1♂, CAS]; Chino Hills, E Gilman Peak, 33.9282, -117.7661, 486m, USGS-BRD San Diego Field Sta. 1.i.2001 [AP1018, 1♂, CAS], 1.i.2002 [AP1019, 1♂, CAS]; Chino Hills, E Lookout Tower, 33.9393, -117.81691, 396m, USGS-BRD San Diego Sta. 1.x.2001 [AP1047, 1♂, CAS], 1.iv.2002 [AP1048, 1♂, CAS]; Chino Hills, ridge south of Telegraph Canyon, 33.9116, -117.78881, 355m, USGS-BRD San Diego Field Station 1.x.2000 [AP1038, 1♂, CAS]; Chino Hills, ridge S Telegraph Canyon, 33.9109, -117.78911, 354m, USGS-BRD San Diego Field Sta. 1.x.2000 [AP1036, 1♂, CAS], 1.x.1998 [AP1034, 2♂, CAS], 1.x.1999 [AP1035, 1♂, CAS]; Chino Hills, ridge S Telegraph Canyon, 33.9116, -117.78881, 355m, USGS-BRD San Diego Field Sta. 1.x.2001 [AP1037, 1♂, CAS]; Chino Hills, ridge S Telegraph Canyon, 33.9119, -117.78911, 358m, USGS-BRD San Diego Field Sta. 1.x.2000 [AP1042, 1040 2♂, CAS], 1.x.1998 [AP1041, 1♂, CAS]; Chino Hills, Telegraph Canyon, 33.9133, -117.81091, 179m, USGS-BRD San Diego Sta. 1.x.2001 [AP1045, 1046 1♂, CAS]; Chino Hills, ridge S Telegraph Canyon, 33.9112, -117.80181, 255m, USGS-BRD San Diego Sta. 1.x.2000 [AP1044, 1♂, CAS], 1.x.1999 [AP1043, 1♂, CAS]; Crow Canyon, 33.6029, -117.54421, 338m, USGS-BRD San Diego Sta. 1.i.2000 [AP1131, 1♂, CAS]; Dana Point, Salt Creek above golf course and bridge, 33.4971, -117.71451, 58m, J. Bond 2.ii.2004 [MY2482, 1juv, CAS]; E El Modena, N Chapman Ave, 33.7936, -117.79421, 176m, USGS-BRD San Diego Sta. 1.xi.1998 [AP957, 2♂, CAS]; El Modena, ridge S Bauer Peak, 33.7936, -117.79421, 176m, USGS-BRD San Diego Sta. 1.xi.2001 [AP1049, 1♂, CAS]; El Modena, ridge S Bauer Peak, 33.7981, -117.79421, 196m, USGS-BRD San Diego Sta. 1.xii.2000 [AP1050, 1♂, CAS]; Fullerton, E Coyote Hills, 33.8957, -117.90031, 139m, USGS-BRD San Diego Sta. 1.xi.2001 [AP1107, 1♂, CAS], 1.xi.1999 [AP1109, 1♂, CAS], 1.x.2001 [AP1108, 1♂, CAS]; Intersection H74 and Trampas Canyon overpass, 33.5136, -117.58231, 89m, J Bond, C Spruill, D Beamer 18.iii.2004 [MY2673, 2675 2♀, CAS]; Loma Ridge, W Limestone Canyon, 33.7363, -117.69011, 417m, USGS-BRD San Diego Sta. 1.xi.1998 [AP1058, 1♂, CAS], 1.xii.1999 [AP1059, 1♂, CAS]; N Aliso Wood Canyon, 33.5575, -117.74641, 64m, USGS-BRD San Diego Field Station 1.x.2002 [AP950, 1♂, CAS]; N Aliso Wood Canyon, 33.5675, -117.74821, 80m, USGS-BRD San Diego Field Station 1.xi.2002 [AP951, 1♂, CAS]; NE Brea, S Oil Field, 33.9272, -117.87421, 174m, R Fisher 1.xi.1998, [AP826, 1♂, CAS], 1.ii.1999 [AP827, 1♂, CAS], 1.x.1999 [AP828, 1♂, CAS]; NE Lemon Heights Lomas de Santiago E Peters Canyon, 33.7643, -117.76671, 284m, USGS-BRD San Diego Sta. 1.xii.2000 [AP958, 1♂, CAS]; NE Lemon Heights, Peters Canyon, 33.7631, -117.771, 272m, USGS-BRD San Diego Sta. 1.xii.2000 [AP956, 1♂, CAS]; NE Rattlesnake Reservoir, 33.7313, -117.7311, 143m, USGS-BRD San Diego Sta. 1.xi.2000 [AP888, 1♂, CAS], 1.vi.2000 [AP889, 1♂, CAS]; NW upper Oso Reservoir, N El Toro Rd, 33.6725, -117.64151, 260m, USGS-BRD San Diego Sta. 1.xi.2001 [AP1116, 1♂, CAS]; NW Upper Oso Reservoir, N El Toro Rd, 33.6702, -117.63961, 283m, USGS-BRD San Diego Field Station 1.i.2000 [AP1228, 1♀, CAS]; Ridge E Bell Canyon, 33.6041, -117.55251, 518m, USGS-BRD San Diego Sta. 1.i.2000 [AP1138, 1♂, CAS]; San Joaquin Hill, ridge N of E Morro Canyon, 33.59, -117.79311, 249m, USGS-BRD San Diego Sta. 1.xi.2002 [AP1112, 1♂, CAS]; San Joaquin hills, E branch Laguna Canyon, 33.5946, -117.77521, 175m, USGS-BRD San Diego Sta. 1.x.2000 [AP1175, 1♂, CAS]; S University of Irvine Campus, N Bonita Canyon, E Spring Canyon, 33.6334, -117.84741, 66m, USGS-BRD San Diego Sta. 1.xi.1998 [AP1180, 1♂, CAS]; Weir Canyon, 33.8148, -117.74621, 252m, USGS-BRD San Diego Field Sta. 1.xii.2000 [AP1122, 1♂, CAS]; Weir Canyon, 33.8155, -117.74711, 232m, USGS-BRD San Diego Field Sta. 1.x.1999 [AP1123, 1♂, CAS]; Weir Canyon, 33.8184, -117.74461, 280m, USGS-BRD San Diego Field Sta. 1.xii.2000 [AP1125, 1♂, CAS], 1.x.2001 [AP1126, 1♂, CAS]; Weir Canyon, 33.8252, -117.74191, 249m, USGS-BRD San Diego Field Sta. 1.i.2000 [AP1127, 1♂, CAS]; E Cowan Heights, Peters Canyon, 33.7741, -117.76161, 260m, USGS-BRD San Diego Sta. 1.xi.2001 [AP995, 1♂, CAS], 1.x.1998 [AP961, 962 4♂, CAS]; E El Toro Marine Corp Air Sta. N Borrego Canyon, 33.6896, -117.67411, 266m, USGS-BRD San Diego Sta. 1.i.2003 [AP969, 1♂, CAS]; Niguel Hill, E of S Aliso Wood Canyon, 33.5123, -117.73972, 195m, USGS-BRD San Diego Sta. 1.ii.2000 [AP948, 1♂, CAS], 1.ii.2002 [AP949, 1♂, CAS]; N Aliso Wood Canyon, 33.574, -117.74931, 104m, USGS-BRD San Diego Sta. 1.ii.2001 [AP952, 1♂, CAS]; NE Lemon Heights, Lomas de Santiago, E Peters Canyon, 33.7672, -117.76371, 295m, USGS-BRD San Diego Sta. 1.viii.1999 [AP959, 1♂, CAS]; San Joaquin Hills, SW Laguna Beach Rd & El Toro Rd jct, 33.5738, -117.7711, 243m, USGS-BRD San Diego Sta. 1.x.2000 [AP999, 1♂, CAS], 1.xi.2002 [AP998, 1♂, CAS]; S Aliso Wood Canyon, 33.5185, -117.73861, 7m, USGS-BRD San Diego Sta. 1.ii.2000 [AP974, 3♂, CAS]; S Aliso Wood Canyon, 33.5327, -117.74141, 20m, USGS-BRD San Diego Sta. 1.x.2001 [AP978, 1♂, CAS]; S Aliso Wood Canyon, 33.5333, -117.00661, 26m, USGS-BRD San Diego Sta. 1.x.2002 [AP947, 1♂, CAS]; S Alliso Wood Canyon, 33.5264, -117.7358, 30m, USGS-BRD San Diego Sta. 1.ii.2001 [AP976, 1♂, CAS], 1.ii.2002 [AP977, 1♂, CAS]; Temple Hill, W of N Aliso Wood Canyon, 33.005, -117.00661, 295m, USGS-BRD San Diego Sta. 1.ii.2000 [AP953, 1♂, CAS]; 0.4km S hwy 74, 4km E San Juan Fire Station, Hot Spring Canyon turnoff, 33.5902, -117.47551, 373m, W Icenogle 3.xi.2000 [MY3785, 1♂, AUMNH], 6.ii.2001 [MY3786, 1♂, AUMNH], 8.xi.2001 [MY3787, 1♂, AUMNH], 30.xii.2005 [MY3788, 1♂, AUMNH]; Riverside Co.: ~300m W of jct hwys 243 & 74 on hwy 74 W Mt. Center, 33.7047, -116.72561, 1341m, M Hedin, C Johnson, R Keith 2.ii.2003 [MY0722, 1juv, AUMNH]; 3.0km (road) W Lake Mathews, canyon just S Cajalco Rd, 33.8256, -117.49573, 265m, W Icenogle 14.xii.1998 [AP371, 1♂, CAS], 2.i.1999 [AP370, 1♂, CAS], 7.ii.1999 [AP661, 2♂, CAS], 4.iv.1999 [AP382, 1♂, CAS], 13.iv.1999 [MY3784, 1♂, CAS], 4.v.1999 [AP369, 1♂, CAS], 31.v.1999 [AP354, 1♀, AUMNH], 8.xii.2001 [MY3782, 4♂, CAS], 2.xii.2000 [MY3783, 1♂, CAS], 4.8km W Mountain Center on HWY 74, 33.7011, -116.7693, 1124m, W Icenogle 26.viii.1968 [AP184, 1♂, CAS; AP190, 451, 456, 2♀ 41juv, AMNH]; 13km NW Winchester on N facing hillside and base of vegetation, 33.5747, -117.03021, 495m, J Bond 13.xii.1997 [AP677, 1♀, AUMNH]; Bautista Canyon, along Bautista Canyon Road, 33.7099, -116.87751, 611m, J Bond 1.ii.2004 [MY2477, 1♀, AUMNH]; canyon adjacent to Cajalco Canyon along Cajalco Exp, 33.828, -117.48711, 335m, J Bond, W Icenogle 29.i.2004 [MY2490, MY2517, 2 juv., AUMNH], 29.i.2004, [MY2491, 1♀, AUMNH]; E Rawson Canyon, S Crown Valley, 33.6299, -117.00521, 661m, USGS-BRD San Diego Field Sta. 1.ii.2000 [AP1118, 1♂, CAS]; E Skinner Reservoir, 33.5869, -117.02121, 501m, USGS-BRD San Diego Sta. 1.ii.2000 [AP1009, 1012, 2♂, CAS]; E Skinner Reservoir, 33.5819, -117.01891, 488m, USGS-BRD San Diego Field Sta. 1.iv.1999 [AP1211, 2♂, CAS], 1.ii.2000, [AP1212, 1♂, CAS]; E Skinner Reservoir, 33.5827, -117.02111, 479m, USGS-BRD San Diego Field Sta. 1.ii.2000 [AP1007, 1♂, CAS]; E Skinner Reservoir, 33.5977, -117.0241, 464m, USGS-BRD San Diego Field Sta. 1.ii.2000 [AP1027, 1♂, CAS]; E Skinner Reservoir, 33.5989, -117.02351, 467m, USGS-BRD San Diego Field Sta. 1.ii.2000 [AP1026, 1♂, CAS]; hills N Diamond Valley, 33.7024, -117.01641, 553m, USGS-BRD San Diego Sta. 1.x.1998 [AP1110, 2♂, CAS], 1.iii.1999, [AP1111, 1♀, CAS]; Joshua Tree National Park, Upper Covington Flat, 34.0145, -116.31591, 949m, USGS-BRD San Diego Sta. 1.iii.2000 [AP900, 1♂, CAS]; Joshua Tree National Park, Covington Flat, 34.0311, -116.31771, 1554m, J Bond 8.xii.1997 [AP678, AP1262, 2♀, CAS]; Joshua Tree National park, S Cap Rock, 33.9476, -116.17161, 1412m, USGS-BRD San Diego Sta. 1.iv.2000 [AP931, 1♂, CAS]; just S Winchester on Leona Rd, ~1.6km S intersection with Patton Avenue, 33.6771, -117.11571, 444m, J Bond 1.ii.2004, [MY2511, 2518, 2514, 2524, 4♀, AUMNH]; Lake Matthews, 33.8266, -117.4381, 446m, J Bond 22.xi.1998 [AP685, 686, 688, 2♀ 1♂, AUMNH]; Lake Skinner Rec Area, 0.8km N Lake, 33.599, -117.05393, 488m, T Prentice 16.xii.1996 [AP242, 1♂, CAS]; Lake Skinner, 13km NW Winchester, 33.595, -117.0583, 485m, [AP504, 1♂, CAS]; Mountain Center, San Jacinto Mountains, 33.7042, -116.7253, 1375m, W Icenogle 26.viii.1968 [AP015, 1♀, AMNH], 9.ii.1969 [AP020, 1♀, AMNH]; Mountain Center, small ravine on H243, ~1.6km from junction H74, 33.712, -116.71641, 1440m, J Bond 31.i.2004 [MY2478, 1juv, AUMNH]; N Perris, E Mayer Farms, 33.8045, -117.25181, 571, USGS-BRD San Diego Sta. 1.i.2000 [AP1100, 1♂, CAS]; N Perris, E Mayer Farms, 33.8109, -117.25781, 593m, USGS-BRD San Diego Field Sta. 1.ii.1999 [AP1103, 1♂, CAS]; N Perris, E Mayer Farms, 33.8145, -117.26011, 575m, USGS-BRD San Diego Field Sta. 1.ii.1999 [AP1106, 1♂, CAS]; N Tenja Canyon, S Wildomar Rd., 33.5104, -117.36871, 604m, USGS-BRD San Diego Sta. 1.i.2000 [AP874, 1♂, CAS]; Ortega HWY H74, ~2.7km N Orange Co./Riverside Co. line, 33.6127, -117.43461, 523m, J Bond 2.ii.2004 [MY2487, 2493 2juv, AUMNH]; San Bernardino National Forest, 33.7363, -116.83161, 603m, J Bond 28.iii.1996 [AP724, 1♀, AUMNH]; San Bernardino National Forest, 1.1km W Mt Center, 33.7083, -116.76041, 964m, J Bond 31.i.2004 [MY2472, 1juv, AUMNH]; San Bernardino National Forest, Juan Diego Flats Rd, ~1km from intersection w/Reed Valley Rd, 33.5836, -116.81411, 1110m, J Bond 7.iv.1996 [AP745, 1♀, AUMNH]; Santa Margarita Ecological Reserve, S Santa Margarita River, NW Royal Oak Ranch, 33.4388, -117.17981, 256m, USGS-BRD San Diego Sta. 1.ii.2000 [AP897, 1♂, CAS]; S Santa Margarita River, N Royal Oak Ranch, 33.4399, -117.16051, 421m, USGS-BRD San Diego Sta. 1.ii.2000 [AP893, 2♂, CAS]; University of California, Riverside Campus, 33.9742, -117.32513, 327m, W Icenogle 17.xii.1969 [AP350, 1♂, AMNH]; W De Luz Creek, S Tenaja Rd, 33.5139, -117.00161, 688m, USGS-BRD San Diego Field Sta. 1.i.2001 [AP982, 1♂, CAS]; Winchester, 1.6km NW of town center, Grand Ave, vicinity of Double Butte, 33.7149, -117.09221, 478m, W Icenogle 17.xi.1968 [AP248, 1♂, AMNH]; Winchester, intersection Leon Rd & Ano Crest Dr, 33.6777, -117.11591, 445m, J Bond 18.i.1997, [AP1221, 1♀, AUMNH]; Winchester, just E Icenogle residence, 33.7156, -117.09361, 465m, J Bond 29.i.2004 [MY2471, 1♀, AMNH]; Winchester, Leona Rd ~1.6km S intersection w/Patton Ave, 33.6771, -117.11571, 444m, J. Bond, W. Icenogle, et al. 13.iii.2004 [MY2595, 2601-03, 2695-08, 8♀ 1juv, AUMNH]; between Squaw Mountain & Redonda Mesa, N Tenaja Rd, 33.5025, -117.33861, 1020m, USGS-BRD San Diego Sta. 1.ii.2000 [AP1196, 1♂, CAS]; SE Skinner Reservoir, 33.5766, -117.03161, 482m, USGS-BRD San Diego Sta. 1.ii.2000 [AP1223, 2♂, CAS]; W De Luz Creek, S Tenaja Rd, 33.5097, -117.31391, 650m, USGS-BRD San Diego Sta. 1.i.2000 [AP992-94, 3♂, CAS]; W De Luz Creek, S Tenaja Rd, 33.511, -117.31471, 674m, USGS-BRD San Diego Sta. 1.i.2000 [AP984, 986, 3♂, CAS], 1.xii.1999, [AP983, 1♂, CAS]; W De Luz Creek, S Tenaja Rd., 33.515, -117.31261, 664m, USGS-BRD San Diego Sta. 1.i.2000 [AP987, 1♂, CAS]; San Bernardino Co.: Alta Loma, 34.122, -117.5973, 412m, D Bixler 18.iii.1969 [AP005, 3♂, AMNH], 20.iii.1969 [AP004, 1♂, AMNH], 20.iv.1969 [AP495, 1♂, AMNH]; Fawnskin, 34.2681, -116.94173, 2077m, L Underwood 1.ix.1996 [AP497, 1♂, CAS]; Granite Mtns Preserve, 34.7844, -115.65791, 1317m, R Vetter, J Bond 15.xii.1997 [AP673, 1♂, AUMNH]; Hwy 18, base San Bernardino Mnts, National Forest Boundary, 34.1776, -117.27521, 516m, J Bond, W Icenogle 28.i.2004 [MY2466, 2497, 2498, 1♀ 2 juv., AUMNH]; Joshua Tree National Park, Lower Covington Flat, 34.0401, -116.31023, 1433m, E Schlinger [AP529, 1♂, AMNH], E Sleeper, S Jenkins 10.iii.1965 [AP537, 1♂, CAS]; Lytle Creek Rd, ~4.5km N of jct w/ I-15, 34.2138, -117.46131, 750m, M Hedin, J Satler, J Starrett, C Richart 15.ii.2009 [MY3762, 1♀, AUMNH]; Lytle Creek Rd, near Scotland, 34.244, -117.49521, 950m, M Hedin, J Satler, J Starrett, C Richart 15.ii.2009 [MY3766, 1j, AUMNH]; San Bernardino, 1km S jct HWY 18 & Waterman Canyon Rd, 34.1774, -117.27361, 488m, W Icenogle 16.i.2000-16.ii.2000 [AP351, 356, 3♂, AMNH; AP355, 357, 361, 362, 365, 5♂, CAS]; Silverwood Lake, 34.2871, -117.34081, 1018m, USGS-BRD San Diego Sta. 1.x.2001 [AP1169, 1♂, CAS]; Chino Hills, E Gilman Peak, 33.93, -117.75431, 486m, USGS-BRD San Diego Sta. 1.i.2002 [AP1017, 1♂, CAS]; San Diego Co.: Camp Pendleton, 33.2341, -117.40135, 2m T Prentice 1.xii.1995 [AP579, 580 2♂, UCR]; Camp Pendleton Marine Corps Base, SW Horno Hill, between Foley & Horno Canyons, 33.3448, -117.50871, 87m, R Fisher 26.i.2004 [AP823, 1♂, CAS]; Camp Pendleton, mouth San Onofre Creek, 33.3898, -117.56261, 35m, USGS-BRD San Diego Sta. 1.xii.1999 [AP1159, 1♂, CAS]; Carmel Mountain, 32.9283, -117.22271, 118m, USGS-BRD San Diego Field Sta. 1.x.2002 [AP940, 1♂, CAS]; Carmel Mountain, 32.9383, -117.21362, 111m, USGS-BRD San Diego Field Sta. 1.xi.2002 [AP942, 1♂, CAS]; Chula Vista, Terra Nova, N Rice Canyon, 32.6432, -117.03772, 105m, USGS-BRD San Diego Field Sta. 1.ii.2000 [AP1227, 1♂, CAS]; DeLuz Road, 8km N Fallbrook at DeLuz Rd./S13 jct, 33.411, -117.28981, 229m, M Hedin 31.viii.2003 [MY2273, 2275 2♀ 4juv, AUMNH]; E Lakeside between El Monte Park & entrance to El Capitan Res, El Monte Rd, 32.8836, -116.82231, 180m, M Hedin 23.ii.2008 [MY3632-34, 3637 3♀ 1juv, AUMNH]; Escondido Wild Animal Park, 33.0932, -116.98491, 191, USGS-BRD San Diego Field Sta. 1.xi.1998 [AP1151, 1♂, CAS]; Escondido Wild Animal Park, 33.0961, -116.981, 242m, USGS-BRD San Diego Field Sta. 1.i.2000 [AP1153, 1♂, CAS]; Escondido, San Diego Wild Animal Park, 33.0898, -116.98661, 201, USGS-BRD San Diego Sta. 1.ii.2001 [AP1016, 1♂, CAS]; Escondido, Wild Animal Park, 33.0932, -116.98491, 191m, USGS-BRD San Diego Field Sta. 1.ii.2001 [AP1150, 1♂, CAS]; Jamul Hollenbeck Canyon, E HWY 94, 32.6799, -116.82111, 245m, USGS-BRD San Diego Field Sta. 7.xi.2003 [MY1192, 1♂, CAS]; Jamul, S Sweetwater River & Steele Canyon jct, 32.7252, -116.94161, 129m, USGS-BRD San Diego Sta. 1.i.2001 [AP905, 1♂, CAS]; Jamul, S Sweetwater River & Steele Canyon jct, 32.7255, -116.94081, 118m, USGS-BRD San Diego Sta. 1.i.2000, [AP902, 903, 2♂, CAS]; Little Cedar Canyon, SE Otay Mountain, 32.6164, -116.86041, 443m, USGS-BRD San Diego Sta. 1.ii.1999 [AP884, 1♂, CAS]; Mission Valley, end of Hewlett Dr, 32.7625, -117.15655, 64m, S Johnson 25.iii.1971 [AP002, 2♂, AMNH]; NW upper Oso Reservoir, N El Toro Rd, 33.6653, -117.63841, 272m, USGS-BRD San Diego Field Sta. 1.i.2000 [AP1114, 1♂, CAS]; Otay Mesa, S HWY 905, 32.553, -117.00251, 134m, USGS-BRD San Diego Sta. 1.ii.2000 [AP1177, 1♂, CAS]; Palomar Mountain area Cleveland National Forest, State Rd S6, ~4.8km (road) SW intersection S6 & S7, 33.3048, -116.87864, 1275m, W Icenogle 15.vii.1970 [AP453, 1♀, AMNH]; Point Loma, Cabrillo National Monument, 32.667, -117.243, 89m, E Jones 8.iii.2002 [AP1243, 1♂, CAS]; S University of Irvine Campus, N Bonita Canyon, E Spring Canyon, 33.6357, -117.84591, 84m, USGS-BRD San Diego Field Sta. 1.ii.2000 [AP1179, 2♂, CAS], 1.xi.1998 [AP1178, 1♂, CAS]; Tenaja Rd, 2mi N Deluz, 33.4642, -117.33955, 198m, W Icenogle 19.ix.1968 [AP260, 1♀, 35juv, CAS]; Torrey Pines State Reserve, E beach, W North Torrey Pines Rd 2, 32.921, -117.25741, 54m, R Fisher 1.ii.2000 [AP863, 1♂, CAS]; Torrey Pines State Reserve, E beach, W North Torrey Pines Road 5, 32.9238, -117.2561, 70m, R Fisher 1.xi.1998 [AP866, 2♂, CAS]; Torrey Pines State Reserve, S Del Mar Heights School 10, 32.941, -117.25291, 73m, R Fisher 1.ii.2001 [AP857, 1♂, AUMNH], 1.xi.1998 [AP855, 1♂, CAS], 1.xii.1999 [AP856, 1♂, CAS]; Torrey Pines State Reserve, W of N Torrey Pines Rd, 32.9258, -117.25051, 11m, USGS-BRD San Diego Sta. 1.ii.2000, [AP1194, 1♂, CAS]; Torrey Pines State Reserve, W of N Torrey Pines Rd, 32.9252, -117.25251, 23m, USGS-BRD San Diego Field Sta. 1.xii.1999 [AP928, 1♂, CAS]; University of California Elliot Reserve, S Carroll Canyon, 32.8917, -117.09711, 194m, USGS-BRD San Diego Sta. 1.iv.2004 [AP879, 1♂, CAS]; vic. Chula Vista, 32.6405, -117.10413, 5m, R Fisher 21.ii.2000 [AP1249, 1♂, CAS]; Wildcat Canyon, 32.8831, -116.89675, 219m, 6.i.1962 [AP496, 1♂, AMNH]; Camp Pendleton Marine Corps Base, E DeLuz Creek Rd, SW Sandia Canyon, Pitfall array CAM-23, 33.4112, -117.2951, 337m, R Fisher [AP824, 1♂, CAS]; Carmel Mountain, 32.9366, -117.215081, 111m, USGS-BRD San Diego Sta. 1.xi.2002-1.xii.2002 [AP944-46, 3♂, CAS]; Flinn Springs, Rios Canyon, 32.8409, -116.86991, 295m, USGS-BRD San Diego Sta. 1.i.2001 [AP971, 1♂ 1juv, CAS]; Jamul, Hollenbeck Canyon, E HWY 94, 32.6799, -116.82111, 245m, USGS-BRD San Diego Sta. 27.v.2004 [AP1000, 1♀, CAS]; Jamul, Jamul Ecological Reserve, W HWY 94, near Dluzura Creek, 32.6665, -116.841, 288m, USGS-BRD San Diego Sta. 1.iii.2002 [AP972, 1♂, CAS]; Torrey Pines State Reserve, E of N Torrey Pines Rd, mouth Soledad Valley, 32.927, -117.25621, 16m, R Fisher 1.xi.1998 [AP867, 2♂, CAS]; Torrey Pines State Reserve, S Del Mar Heights School 3, 32.9398, -117.25181, 62m, R Fisher 1.ii.2001 [AP850, 1♂, CAS]; Torrey Pines State Reserve, W of N Torrey Pines Rd, 32.9148, -117.251, 98m, R Fisher 1.ii.2000 [AP844, 1♂, CAS]; San Luis Obispo Co.: 8km N Santa Margarita, 35.4694, -120.60176, 400m, D Marqua 26.xi.1970 [AP172, 1♂, AMNH]; Corrizo Plain, Soda Lake, 21km SE Simmler, 35.2509, -119.86325, 625m, D Giuliani 11.iii.1987 [AP570, 1♂, CAS]; Hwy 1 S jct Villa Creek Rd, 35.4682, -120.97585, 12m, W Icenogle 6.x.1970 [AP202, 3juv, AMNH]; Hwy 58, 4.1mi E Santa Margarita, 35.4169, -120.55721, 366m, M Hedin, P Paquin, J Starrett 5.iv.2003 [MY741, 745, 746, AP1200 2♀ 2juv, AUMNH], 11.x.2003, [MY2462, 1♀, CAS]; Morro Creek, off hwy 41, 14.5km W HWY 101, 35.4133, -120.80092, 85m, D Palmer, J Starrett 26.vi.2003 [MY2270, 2274, 1♀ 1juv, AUMNH]; See Canyon Rd, 2.9km N San Luis Bay Dr, 35.216, -120.72641, 65m, A Stockman 9.vii.2009 [MY3707, 3708, 2♀, AUMNH]; ~320m S jct Old Moonstone Beach Dr & HWY 1 on inland rd cut, 35.5836, -121.12061, 16m, J Bond 6.xii.2005 [MY3444-46, 2juv, 1♂, AUMNH]; San Simeon Creek Rd off Hwy 1, N Cambria, 35.6091, -121.08371, 40m, M Hedin, J Starrett, D Leavitt, D Carlson, B Keith 26.iii.2011 [MY3789, 1♀, AUMNH]; Toro Creek Rd off of Hwy 41, W of Atascadero, 35.4605, -120.76601, 350m, M Hedin, J Starrett, D Leavitt, D Carlson, B Keith 26.iii.2011 [MY3794, 4005, 4014, 3♀, AUMNH]; Upper Lopez Canyon Rd, E of Lopez Lake, 35.1896, -120.44511, 270m, M Hedin, J Starrett, D Leavitt, D Carlson, B Keith 25.iii.2011 [MY4015, 1♀, AUMNH]; La Panza CG, E La Panza, E Pozo Rd, 35.3531, -120.26331, 420m, M Hedin, L Hedin, J Satler, D Carlson 25.vii.2010 [MY3810, 1juv, AUMNH]; Santa Barbara Co.: Cave Canyon, Santa Barbara Island, 33.4777, -119.03054, 63m, M Ramirez 8.vii.1987 [AP439, 467, 480, 3♀, CAS]; Hot Springs, 34.503, -120.21865, 206m, F.J.M. 29.v.1969 [AP262, 1♀, AMNH]; Montecito, E Mountain Dr 1.4km from San Ysidro Rd jct, 34.4463, -119.63031, 118m, D Palmer, J Starrett 23.vi.2003 [MY2268, 1♀, AUMNH]; Point Sal, 34.9031, -120.66946, 52m, W Icenogle 12.viii.1978 [AP249, 3juv, AMNH]; Refugio Rd, 2.7km N HWY 101, 34.4927, -120.06581, 86m, A Stockman, A Bailey 9.vii.2009 [MY3711, 1♀, AUMNH]; Santa Barbara Island, Middle Canyon, 33.4756, -119.03537, 106m, M Ramirez 8.vii.1987 [AP192, 1♀, CAS]; Santa Barbara Island, near jct of all points, Arch, Signal Peak, & Elephant Seal Cove trails, 33.4758, -119.03725, 137m, M Ramirez 28.iii.1982 [AP298, 1♀, AMNH]; Santa Cruz Island, 33.9617, -119.78126, 3m, 12.ix.1982 [AP265, 1♀, CAS]; Santa Cruz Island, Central Valley, 34.0061, -119.75676, 230m, 10.ix.1982 [AP294, 1juv, AMNH]; Santa Cruz Island, Forney’s Cove, 34.0583, -119.9153, 15m, E Sleeper 15.iii.1969 [AP446, 1juv, AMNH]; Santa Rosa Island, 33.95, -120.16, 445m, M Thompson 13.ix.1974 [AP312, 2♀ 1juv, AMNH]; Santa Rosa Island Upper Torrey Pine area, 33.9839, -120.05995, 190m, M Ramirez, H David 10.viii.1994 [AP507, 1♀, CAS]; Sierra Madre Mountains, along HWY 166, 35.0663, -120.17381, 340m, J Bond, M van der Merwe 18.xii.1999 [MY0714, 1♀, AUMNH]; Signal Peak, W slope Santa Barbara Island, 33.4717, -119.03984, 174m, C Drost 24.vii.1981 [AP282, 1juv. CAS]; Vandenberg Air Force Base, Plot #6, 34.7422, -120.59744, 83m, 19.xi.2004 [MY2978, 2980, 2♂, CAS]; Jalama Rd, 7.5km E coast line, 34.5145, -120.45511, 83m, J Bond, A Stockman, D Beamer 17.iii.2005 [MY3417, 1♀, AUMNH; MY3419, 1♀, AMNH]; Tulare Co.: Kaweah Power Station #3, 36.488, -118.8376, 460m, D Burdick 4.vi.1983 [AP006, 1♂, CAS]; N base Case Mountain, 36.4218, -118.79371, 1646m, USGS-BRD San Diego Sta. 1.v.2002 [AP1166, 1♂, CAS]; SE side Case Mountain, 36.407, -118.80161, 1998m, USGS-BRD San Diego Sta. 1.ix.2003 [AP1176, 2♂, CAS]; Ventura Co.: Anacapa Island, 34.0044, -119.39865, 72m, M Thompson 2.iv.1968 [AP500, 1♀ 10juv, AMNH]; Hwy 150, W Ojai, N Dennison Park, 34.4407, -119.19761, 341m, A Stockman, A Bailey 11.vii.2009 [MY3726, 1♀, AUMNH]; Los Padres National Forest, 8.8km S Squaw Flats, 34.4557, -118.9226, 477m, Marqua 25.x.1970 [AP269, 1♀, AMNH]; Los Padres NF, Hwy 33, mile marker 17.92, N Ojai, 34.5071, -119.2891, 75m, A Stockman, A Bailey 9.vii.2009 [MY3714, 1♀, AUMNH]; W Anacapa Island, 34.012, -119.43734, 114m, M Ramirez 7.vii.1987, [AP440, 1♀, CAS]; Lockwood Valley Rd, 8km E int w/Hwy 33, N Wheeler Springs, 34.6895, -119.28001, 1217m, J Satler, J Grummer, J Nash 2.iv.2010 [MY3818, 1juv, AUMNH].

Variation, males (5). Cl 5.31-5.94, 5.70±0.11; Cw 4.25-5.13, 4.78±0.15; STRl 3.09-3.48, 3.24±0.07; STRw 1.60-2.94, 2.50±0.25; LBw 0.68-0.98, 0.81±0.05; LBl 0.30-0.53, 0.40±0.04; leg I: 5.19-6.00, 5.49±0.15; 3.44-4.25, 3.8±0.14; 3.38-4.25, 3.72±0.16; 2.10-2.73, 2.45±0.13; 1.89-2.97, 2.28±0.21; leg IV: 5.00-5.88, 5.41±0.16; 2.50-3.05, 2.79±0.11; PTl 2.34-2.76, 2.55±0.07; PTw 0.71-1.04, 0.89±0.06; Bl 1.13-1.26, 1.20±0.02; TSp 3-5, 4.4±0.4; TSr 3-5, 3.8±0.49; TSrd 4-5, 4.6±0.24.

Variation, females (5). Cl 9.13-10.0, 9.38±0.17; Cw 7.44-8.50, 8.02±0.21; STRl 5.13-5.81, 5.50±0.14; STRw 4.38-5.00, 4.64±0.13; LBw 1.44-1.71, 1.56±0.05; LBl 0.80-0.98, 0.87±0.03; Leg I: 19.82-22.63, 21.29±0.56; ANTd 7-8, 7.6±0.24; PTLs 10-15, 13.00±0.89; TBs 3-7, 5.00±0.84.

Figures 69–75.

Aptostichus atomarius Simon, 1891. 69–72 Specimen AP357 from San Bernardino Co., San Bernardino; scale bar = 1.0mm 69 retrolateral aspect leg I [805733] 70 prolateral aspect leg I [805737] 71 retrolateral aspect pedipalp [805743] 72 ventral aspect palpal bulb [805745] 73–75 line drawings of spination patterns on metatarsus and tibia, leg I, retrolateral aspect 73 Los Angeles Co., Baldwin Hills (AP181) 74 San Luis Obispo Co., San Luis Obispo (AP172) 75 Los Angeles Co., Eaton Canyon Park (AP157).

Figures 76–78.

Aptostichus atomarius cleared spermathecae; scale bar = 0.25mm. 76 Los Angeles Co., San Gabriel Canyon (MY2618) [806561] 77 Riverside Co., Winchester (MY2603) [806564] 78 San Bernardino Co., San Bernardino National Forest (AP724) [806567].

Figures 79–81.

Aptostichus atomarius specimens, live photographs. 79 MY3794 80 AUMS74 81 AUMS71.

GenBank accessions.

16S-tRNAval-12S: EU569971-EU569918, EU569964-EU569990, EU570023-EU570027, JX103256-JX103292; 18S (partial)-ITS1-5.8S-ITS2: EU569876-EU569879.

Distribution and natural history.

Aptostichus atomarius is widely distributed throughout southern California and has been collected in San Diego, Orange, Riverside, San Bernardino, Inyo, Los Angeles, Ventura, and San Luis Obispo counties (Map 2). Populations to the south are found throughout the Peninsular Ranges including the San Ysidro and Jamul Mountains, bounded to the east by the Laguna Mountain range. Moving northward in the Peninsular Ranges populations are abundant in the San Jacinto and Santa Ana Mountains. Like species described for the closely related genus Apomastus Bond and Opell 2002, Aptostichus atomarius was probably once more extensively distributed across the Los Angeles Basin but is now restricted to the steep ravines of the surrounding San Gabriel and Santa Monica Mountains and the Palos Verdes Hills along the coast. Populations to the north are distributed throughout the northeast extent of the Transverse Ranges bounded by the San Bernardino Mountains but extending northward along the coast in the Santa Ynez Mountains into the southernmost extent of the Coastal Ranges. A couple of morphologically similar specimens, collected from Tulare County in the southern extent of the Sierra Nevada Mountain range, are considered herein to be Aptostichus atomarius but will likely be removed to a separate species at a later date. From a geographical perspective it would seem reasonable to include these specimens in the Aptostichus dantrippi hypothesis, however, Aptostichus dantrippi individuals are distinctive morphologically and are considered a separate cohesion species at this time. Future molecular studies will likely resolve the placement of these outlier populations but until such data are available they are retained here as Aptostichus atomarius on the basis of their morphological affinity with all other specimens. Finally, a number of additional allopatric populations are found out on the Channel Islands and have likely been separated for a considerable amount of time but are likewise retained herein as Aptostichus atomarius until additional character systems can be employed to resolve their placement (or allocation to a new species).

The DM produced for this species (Map 3) shows the areas with the highest probability of predicted occurrence to be in the Peninsular and southernmost extent of the Transverse Ranges (around the Los Angeles Basin). Many of the populations in the desert to the east and the Coastal and Sierra Nevada Ranges to the north fall in areas predicted to have a very low probability of occurrence in the model, likely reflecting the fact that this species delineation comprises > 1 species.

In the Peninsular, Transverse, and Coastal Ranges, Aptostichus atomarius is restricted primarily to the California Coastal Range Open Woodland-Shrub-Coniferous and California Coastal Chaparral Forest and Shrub ecoregions. Vegetation types comprise mainly mixed chaparral, chamise-redshank chaparral, and coastal scrub. Male dispersal times are widely varied across specimens examined as part of this study. However, the majority of males were collected during the late fall to winter months of October through to March. Occasionally specimens have been collected during the summer months of June and August but these represent very rare occurrences. Females construct burrows that are typical for members of the genus.

Maps 2, 3.

Aptostichus atomarius Simon, 1891. 2 distribution of known specimens 3 predicted distribution; cooler colors–blue shades–represent areas of high probability of occurrence, warmer colors–yellow and orange shades–represent areas of low probability of occurrence.

Conservation status.

Aptostichus atomarius is widespread, abundant, and appears to thrive in moderately developed suburban areas throughout Southern California and thus is likely secure.

Species concept applied.

Morphological. Aptostichus atomarius presents a number of problems with respect to species delineation and diagnosis and thus is delineated herein as a single morphologically distinguishable species with the expectation that it will be further divided at some point in the future on the basis of other criteria.


The type locality of Aptostichus atomarius as “San Bernardino” coupled with the relatively similar morphology of Aptostichus atomarius and Aptostichus icenoglei females contributes some uncertainty to the identity of the species attributed to this name. That is, without a more specific locality or the ability to recover DNA for molecular studies from the type specimen, the Aptostichus atomarius type could potentially be either. However, as discussed in the diagnosis the sternum of Aptostichus icenoglei is subtlety narrower than that of Aptostichus atomarius. Based on my morphological and molecular surveys of many specimens of both species I feel confident that Aptostichus atomarius, as described by Simon, is correctly attributed to the specimens I have identified as such. Second, as mentioned above, the molecular data indicate that the Aptostichus atomarius specimens listed in the material examined section above likely comprise a number of additional species. However, the data and sampling currently on hand are, in my opinion, insufficient to further split this complex into species lineages. Future studies of the entire Atomarius species complex will address these issues.

Aptostichus stephencolberti Bond, 2008

‘The Stephen Colbert Trapdoor Spider’



Figures 82–90, Maps 4, 5
Aptostichus stephencolberti Bond, 2008: 646. Male holotype (MY3515, EU570029) and female paratype (MY3513, EU570028), California, San Mateo Co., Pescadero State Beach, 37.26598, -122.412191, elev. 3m, coll. A. Stockman & P. Marek, 29.i.2008, in CAS, examined.

Individuals of this species are difficult to distinguish from other Atomarius Sibling Species Complex members on the basis of morphological features (Figs 82–90) alone but can be diagnosed on the basis of a set of unique mtDNA site substitutions (see Bond and Stockman 2008). The species is restricted in distribution to the coastal dune habitats of Monterey, Santa Cruz, San Mateo, and San Francisco Counties (California; Maps 4, 5) and is much lighter in coloration (Figs 88–90) than species found in inland habitats (e.g., Aptostichus atomarius, Aptostichus angelinajolieae, and Aptostichus stanfordianus).


Described by Bond (2008).

Material examined.

United States: California: Monterey Co.: Asilomar St Beach, 36.6221, -121.93913, 8m, W Icenogle 14.x.1971 [AP463-64, 3♀, 7juv, CAS]; Asilomar St Beach, 36.6236, -121.94051, 3m, J Bond 15.v.1997, [AP800-802, 812-13, 2♀4juv, AUMNH]; 2.5km S Marina Ranger Station, 36.6969, -121.80881, 14m, J Bond 16.v.1997 [AP803, 814-16, 4juv, AUMNH]; end Dunes Rd, N Marina St Beach, 36.7068, -121.8071, 8m, J Bond, W Bond 27.vii.2008 [MY3750-51, 2♀, AUMNH]; dunes Marina Beach, 36.705, -121.80771, 3m, J Bond 4.v.1997 [AP772-74, 13♀, AUMNH]; Marina Beach (dunes across from RV park), 36.7033, -121.80631, 7m, J Bond 2-3.iv.1996 [AP711 722, 739-40, 748, , 4♀, 1juv, AUMNH]; Marina Beach dunes, 36.703, -121.8081, 13m, J Bond 2.iv.1996 [AP736, 1♀, AUMNH]; Marina State Beach, 36.6973, -121.80924, 12m, M Ramirez 16.v.1983 [AP278, 1juv, AMNH], 28.x.1984 [AP468, 1♀, AMNH], E Schlinger 23.iv.1970 [AP485, 2♀, SCW]; Marina Dunes Natural Preserve, 36.6905, -121.81052, 3m, J Bond, D Beamer, A Stockman 17.iii.2005 [MY3069-70, 1♀ 1juv, AUMNH]; Moss Landing St Beach, 36.8086, -121.78831, 3m, J Bond 14.iv.1997 [AP1265, 1♀, AUMNH]; Moss Landing St Beach, 36.8155, -121.791, 0m, M Hedin, M Lowder 28.vi.2000 [AP1267, 1♀, AUMNH], J Bond 21.xii.1997 [AP706, 1♀, AUMNH]; Point Sur Lighthouse, 36.3062, -121.89711, 0m, M Hedin, M Lowder 29.vi.2000 [AP1252, MY699–MY701, 3♀, 2juv, AUMNH]; Salinas River St Beach, 36.7823, -121.79391, 9m, W Icenogle 14.x.1999 [MY0713, 1♀, CAS]; Salinas River St Beach, 36.7831, -121.79441, 3m, J Bond 17.v.1997 [AP758-60, AP804, 4juv, AUMNH], 6.v.1997 [AP778, 1juv, AUMNH]; Salinas River St Beach, Molera Rd Parking Lot, 36.7752, -121.7964, 6m, M Ramirez 16.iv.1983 [AP258, AP306, 2♀, AMNH]; Salinas River St Beach, 36.7855, -121.79453, 3m, A Stockman, P Marek 28.i.2006 [MY3489-91, 3juv, AUMNH]; Salinas River St Beach, 36.7907, -121.79191, 3m, J Bond 8.xii.2005 [MY3455-57, 2♀, 1juv, AUMNH]; Zmudowski St Beach, 36.8436, -121.80412, 3m, J Bond 15.v.1997 [AP797-99, 809-11, 5♀, 1juv, AUMNH]; Zmudowski St Beach, 36.8358, -121.8021, 3m, J Bond 8.xii.2005 [MY3461-63, 2♀, 1juv, AUMNH]; Pfeiffer Beach, 36.2384, -121.81542, 6m, J Bond 7.xii.2005 [MY3451, 1juv, AUMNH]; San Francisco Co.: Ft Funston National Recreation Area, 37.7231, -122.50433, 31m, M Ramirez 23.vi.1988 [AP196, 1♀, CAS]; Ft Funston National Recreation Area, 37.7121, -122.50141, 48m, A Stockman, P Marek 30.i.2006 [MY3517-20, 1♀, 3juv, AUMNH]; San Francisco, near jct Lincoln Way & 46 Ave, 37.7642, -122.50623, 16m, L Trautz 1.x.1969 [AP1273, 1♀, SCW)]; Petrel Bluff, 37.6978, -123.00177, 3m, M Ramirez 30.vii.1986 [AP156, 1♂, CAS]; San Francisco, Baker Beach, 37.792, -122.4844, 7m, D Ubick 8.iii.1980 [AP301, 3♀, CAS]; San Francisco, Sunset District, 37.7601, -122.48775, 71m, J McNally 3.x.1969 [AP255, 1♀, CAS]; San Mateo Co.: Gazos Creek Coastal Access off HWY 1, 37.1659, -122.36253, 10m, M Thompson 17.ix.1976 [AP1278, 2♀, 1♂, CAS]; Ano Nuevo St Reserve, 37.1165, -122.32771, 1m, M Hedin, M Lowder 28.vi.2000 [MY698, AP1253, 1♀, 3juv, AUMNH]; Ano Nuevo St Reserve, Cascade Creek Trail, 37.139, -122.34032, 3m, A Stockman, P Marek 29.i.2006 [MY3509, 1♀, AUMNH]; Ano Nuevo St Reserve, Franklin Point Trail, 37.1551, -122.35551, 7m, A Stockman, P Marek 29.i.2006 [MY3510-12, 2♀, 4juv, AUMNH; 1juv, AUMNH]; Pescadero St Beach, 37.2659, -122.41211, 4m, A Stockman, P Marek 29.i.2006 [MY3513-16, 2♀, 2♂, AUMNH]; San Luis Obispo Co.: S Morro Bay, 0.64km N parking lot, 35.3136, -120.76794, 24m, W Icenogle 16.x.1999 [MY712, 1♀, CAS]; Santa Cruz Co.: Younger Lagoon, 36.9508, -122.06584, 11m, M Ramirez 27.vii.1987 [AP437, 1juv, CAS]; Bonny Doon Beach W Bonny Doon Rd, 37.0003, -122.1811, 8m, A Stockman, P Marek 29.i.2006 [MY3501-04, 2♀ 2juv, AUMNH]; Sunset St Beach, 36.878, -121.82611, 1m, A Stockman, P Marek 28.i.2006 [MY3492-97 1♀, 5juv, AUMNH]; Waddell Creek Beach, 37.0953, -122.2771, 11m, A Stockman, P Marek 29.i.2006 [MY3505, 08, 3♀ 1juv, AUMNH]; Wilder Ranch St Park, parking area N main entrance, 36.9668, -122.12281, 4m, A Stockman, P Marek 29.i.2006 [MY3498-500, 3♀, AUMNH; MY3499, 1♀, AUMNH].

Variation, males (3). Cl 5.65-6.38, 6.09±0.22; Cw 4.85-5.63, 5.37±0.26; STRl 3.10-3.60, 3.28±0.16; STRw 2.76-3.25, 3.00±0.14; LBw 0.85-0.94, 0.91±0.03; LBl 0.51-0.53, 0.52±0.01; leg I: 5.10-5.50, 5.33±0.12; 3.25-3.75, 3.53±0.15; 3.25-3.75, 3.53±0.15; 2.00-2.35, 2.23±0.12; 1.75-2.25, 2.08±0.17; leg IV: 5.00-5.25, 5.15±0.08; 2.35-3.00, 2.70±0.19; PTl 2.25-2.50, 2.42±0.08; PTw 0.85-1.00, 0.93±0.04; Bl 1.05-1.45, 1.29±0.12; TSp 3-6, 4.33±0.88; TSr 0-6, 3.00±1.73; TSrd 4-8, 5.67±1.20.

Variation, females (5). Cl 7.20-9.00, 7.98±0.32; Cw 6.56-7.90, 7.39±0.23; STRl 3.90-5.15, 4.63±0.22; STRw 3.70-4.75, 4.31±0.17; LBw 1.28-1.70, 1.50±0.07; LBl 0.85-1.02, 0.94±0.04; Leg I: 14.05-20.51, 17.74±1.08; ANTd 6-10, 7.60±0.81; PTLs 16-29, 20.40±2.38; TBs 5-11, 7.20±1.11.

Figures 82–87.

Aptostichus stephencolberti Bond, 2008. 82 male habitus from San Francisco Co. (AP156) [805762] 83–85 male holotype from San Mateo Co., Pescadero State Beach (MY3515); scale bar = 1.0mm 83 retrolateral aspect leg I [805751] 84 prolateral aspect leg I [805747] 85 retrolateral aspect pedipalp [805753] 86 female habitus from Santa Cruz Co., Waddell Creek Beach (MY3508) [805758] 87 cleared spermathecae, from San Luis Obispo Co., Wilder Ranch State Beach (MY3500) [805754]; scale bar = 0.25mm.

Figures 88–90.

Aptostichus stephencolberti specimens, live photographs. 88 male holotype from San Mateo Co., Pescadero State Beach (MY3515) 89, 90 specimens from Monterey Co., Marina Dunes State Park (AUMS20).

GenBank accessions.

16S-tRNAval-12S: EU569930-EU569939, EU570008-EU570021, EU570028-EU570031, JX103357- JX103366; 18S (partial)-ITS1-5.8S-ITS2: EU569888-EU569892.

Distribution and natural history.

Aptostichus stephencolberti is distributed throughout the coastal dune habitats of San Francisco, San Mateo, Santa Cruz, and Monterey Counties with a single population recorded from San Luis Obispo County (Map 4). Individuals are found in relatively deep burrows on the steep faces of sand dunes and at the base of coastal vegetation. Burrows comprise a thick silk lining and are covered by a very cryptic trapdoor constructed of silk and sand. Dune habitats disturbed by high concentrations of the invasive Carpobrotus edulis (ice plant) tend to lack Aptostichus stephencolberti individuals entirely. The DM for this species (Map 5) follows closely with the known distribution to include the southernmost-recorded locality for the species. Wandering males (2) have been collected in August and September; two males have been collected from burrows in January.

Maps 4, 5.

Aptostichus stephencolberti, Bond 2008. 4 distribution of known specimens 5 predicted distribution; cooler colors–blue shades–represent areas of high probability of occurrence, warmer colors–yellow and orange shades–represent areas of low probability of occurrence.

Conservation status.

Aptostichus stephencolberti is generally abundant at localities along the California coast (Map 4). However, the species is particularly vulnerable to invasive plant species (e.g., ice plant, Carpobrotus edulis) and is highly structured genetically across its distribution thus many populations contain unique alleles (Bond and Stockman 2008). Moreover, divergent populations at the southernmost extent of the distribution comprise very few individuals (specimens are rare, despite extensive searching). Consequently, I would consider this species to be apparently secure or vulnerable, contingent upon future delimitation of divergent lineages as nominal taxa.

Species concept applied.

Cohesion. Aptostichus stephencolberti is considered to be ecological non-interchangeable from other closely related lineages–it is restricted to coastal dune habitat and has psammophilic features (e.g., lighter coloration).

Aptostichus angelinajolieae Bond, 2008

‘The Angelina Jolie Trapdoor Spider’



Figures 91–97, Maps 6, 7
Aptostichus angelinajolieae Bond, 2008: 646. Female holotype (MY3310; EU569958), California, Monterey Co., Carmel Valley Rd/G16, 5.9km N of Arroyo Seco Rd, 36.29045, -121.465941, elev. 337m, coll. A. Stockman 9.vi.05, in CAS; male paratype (AP167) from Carmel, 36.5495, -121.91036, elev. 74m, coll. 8.ii.54, in AMNH examined.

Individuals of this species are difficult to diagnose from Aptostichus atomarius and Aptostichus stanfordianus on the basis of morphological features alone (Figs 91–94) but can be diagnosed on the basis of a set of unique mtDNA site substitutions (see Bond & Stockman 2008). The species is restricted in distribution to northern Monterey Co. (California) localities west of the Salinas Valley (Maps 6, 7) and can be distinguished from geographically proximate populations of Aptostichus stephencolberti on the basis of its darker coloration (Figs 95–97) and absence from coastal dune habitat.


Described by Bond (2008).

Material examined.

United States: California: Monterey Co.: 1.6km W Seaside, 36.6227, -121.83635, 30m, M Irwin 23.viii.68 [AP289, 3juv, AMNH]; 2.2km from intersection G16/Carmel Valley Rd & Cachagua Rds on Cachagua Rd, 36.4411, -121.68771, 387m, J Bond 5.v.97 [AP754-76, 2♀, AUMNH; 1♀, AMNH]; 24km W Greenfield on Arroyo-Seco Rd, 36.2263, -121.49475, 300m, W. Icenogle 31.v.74 [AP193, 2♀, CAS]; Aguajito Rd & Monhollan Rd jct, 36.5753, -121.87371, 56m, A Stockman 10.vi.05 [MY3317, 1♀, AMNH; MY3318, 3380 2♀, AUMNH]; Cachagua Rd, 160m W jct w/ Carmel Valley Rd, 36.4455, -121.68271, 191m, A Stockman 10.vi.05 [MY3311-13, 2juv, 2♀, AUMNH]; Cachagua Rd, 13.7km W jct w/ Carmel Valley Rd, 36.392, -121.62521, 333m, A Stockman 10.vi.05 [MY3315, 3316 2♀, AUMNH]; Cachagua Rd, just S intersection w/G16, 36.4447, -121.68551 1, 245m, M Hedin, J Starrett, D Leavitt 21.xii.07 [MY3620, 3626, 3627, 3630, 3631, 2♀ 1♂ 2juv, AUMNH]; Cachagua Rd, 160m from jct Carmel Valley Rd, 36.4454, -121.68331, 225m, J Bond, M van der Merwe 13.xii.99 [MY708, 716 2♀, AUMNH]; J Bond, M van der Merwe 13.xii.99 [MY716, 1♀, AUMNH]; Calera Canyon Rd, 1.6km S Corral De Tierra Rd, 36.5383, -121.73761, 137m, A Stockman 10.vi.05 [MY3319, 3321 2♀, AUMNH; MY3320, 1♀, AMNH]; Carmel, 36.5495, -121.91036, 74m, 25.vii.67 [AP155, 1♂, AMNH], 8.ii.54 [AP167, 1♂, AMNH], 5.x.58 [AP177, 1♂, AMNH], V Roth 21.xii.53 [AP267, 2juv, AMNH]; Carmel Valley Rd, 36.4511, -121.69191, 165m, A Stockman 15.v.05 [MY3129-3131 3♀, AUMNH]; Carmel Valley Rd (G16), 1.3km N Tassajara Rd, 36.4096, -121.59344, 426m, J Starrett 29.xi.03 [AP1198, 1♀, AUMNH]; Carmel Valley Rd/G16, 5.9km N Arroyo Seco Rd, 36.2904, -121.46591, 337m, A Stockman 9.vi.05 [MY3309, 3310 2♀, AUMNH]; County Rd G16, 17.7km S Martin Rd intersection, 36.2776, -121.45035, 335m, F Coyle 30.vii.72 [AP268, 1♀, AMNH]; Cachagua Rd 6.5 miles SE Carmel Valley Village, 4.2km S intersection w/Carmel Valley Rd, 36.4278, -121.68254, 460m, W Icenogle 2.vi.74 [AP279, 1♀, CAS]; G20 (Laureles Grade Rd), ~1.3km S Laureles Summit, 36.524, -121.75581, 315m, M Hedin, J Starrett, D Leavitt 21.xii.07 [MY3623, 3628 2♀, AUMNH]; Intersection of Valenzuela & Viejo Rds, 36.5761, -121.89981, 120m, J Bond 1.iv.96 [AP723, 727 1♀ 1juv, AUMNH], 2.iv.96 [AP742, 1♀, AUMNH], 5.v.97 [AP751, 752-3, 6, 2juv, 2♀, AUMNH]; Klondike Rd, 6.4km E G16/Carmel Valley Rd, 36.4731, -121.7071, 169m, J Bond, W Bond 27.vii.08 [MY3736, 1♀, AUMNH]; Monterey, ~100m N intersection Vieja & Valenzuela Rds, 36.5759, -121.89961, 91m, M Hedin, P Paquin, J Starrett 27.vii.02 [MY0632, 1♀, AUMNH]; Near jct Cachagua & Tassajara Rds, 36.3908, -121.59554, 410m, W Icenogle 2.vi.74 [AP277, 1♀, CAS]; Pacific Grove, 36.628, -121.92536, 30m, 7.xi.53 [AP163, 1♂, AMNH], W Ivie 1.ix.37 [AP274, 1juv, AMNH], 16.viii.31 [AP472, 1♀, 6juv, AMNH]; Palo Colorado Rd, 1.4km E Hwy 1, near Rocky Point, 36.3997, -121.89141, 105m, J Bond, A Stockman, D Beamer 17.iii.05 [MY3057, 3060, 2♀, AUMNH]; Pebble Beach, 36.5688, -121.94786, 25m, W Icenogle 1.vi.74 [AP291, 1♀, AMNH]; Sycamore Canyon Rd ~0.72km W jct HWY 1, 36.2418, -121.78411, 104m, J Bond 7.xii.05 [MY3452-54, 2♀ 1juv, AUMNH]; Viejo Rd, 36.5778, -121.900765, 138m, W Icenogle 1.vi.74 [AP197, 1♀, 3juv, CAS].

Variation, males (5). Cl 5.81-7.50, 6.30±0.31; Cw 5.00-6.19, 5.34±0.22; STRl 3.20-4.19, 3.49±0.18; STRw 2.70-3.27, 2.90±0.1; LBw 0.85-1.02, 0.94±0.04; LBl 0.43-0.63, 0.56±0.04; leg I: 5.25-6.44, 5.58±0.22; 3.50-4.25, 3.73±0.14; 3.65-4.44, 3.91±0.15; 2.25-2.61, 2.34±0.07; 1.75-2.55, 2.25±0.14; leg IV: 5.06-6.25, 5.43±0.28; 2.50-3.13, 2.81±0.13; PTl 2.51-3.00, 2.72±0.08; PTw 0.76-1.02, 0.89±0.04; Bl 1.19-1.49, 1.32±0.05; TSp 3-6, 4.20±0.58; TSr 3-5, 4.20±0.37; TSrd 4-5, 4.40±0.24.

Variation, females (5). Cl 6.69-8.96, 7.55±0.45; Cw 5.31-8.16, 6.50±0.53; STRl 3.75-5.70, 4.41±0.39; STRw 3.12-4.75, 3.70±0.33; LBw 1.07-1.55, 1.31±0.1; LBl 0.71-1.19, 0.93±0.08; Leg I: 14.56-20.94, 17.27±1.32; ANTd 6-8, 7.20±0.37; PTLs 14-17, 15.00±0.55; TBs 2-5, 3.00±0.55.

Figures 91–94.

Aptostichus angelinajolieae Bond, 2008. 91–93 male paratype from Monterey Co., Carmel (AP167); scale bars = 1.0mm 91 retrolateral aspect right leg I [805766] 92 prolateral aspect right leg I [805770] 93 retrolateral aspect pedipalp [805772] 94 cleared spermathecae, female holotype from Monterey Co., Carmel Valley (MY3310) [805773]; scale bar = 0.25mm.

Figures 95–97.

Aptostichus angelinajolieae specimens from Monterey Co., Monterey, live photographs. 95 female specimen (AUMS62) 96, 97 malespecimen (MY3630) 97 close up shot of leg I, retrolateral aspect, in life.

GenBank accessions.

16S-tRNAval-12S: EU569940-EU569958, EU569991, JX103243-JX103249; 18S (partial)-ITS1-5.8S-ITS2: EU569880-EU569883.

Distribution and natural history.

Aptostichus angelinajolieae is restricted in distribution to the Santa Lucia Range of Monterey County (Map 6), bounded to the east by the Salinas River Valley (SRV). The ecoregion is characterized as California Coastal Chaparral Forest and Shrub. As discussed in Bond and Stockman (2008) the DM (Map 7) predicts the areas with the highest probability of occurrence in the regions east of the SRV, with the valley likely serving as a barrier to dispersal. The few male specimens known were collected during the late fall through winter months (October–December, February), with one specimen collected in July that molted to the final adult stage a month later in August. Female specimens are frequently found on shaded, damp steep banks and road cuts throughout the region. Burrows are generally shallow comprising a white silken lined retreat, covered by a thin silk-soil trapdoor.

Maps 6, 7.

Aptostichus angelinajolieae Bond, 2008. 6 distribution of known specimens 7 predicted distribution; cooler colors–blue shades–represent areas of high probability of occurrence, warmer colors–yellow and orange shades–represent areas of low probability of occurrence.

Conservation status.

The conservation status of Aptostichus angelinajolieae is likely classified as secure because it is widespread, abundant, and appears to thrive in moderately developed residential areas.

Species concept applied.

Cohesion. Aptostichus angelinajolieae is considered a cohesion species on the basis of it exclusivity as a lineage in DNA studies and lack of genetic exchangeability (gene flow) with other Atomarius Sibling Species Complex lineages as a consequence of the SRV barrier to gene flow.

Aptostichus miwok Bond, 2008

‘The Miwok Trapdoor Spider’



Figures 98–105, Map 8, 9
Aptostichus miwok Bond, 2008: 646. Female holotype (MY301; EU69907) from California, Humboldt Co., Clam Beach Co. Park, just S Crannell Rd exit on Clam Beach Dr, near Little River, 41.01333, -124.109231, elev. 3m, coll., J. Bond & M. Hedin 13.i.02 in CAS, examined; male paratype (AP149) from Farallon Island, San Francisco Co., California, in CAS, examined).

Based on morphological features alone (Figs 98–103) this species can be difficult to diagnose from geographically proximate sibling species, Aptostichus stanfordianus, Aptostichus angelinajolieae, and Aptostichus stephencolberti but can be distinguished on the basis of a set of unique mtDNA nucleotide substitutions (see Bond and Stockman 2008). The species is restricted in distribution to the coastal dune habitats of Marin, Sonoma, Mendocino, Humboldt, and Del Norte Counties (California). Individuals of Aptostichus stanfordianus, found only in inland habitats, are much darker in coloration whereas Aptostichus miwok specimens are much lighter (Figs 104, 105).


Described by Bond (2008).

Material examined.

United States: California: Del Norte Co.: Smith River St Park, Beach 1km W Kellogg Rd from Lower Lake Rd, 41.8695, -124.20731, 0m, J Bond, M Hedin 14.i.02 [MY290-93, 95, 3♀ 2juv, AUMNH]; Humboldt Co.: ~3.2km W Arcata, Lanphere-Christensen Dune Preserve, 40.8823, -124.14783, 3m, E Schlinger 26.vii.75 [AP522, 1♀, CAS]; Clam Beach Co Park, just S Crannell Rd exit on Clam Beach Dr, near Little River, 41.0133, -124.10921, 3m, J Bond, M Hedin 13.i.02 [MY300-04, 5♀, AUMNH]; S Spit Humboldt Bay, 40.6979, -124.27251, 0m, M Hedin, M Lowder 22.vi.00 [MY702-04, 3♀, AUMNH]; S Spit Humboldt Bay, S Eureka, 40.6992, -124.27381, 3m, M Hedin, R Keith, S Thomas, J Starrett 14.iii.06 [MY3542-46, 4♀, 1juv, AUMNH]; Trinidad, 41.0571, -124.14195, 8m, B Malkin 29.v.69 [AP266, 1♀, AMNH]; Hwy 96, N of Willow Creek, 41.0096, -123.64551, 210m, J Bond, A Stockman, D Beamer 15.iii.05 [MY3052, 1juv, AUMNH]; Marin Co.: Dillon St Beach, 38.2494, -122.96751, 3m, J Bond 14.v.97 [AP763, 764, 793, 805, 4juv, AUMNH]; N Beach, P Reyes Natl Seashore, 38.0011, -122.99735, 30m, E Rogers, 13.v.72 [AP465, 1♀, SCW]; E Schlinger 14.vi.75 [AP469, 1♀, CAS]; C Griswold 31.iii.75 [AP476, 1♀, CAS]; [AP479, 1♀, AMNH]; C Griswold 16.viii.81 [AP499, 1♀, CAS]; H Ewing 14.v.71 [AP1276, 1juv, CAS]; Pt Reyes Natl Seashore, 38.0262, -122.88313, 3m, J Cate 12.v.73 [AP1274, 1juv, CAS]; Dillon Beach, 38.2499, -122.96762, 1♂, A Stockman, P Marek 30.i.06 [MY3528, 1juv, AUMNH]; Pt Reyes Natl Seashore Kehoe Beach, 38.1553, -122.94831, 9m, A Stockman, P Marek 30.i.06 [MY3524-27, 1♀ 1♂ 3juv, AUMNH]; Pt Reyes Natl Seashore, Limantour Beach, 38.0262, -122.88311, 3m, A Stockman, P Marek 30.i.06 [MY3521-23, 2♀, 1 juv, AUMNH]; Mendocino Co.: 6.4km N Ft Bragg, Inglenook Fen area, 39.5304, -123.77123, 12m, L Keram 11.iv.73 [AP520, 1♀, CAS]; E Schlinger 17.vi.73 [AP521, 1♀, CAS]; Hwy 1, just S Ten Mile River crossing, N Ingelnook, dunefield W hwy, 39.5476, -123.76311, 5m, M Hedin, J Starrett 13.iii.06 [MY3538-41, 3♀ 1juv, AUMNH]; Inglenook Dunes, 39.5304, -123.77123, 10m, R Jackson 1.xi.74 [AP1269, 1♂, CAS], 19.iv.75 [AP1270, 1♂, CAS]; E Schlinger 30.iv.73 [AP1271, 1juv, CAS], 22.vii.72 [AP1272, 3juv, CAS]; N Inglenook Sand Dunes, 39.5422, -123.76181, 37m, J Bond, A Stockman, D Beamer 14.iii.05 [MY3049, 1juv, AUMNH]; San Francisco Co.: Petrel Bluff, 37.6978, -123.00177, 3m, M Ramirez 31.viii.86 [AP498, 5♀, 2juv, CAS]; SE Farallon Island, 37.6978, -123.00244, 7m, M Ramirez 1.ix.86 [AP438, 5♂, CAS], 2.ix.86 [AP475, 482, 149, 1♂ 2♀, CAS; AP491, 1juv, AMNH], 2.ix.88 [AP492, 2♀, AMNH], 1.ix.88 [AP007, 1♀, CAS], 30.viii.88 [AP189, 8♀, AMNH]; P Anderson 20.xii.56 [AP481, 1♀, 2juv, AMNH]; W Azevedo 12.iv.70 [AP494, 3♀, AMNH]; D Spadoni 10.iii.69 [AP505, 1♀ 1♂ 1juv, CAS]; D Hanna 6.v.49 [AP483, 2juv, AMNH]; H Leech 18.xi.49 [AP484, 6juv, AMNH]; W Hazeltine 23.x.51 [AP486, 2juv, AMNH]; H Keifer 15.x.26 [AP487, 1juv, AMNH]; E Bixford 17.iv.29 [AP502, 1♀, AMNH]; Sonoma Co.: Bodega Bay Dunes, 38.3137, -123.03913, 1m, R Robertson 16.ix.92 [AP493, 1♂, CAS]; Sonoma Coast St Beach, Bodega Dunes, 38.3389, -123.061491, 47m, A Stockman, P Marek 30.i.06 [MY3529-32, 4juv, AUMNH].

Variation, males (4). Cl 4.50-5.94, 5.35±0.30; Cw 4.25-5.00, 4.65±0.18; STRl 2.48-3.04, 2.78±0.13; STRw 2.33-2.73, 2.52±0.08; LBw 0.85-0.87, 0.86±0.01; LBl 0.43-0.60, 0.50±0.04; leg I: 4.10-5.30, 4.76±0.26; 2.48-3.50, 3.10±0.23; 2.36-3.30, 3.00±0.22; 1.52-2.00, 1.81±0.11; 1.55-2.05, 1.87±0.11; leg IV: 3.80-5.05, 4.44±0.26; 2.00-2.50, 2.25±0.1; PTl 1.85-2.38, 2.21±0.13; PTw 0.71-0.85, 0.79±0.03; Bl 0.85-1.17, 1.04±0.07; TSp 4-6, 4.75±0.48; TSr 1-3, 2.25±0.48; TSrd 4-5, 4.75±0.25.

Variation, females (5). Cl 6.06-7.00, 6.51±0.19; Cw 5.69-6.40, 6.01±0.14; STRl 3.32-4.00, 3.69±0.12; STRw 3.29-3.75, 3.50±0.10; LBw 1.11-1.36, 1.24±0.05; LBl 0.68-0.94, 0.81±0.05; Leg I: 13.00-16.15, 14.30±0.59; ANTd 5-8, 6.80±0.49; PTLs 16-25, 21.80±1.59; TBs 3-6, 5.20±0.58.

Figures 98–103.

Aptostichus miwok Bond, 2008. 98 male habitus from Mendocino Co., Inglenook Dunes (AP1270) [805812] 99–101 male paratype (AP149) from San Francisco Co., Farallon Islands; scale bars = 1.0mm 99 retrolateral aspect, leg I [805801] 100 prolateral aspect, leg I [805797] 101 retrolateral aspect, pedipalp [805803] 102 female habitus from Mendocino Co., Inglenook Dunes (AP520) [805808] 103 spermathecae, female holotype (MY301) [805804]; scale bar = 0.10mm.

Figures 104, 105.

Aptostichus miwok from Mendocino Co., Inglenook Dunes area, live photographs. 104 male specimen (AUMS18) 105 female specimen (AUMS16).

GenBank accessions.

16S-tRNAval-12S: EU569901-EU569910, EU569919-EU569921, EU569922, EU569927-EU569929, EU570022, EU570035, JX103340-JX103353; 18S (partial)-ITS1-5.8S-ITS2: EU569893, EU569894.

Distribution and natural history.

Aptostichus miwok is distributed throughout the geographically disjunct coastal dune habitats of Del Norte, Humboldt, Mendocino, Sonoma, Marin, and San Francisco counties of central and northern California (Map 8). A single inland specimen (Humboldt) is placed with this species on the basis of the molecular data. The DM for Aptostichus miwok (Map 9) corresponds closely to the known occurrences with the largest areas of high probability of occurrence in the more northern extent of the species’ distribution. The model indicates that inland localities may be suitable despite the paucity of known inland populations. The habitat requirements and general burrow structure is very similar to that described for Aptostichus stephencolberti. All populations are located in the coastal dune habitat. Males have been collected in the months of September, November, January, March, and April.

Maps 8, 9.

Aptostichus miwok Bond 2008. 8 distribution of known specimens 9 predicted distribution; cooler colors–blue shades–represent areas of high probability of occurrence, warmer colors–yellow and orange shades–represent areas of low probability of occurrence.

Conservation status.

Aptostichus miwok is abundant and widespread across its distribution and thus is likely classified as secure.

Species concept applied.

Cohesion. Aptostichus miwok is considered to be ecological non-interchangeable from other closely related lineages–it is restricted to coastal dune habitat and has psammophilic features (e.g., lighter coloration).


The recognition of Aptostichus miwok by Bond and Stockman (2008) as a species renders one of the Aptostichus stanfordianus lineages paraphyletic (Fig. 28). While this is somewhat problematic, I have chosen to uphold this decision because of the adaptive diversity contained within the nominal Aptostichus miwok lineage and apparent lack of both genetic and ecological interchangeability between this lineage and Aptostichus stanfordianus.

Aptostichus stanfordianus Smith, 1908

‘The Stanford Hills Trapdoor Spider’



Figures 106–114, Map 10, 11
Aptostichus stanfordianus Smith, 1908: 221. Female holotype, specimen no. 102 deposited in the Entomological Museum of Stanford University, presumed lost.
Type material.

Specimens described by Smith (1908) and deposited in the “Entomological Museum of Stanford University” have long been considered to be lost (e.g., Coyle 1974). To clarify the taxonomic status of the species, I designate herein a neotype because the name-bearing type specimen is believed to no longer exist. Female neotype(MY3248; EU570032, EU569895) designated from California, San Mateo Co., Hwy 92, 1.5km E of HWY 1, 37.48452, -122.399261, elev. 76m, coll. A. Stockman 2.vi.05, deposited in AUMNH. Based on the evidence, Smith’s (1908) drawings and documentation of locality data for the species, I am reasonably confident that designation of this specimen as the neotype is consistent with what is known of the former name-bearing type. The locality from which the neotype was collected is ~20km to the west of Smith’s type locality, described as “Stanford Estate” near Stanford University; considerable development has occurred in this region over the last century and specimens from the direct vicinity of Stanford University are not available. Smith noted collecting specimens, for the series on which Aptostichus stanfordianus was described, from points to the west below ~121m in elevation. The carapace length and width for the neotype are noted in the variation section below (enclosed in brackets [ ]) and a complete set of measurements are archived in the Dryad Data Repository at doi: 10.5061/dryad.3b95n; specimen coloration is similar to that illustrated in figure 110. As noted above, GenBank accession numbers EU570032 (12S-tRNA-val-16S) and EU569895 (18S (partial)-ITS1-5.8S-ITS2) are attributed to this specimen.


Individuals of this species are particularly difficult to distinguish morphologically (Figs 106–112) from Aptostichus angelinajolieae specimens but were diagnosed on the basis of a unique set of mtDNA nucleotide substitutions documented in Bond and Stockman (2008; but see discussion below). The species is separated geographically from Aptostichus angelinajolieae by the Salinas River Valley and is found only in inland habitats whereas Aptostichus miwok is found in coastal dunes. Aptostichus miwok is much lighter in color than Aptostichus stanfordianus (Figs 106, 110, 113, 114).


Female described by Smith (1908).

Material examined.

United States: California: Alameda Co.: Alameda, 37.7652, -122.24166, 4m, E Kools 1.i.94 [AP1277, 1♀, CAS]; Berkeley, 37.8776, -122.2666, 87m, 21.x.53 [AP251, 1♀, CAS]; J Doyen 10.x.72 [AP296, 1♀, AMNH]; Del Valle Regional Park, 37.5889, -121.69595, 249m, M Thompson, 1.xi.81 [AP609, 1♀, CAS]; Lake del Valle St Recreational Area, Campsite #53, 37.5722, -121.691, 218m, A Stockman 12.v.05 [MY3091, 1juv, AUMNH]; Colusa Co.: Bear Valley Rd, 3.2km NW intersection hwy 20, 39.0204, -122.38971, 396m, J Bond, M Hedin 12.i.02 [MY282-84, 3juv, AUMNH]; Contra Costa Co.: 0.8km E of S Gate of Mount Diablo State Park, 37.853, -121.92915, 532m, P Hird 7.ii.47 [AP171, 1♂, AMNH]; Orinda Village, San Pablo Ridge below Eureka Peak, 37.8801, -122.21025, 335m, E Schlinger 13.xi.70 [AP162, 1♂, CAS]; Tilden Park, 37.9024, -122.24713, 325m, J Fraser 24.x.80 [AP501, 1♂, AMNH]; Briones Rd, near Bear Creek Rd, 37.9693, -122.15711, 134m, A Stockman 15.vi.05 [MY3371, 1♀, AUMNH]; Morgan Territory Rd, 3.5km S Marsh Creek Rd, 37.8794, -121.86531, 235m, A Stockman 12.v.05 [MY3085, 3086, 2♀, AUMNH]; Briones Regional Park, Alhambra Creek Staging Creek, 37.9537, -122.12501, 120m, M Hedin, J Starrett, D Carlson, R Keith, H Wood, J Ledford 31.iii.2010 [MY3815, 1♀, AUMNH]; Fresno Co.: Hwy 198, 35.2km E HWY 25, 36.0962, -120.52491, 464m, A Stockman 9.vi.05 [MY3305, 1♀, AUMNH]; Marin Co.: Kentfield, 37.9533, -122.55786, 69m, B Hopey 19.vi.36 [AP271, 1♀, AMNH]; Ridge between San Anselmo & San Rafael, 37.994, -122.5585, 180m, L Freihofer 13.xi.76 [AP160, 1♂, CAS]; Tamalpais St Park, 37.9231, -122.59585, 750m, M Bentzien 18.xi.68 [AP1275, 1♀, SCW]; N San Pedro Rd at Pt San Pedro Rd, 37.9974, -122.45711, 20m, A Stockman 15.vi.05 [MY3357, 1juv, AUMNH; MY3358, 1♀, CAS]; Merced Co.: Dinosaur Pt Rd, 0.8km SE HWY 152, 37.0649, -121.21021, 412m, A Stockman 7.vi.05 [MY3284, 1juv, AUMNH]; Dinosaur Pt Rd, 2.7km SE of Hwy 152, 37.067, -121.19411 305m, A Stockman 7.vi.05 [MY3279, 1juv, AUMNH]; Monterey Co.: Hwy 198, 10.9km E Hwy 25, 36.1988, -120.73811, 696m, A Stockman 9.vi.05 [MY3308, 1♀, 12juv, AUMNH]; Maher Rd, ~2.4km S San Miguel Canyon Rd, 36.8333, -121.67611, 52m, A Stockman 11.vi.05 [MY3325-27, 3♀, AUMNH]; San Juan Canyon S Salinas, 36.8307, -121.53771, 102m, J Bond 8.xii.05 [MY3464, 3465, 2♀, AUMNH]; Napa Co.: Chiles Pope Valley Rd, just S Pope Valley, 38.5963, -122.39971, 250m, M Hedin, J Ledford 31.i.08 [MY3639, 1juv, AUMNH]; Hwy 121, 1.9km S jct w/Hwy 128 at Moskowite Corners, along Capel Creek, 38.432, -122.20731, 250m, M Hedin, J Ledford 31.i.08 [MY3640, 1♂, AUMNH]; N side Howell Mountain, 38.5998, -122.43925, 235m, H Leech 3.xi.83 [AP414, 1♂, CAS]; Hwy 128, 3.2km W Monticello Dam, 38.4952, -122.12361, 143m, A Stockman 13.vi.05 [MY3342, 1♀, AUMNH]; San Benito Co.: ~2.25km from Pinnacles Natl Monument entrance, 36.4872, -121.22331, 502m, J Bond 7.v.97 [AP779-81, 2♀, 1juv, AUMNH]; ~2km before Pinnacles Natl Monument entrance, 36.4544, -121.22191, 470m, J Bond 3.iv.96 [AP717, 738, 1♀, 1juv, AUMNH; AP734, 1♀, CAS]; ~6km from Pinnacles Natl Monument entrance Hwy 146, 36.4323, -121.22751, 4m, J Bond, W Bond 27.vii.08 [MY3740, 1♀, AUMNH]; Pinnacles Natl Monument, 36.4872, -121.20661, 475m, J Bond 3.iv.96 [AP731, 1juv, AUMNH]; Pinnacles Natl Monument, ~2.25km from entrance, 36.4873, -121.22331, 475m, J Bond 3.iv.96 [AP747, 1♀, AUMNH]; Pinnacles Natl Monument, W Chaparral ranger station, 36.4893, -121.21191, 439.9m, J Starrett 1.vii.03 [MY2272, 1♀, AUMNH]; San Juan Canyon Rd/G1, 17km S Hwy 156, near Fremont Peak SP entrance, 36.7602, -121.5024, 850m, A Stockman 7.vi.05 [MY3291, 1♀, AUMNH]; San Juan Canyon Rd vic. Fremont Peak St Park, 36.7858, -121.46071, 549m, M Hedin, P Paquin, J Starrett 5.iv.03 [MY731, 1♀, AUMNH]; Hwy 25, N Hwy 146, ~2.4km N Gloria Rd, 36.5796, -121.19061, 398m, A Stockman 8.v.05 [MY3301, 1♀, AUMNH]; San Juan Canyon Rd/G1, 3.2km S Hwy 156, 36.8166, -121.52641, 130m, A Stockman 8.vi.05 [MY3295-97, 2♀ 1 juv., AUMNH]; San Juan Canyon Rd/G1, 12.2km S Hwy 156, 36.7852, -121.46321, 566m, A Stockman 8.vi.05 [MY3292, 3294 2juv, AUMNH; MY3293, 1♀, AMNH]; vic Hollister Hills, S of Hollister, 36.7716, -121.41121, 220m, M Hedin, J Starrett, D Leavitt, D Carlson, B Keith 27.iii.2011 [MY3795, 4012, 2♀, AUMNH]; New Idria Rd, Griswold Hills, Griswold Canyon, 36.5417, -120.83421, 420m, M Hedin, J Starrett, D Leavitt, D Carlson, B Keith 28.iii.2011 [MY4010, 1♀, AUMNH]; New Idria Rd, 0.8km N New Idria mine site, 36.4235, -120.66741, 725m, M Hedin, J Starrett, D Leavitt, D Carlson, B Keith 29.iii.2011 [MY4003, 1♀, AUMNH]; Panoche Rd, E Panoche Pass, W Llanada, 36.6190, -120.97711, 40m, M Hedin, J Starrett, D Leavitt, D Carlson, B Keith 28.iii.2011 [MY3791, 4008, 4011, 2♀, 1juv, AUMNH]; San Francisco Co.: San Francisco, 37.75, -122.457, 230m, R Schick 1.ix.61 [AP166, 1♂, AMNH]; 23.i.34 [AP473, 1♀, AMNH]; San Joaquin: 6mi W Tracy, 37.7426, -121.55665, 80m, J McSwain 30.iii.49 [AP154, 1♂, AMNH]; San Mateo Co.: ~1.6km W Woodside city limit, 37.4416, -122.24161, 88m, J Bond 3.v.97 [AP765-68, 1♀, 3juv, AUMNH]; Alpine Rd, 4km E Pescadero Rd, 37.291, -122.22941, 314m, A Stockman 13.v.05 [MY3107-09, 3♀, AUMNH]; Half Moon Bay, 37.4611, -122.4405, 17m, W Lange 21.ii.40 [AP444, 1♀, AMNH]; Highway 84 on way to La Honda, 37.3988, -122.25941, 257m, J Bond 4.v.97 [AP770-71, 2juv, AUMNH]; Hillsborough, swimming pool along Summit Dr, 37.5728, -122.38545, 146m, B Thompson 25.ix.72 [AP159, 1♂, CAS]; Hwy 92, 1.5km E HWY 1, 37.4845, -122.39921, 76m, A Stockman 2.vi.05 [MY3247-49, 3♀, AUMNH]; San Mateo, 37.5568, -122.31777, 60m, 31.xii.38 [AP474, 1♀, AMNH]; Santa Clara Co.: 14.5km W Morgan Hill, 1.6km Loma Prieta mountain peak, along Casa Loma Rd, Llagas Creek ravine, 37.1427, -121.78124, 250m, W Icenogle 10.x.70 [AP273, 1♀, 164juv, CAS]; Alum Rock St Park, 37.397, -121.7973, 200m, W Icenogle 11.x.70 [AP187, 1♀, 59juv. AMNH]; 8.x.78 [AP261, 1♀, CAS]; 11.xi.70 [AP264, 1♀, 14juv, AMNH]; 8.x.70 [AP478, 1♀, 32juv, CAS]; 30.vii.71 [AP488, 1♂, AMNH]; Bear Creek Rd, ~0.4km W jct w/ hwy 17, 37.1887, -121.99541, 213m, M Hedin, P Paquin, J Starrett 5.iv.03 [MY725, 1♀, AUMNH]; Guadalupe Creek, 37.1777, -121.874793, 228m, D Ubick 17.ii.76 [AP448, 1juv, CAS]; Marsh Rd, ~0.8km S Calaveras Reservoir, ~6.4km E Milpitas, 37.4501, -121.81385, 240m, W Icenogle 7.x.70 [AP199, 1♀, 1juv, CAS; AP254, 1♀, 52juv, AUMNH]; Marsh Rd, 0.8km S Calaveras Reservoir, 1.6km NE intersection Marsh & Felter Rds, 37.4468, -121.80994, 274m, W Icenogle 7.x.70 [AP466, 1♀, 87juv, AUMNH]; Congress Springs Rd/Hwy 9, 37.2609, -122.09851, 492m, A Stockman 13.v.05 [MY3095-99, 3♀, 2juv, AUMNH]; East Dunne Rd, 37.1519, -121.58651, 226m, A Stockman, P Marek 26.i.06 [MY3486, 1juv, AUMNH; MY3487, 1♀, CAS]; Leavesley Rd just E Roop Rd, 37.0574, -121.51881, 235m, A Stockman, P Marek 24.i.06 [MY3473, 3476-78 2♀, 1 juv., AUMNH]; Uvas Rd/G8, 7.2km S Croy Rd, 37.0599, -121.67781, 126m, A Stockman 11.vi.05 [MY3328-30, 2♀, 1juv, AUMNH]; Alum Rock Park, trail near Quail Hollow bridge, 37.3934, -121.81571, 137m, A Stockman, P Marek 25.i.06 [MY3481-83, 1♀, 2juv, AUMNH]; East Dunne Rd, SW Henry Coe State Park, vic Anderson Lake, 37.1496, -121.59091, 230m, M Hedin, J Starrett, D Carlson 27.iii.2010 [MY3811, 1♀, AUMNH]; Santa Cruz Co.: Ben Lomond Area, 37.077, -122.0843, 100m, Father Koenig 1.xi.64 [AP170, 1♂, AMNH]; Hwy 9, S Brookdale, 37.1037, -122.10481, 130m, M Hedin, R Keith, S Thomas, J Starrett 11.iii.06 [MY3536, 1juv, AUMNH]; Mt Madonna County Park, along Mt Madonna road, 0.72km from jct Pole Line Rd, 37.0116, -121.72081, 455m, J Bond, M van der Merwe 15.xii.99 [MY705, 706 2♀, AUMNH]; University of California Kresge College, 36.99, -122.063, 227m, M Ramirez 14.x.83 [AP158, 1♂, CAS]; Bear Creek Rd 10km E Hwy 9, 37.1767, -122.0631, 445m, A Stockman 4.vi.05 [MY3258, 1♀, AUMNH]; Henry Cowell Redwoods SP, Hwy 9, 1.8km S entrance, 37.0309, -122.06481, 161m, A Stockman 15.v.05 [MY3121, 1♀, AUMNH]; Hwy 35, 3.2km S of Hwy 9, 37.27828, -122.149571, 747m, A. Stockman 13.v.05 [MY3100, 1♀, AUMNH]; Swanton Rd, 6.3km from S entrance off hwy 1, S Swanton, 37.0644, -122.22771, 17m, J Bond, A Stockman, D Beamer 17.iii.05 [MY3066, 3067 1♀, 1juv, AUMNH]; Sonoma Co.: Bennett Valley Rd, 4.3km W Sonoma Mountain Rd, 38.4163, -122.6611, 94m, A Stockman 14.vi.05 [MY3353, 1juv, AUMNH]; Mark W Springs Rd, 7.2km E Old Redwood Hwy, 38.5401, -122.72091, 129m, A Stockman 14.vi.05 [MY3352, 1juv, AUMNH]; Stanislaus Co.: Del Puerto Canyon Rd, 22.8km W I-5, 37.4245, -121.34251, 304m, A Stockman 6.vi.05 [MY3275, 1juv, AUMNH]; Del Puerto Canyon Rd, 5.9km W I-5, 37.47373, -121.2361, 101m, A Stockman 6.vi.05 [MY3267, 3268 1♀, 1juv, AUMNH].

Variation, males (5). Cl 5.50-6.88, 6.18±0.28; Cw 4.50-5.94, 5.16±0.25; STRl 3.03-3.60, 3.39±0.13; STRw 2.54-3.19, 2.83±0.12; LBw 0.83-1.11, 0.93±0.05; LBl 0.41-0.60, 0.53±0.04; leg I: 5.00-6.38, 5.55±0.27; 3.25-4.38, 3.72±0.21; 3.28-4.44, 3.81±0.21; 2.16-3.00, 2.50±0.15; 1.98-2.45, 2.28±0.10; leg IV: 5.00-6.31, 5.65±0.28; 2.63-3.44, 2.94±0.14; PTl 2.37-2.88, 2.61±0.11; PTw 0.80-1.00, 0.89±0.04; Bl 1.07-1.34, 1.22±0.05; TSp 3-5, 3.6±0.4; TSr 0-5, 3.00±0.84; TSrd 4-6, 4.80±0.37.

Variation, females (5). Cl 6.38-8.63, 7.27±0.37 [6.88]; Cw 5.25-6.40, 5.82±0.25 [5.75]; STRl 3.50-5.31, 4.19±0.31; STRw 3.01-4.50, 3.64±0.25; LBw 1.19-1.38, 1.25±0.03; LBl 0.62-0.93, 0.79±0.05; Leg I: 14.00-19.88, 16.44±0.98; ANTd 6-9, 8.20±0.58; PTLs 14-24, 19.40±1.60; TBs 2-6, 3.80±0.66.

Figures 106–112.

Aptostichus stanfordianus Smith, 1908.106–109 male specimen from Contra Costa Co., Orinda Village (AP162); scale bars = 1.0mm 106 male habitus [805794] 107 retrolateral aspect, right leg I [805784] 108 prolateral aspect, right leg I [805780] 109 retrolateral aspect, right pedipalp [805786] 110, 111 female habitus and cleared spermathecae from Santa Cruz Co. (MY3100) [805790, 805795] 112 cleared spermathecae from Alameda Co., Alameda (AP296) [805776]; scale bars = 0.1mm.

Figures 113, 114.

Aptostichus stanfordianus specimens from Sonoma Co., Santa Rosa, live photographs. 113 male specimen (AUMS32) 114 female specimen (AUMS35).

Distribution and natural history.

Aptostichus stanfordianus is distributed widely throughout the Coastal Ranges of central California, bounded to the east by the Central Valley (Map 10). The greatest concentration of populations appears to be centered in the Santa Cruz Mountains and the Diablo and Gabilan Ranges with additional populations in the Sonoma and Howell Mountains to the north. The DM for Aptostichus stanfordianus (Map 11) corresponds closely to the known distribution of the species with the exception of areas of high probability of occurrence that overlaps considerably with the predicted distribution of Aptostichus angelinajolieae but likewise is separated from this species by an area of low probability of occurrence across the Salinas Valley. Also, populations found on the eastern facing slopes of the Coastal Range are found in areas of a low probability of occurrence. Like Aptostichus angelinajolieae, this species is found along damp, north-facing steep banks and road cuts. Populations of this species are found in a number of ecoregion types including California coastal chaparral and shrub, coastal range open woodland and shrub, coniferous forest, coastal steppe, mixed forest and redwood forest. Males have been collected early fall through late winter (September–March).

Maps 10, 11.

Aptostichus stanfordianus Smith, 1908. 10 distribution of known specimens 11 predicted distribution; cooler colors–blue shades–represent areas of high probability of occurrence, warmer colors–yellow and orange shades–represent areas of low probability of occurrence.

Conservation status.

Aptostichus stanfordianus is widespread and abundant throughout its distribution and thus is likely classified as secure. Nevertheless, its distribution throughout the San Francisco Bay region has likely resulted in its extirpation from many localities; specimens from Smith’s (1908) type locality have not been collected in many years.

Species concept applied.

Cohesion (sensu Bond and Stockman 2008). Based on the evidence available at the time, Bond and Stockman (2008) considered the two Aptostichus stanfordianus clades to comprise a single ecologically interchangeable species; that is, the two sister lineages (no longer retained as such in our more recent analysis, see comments below) overlapped in their predicted distributions and thus were ecologically equivalent (not adaptively diverged).


Although cohesion species concept criteria were applied in the formulation of this species the subsequent addition of molecular data for more populations seems to have clouded the picture. The new data indicate that Aptostichus stanfordianus, as currently delineated, may comprise at least two distinct, unrelated lineages, within the Atomarius Sibling Species Complex (Fig. 28). As such the current diagnosis and delimitation will require reconsideration in the future if these two lineages remain genealogically exclusive under further scrutiny.

Aptostichus dantrippi sp. n.

‘The Dan Tripp Trapdoor Spider’



Figures 115–119, Maps 12, 13

Male holotype (AP179) and female paratype (AP173) from California, Kern Co., Bakersfield, South Bank of Kern River, 35.3947, -119.03135, elev. 137m, coll. W. Icenogle 6.x.1971, deposited in AUMNH.


The specific epithet is patronym in honor of Daniel Tripp in recognition of the Tripp family support of biodiversity research and scholarship at East Carolina University, Greenville, North Carolina.


Morphological differences, particularly secondary sexual characteristics (Figs 115–119), between Aptostichus dantrippi and other geographically proximate species of the Atomarius Sibling Species Complex are subtle. First, Aptostichus dantrippi male and female individuals are found only in far inland habitats but tend to be much lighter in coloration (Fig. 118) than other inland species (Aptostichus atomarius, Aptostichus angelinajolieae, and Aptostichus stanfordianus) and thus superficially resemble coastal dune species Aptostichus miwok and Aptostichus stephencolberti. Spermathecae have a very elongate lateral lobe that is directed anteriorly whereas the secondary lobe in other taxa is directed more posterior-laterally (Fig. 119). The species is restricted in distribution to Kern County (California) and does not overlap with any closely related Atomarius Sibling Species Complex taxa (Map 12).

Description of male holotype.

Specimen preparation and condition. Specimen collected live from burrow, preserved in 70% ethanol. Coloration moderately faded. Pedipalp, leg I left side removed, stored in vial with specimen. General coloration. Carapace, chelicerae, legs dark yellowish brown 10YR 4/6. Abdomen uniform dark reddish gray 5YR 5/2 dorsally. Very light diminutive abdominal color pattern comprising 3 patches along dorsal midline (Fig. 118). Cephalothorax. Carapace 6.32 long, 5.44 wide, clothed in light white hairs, stout black bristles along fringe; surface smooth, pars cephalica elevated slightly. Fringe, posterior margin lacks black bristles. Foveal groove deep, straight. Eyes on low mound. AER slightly procurved, PER slightly recurved. PME, AME subequal diameter. Sternum moderately setose, STRl 3.45, STRw 3.00. Posterior sternal sigilla moderate sized, positioned centrally, not contiguous, anterior sigilla pairs small, oval, marginal. Chelicerae with distinct anterior tooth row comprising 6 teeth, posterior margin with single row of small denticles. Palpal endites with patch of small cuspules on proximal, inner margin, labium lacks cuspules, LBw 1.02, LBl 0.42. Rastellum consists of 5 very stout spines not on a mound. Abdomen. Setose, sparse heavy black setae intermingled with fine lighter colored setae. Legs. Leg I: 6.10, 4.19, 4.13, 2.68, 2.40; leg IV: 6.10, 3.30. Light scopulae on legs I, II tarsus, metatarsus. Tarsus I with single, slightly staggered row of 14 trichobothria. Leg I spination pattern illustrated in Figures 115, 116; TSp 3, TSr 5, TSrd 5. Metatarsus I anteverted retrolaterally, modified with mid-ventral mating apophysis terminating in triangular mound. Pedipalp. Articles slender (Fig. 117). PTw 1.40, PTl 2.50, Bl 1.36. Embolus slender, tapering sharply toward tip, slightly curved, lacking serrations (Fig. 117).

Variation.Known only from the type specimen.

Figures 115–119.

Aptostichus dantrippi sp. n. specimens from Kern Co., Bakersfield. 115–118 male holotype (AP179); scale bars = 1.0mm 115 retrolateral aspect, leg I [805816] 116 prolateral aspect, leg I [805820] 117 retrolateral aspect, pedipalp [805822] 118 male habitus [805824] 119 cleared spermathecae of paratype specimen (AP173) [806570]; scale bar = 0.1mm.

Description of female paratype.

Specimen preparation and condition. Female collected live from burrow, prepared in same manner as male holotype. Genital plate removed stored in microvial with specimen. General coloration. Carapace, legs, chelicerae, yellowish brown 10YR 5/6. Abdomen uniform dark yellowish brown dorsally 10YR 4/4, ventrum, spinnerets pale yellow; narrow small dusky stripes on dorsal surface. Cephalothorax. Carapace 6.90 long, 6.00 wide, glabrous; generally smooth surface, pars cephalica moderately elevated. Fringe lacks setae. Foveal groove deep, slightly procurved. Eye group slightly elevated on low mound. AER slightly procurved, PER slightly recurved. PME-AME subequal diameter. Sternum widest at coxae II/III, moderately setose, STRl 4.20, STRw 3.60. Three pairs of sternal sigilla anterior pairs small, oval, marginal, posterior pair much larger, oval, mesially positioned. Chelicerae anterior tooth row comprising 7 teeth with posterior margin denticle patch. Palpal endites with 10 cuspules concentrated at inner (promargin) posterior heel; labium with 8 cuspules, LBw 1.40, LBl 0.80. Rastellum consists of 8 very stout spines not positioned on mound; fringe of short spines along distal promargin extending upward from rastellum. Abdomen. Moderately setose. PLS all 3 segments with spigots. Terminal segment 1/2 length of medial segment, 2 enlarged spigots visible at tip. PMS single segment, with spigots, short with rounded terminus. Legs. Anterior two pairs noticeably more slender than posterior pairs. Leg I: 5.60, 3.40, 3.40, 2.80, 1.60. Tarsus I with single staggered row of 19 trichobothria. Legs I, II with moderately heavy scopulae on tarsus, metatarsus. PTLs 14, TBs 3. Rudimentary preening comb on retrolateral distal surface (at tarsus - metatarsus joint) of metatarsus III, IV. Spermathecae. 2 simple spermathecal bulbs that lack an elongate neck, basal lateral extension of bulb enlarged, directed anteriorly (Fig. 119).

Variation (5). Cl 5.90-7.60, 6.79+0.28; Cw 5.05-6.56, 5.98+0.26; STRl 3.60-4.56, 4.16+0.16; STRw 3.00-3.68, 3.46+0.12; LBw 1.19-1.40, 1.32+0.04; LBl 0.77-0.95, 0.84+0.03; Leg I: 14.50-18.00, 16.69+0.58; ANTd 5-7, 6.20+0.37; PTLs 11-17, 14.60+1.29; TBs 3-5, 3.60+0.40.

Material examined.

United States: California: Kern Co.: Bakersfield, South Bank Kern River, 35.3947, -119.03135, 137m, W Icenogle 6.x.71 [AP173, 1♀, 10juv, CAS; AP178, 179, 182, 2♀ 1♂ 20juv, AMNH], 16.x.70 [AP175, 1♀, AMNH], 22.vi.70 [AP180, 2♀, CAS], 23.vi.70 [AP545, 1♀, CAS]; Cedar Creek, Cedar Creek Campground, 35.7493, -118.58161, 1495m, F Moore, R Berry 22.v.69 [AP443, 1♀, AMNH]; NE edge El Paso Mountains, hills ~ 1 mile W hwy 395, 35.5288, -117.76364, 900m, W Icenogle 11.x.68 [AP257, 1♀, CAS]; S bank Kern River ~1/4mi from Manor St Bridge, 35.4067, -119.01181, 127m, J Bond 31.iii.96 [AP713, 716, 741, 746 3♀ 1 juv, AUMNH]; Tehachapi Mountains, Antelope Canyon, 34.9005, -118.64065, 1524m, S Frommer 12.xi.75 [AP595, 1♀, CAS]; Tehachapi Mountains, Water Canyon, 35.0848, -118.49345, 1372m, W Icenogle 22.vi.70 [AP194, 2♀, CAS]; San Emigdio Mountain, San Emigdio Creek, NE of Pine Mountain Club, off Mill Potrero Hwy, 34.8624, -119.12751, 1380m, M Hedin, J Satler, D Carlson 27.vii.2010 [MY3808, 3806 2juv, AUMNH]; Breckenridge Rd, 33km E int w Comanche Dr, NE Edison, 35.4843, -118.64771, 1527m, J Satler, S Derkarabetian, C Richart, P van Niekerk 28.iii.2011 [MY3817, 1♀, AUMNH]; Hwy 178, ~100m W of Walker Pass, 35.66343, -118.027671, 1067m, M Hedin, P Paquin, J Starrett 29.iii.2003 [MY0730, 1♀, AUMNH]; San Luis Obispo.: Temblor Range, Hwy 58, Pee Wee Park, 35.3494, -119.81741, 900m, M Hedin, J Starrett, D Leavitt, D Carlson, B Keith 29.iii.2010 [MY3792, 1♀, AUMNH]; Hwy 58, Temblor Range, 35.3452, -119.81071, 860m, M Hedin, J Starrett, D Leavitt, D Carlson, B Keith 25.iii.2010 [MY3807 3809, 1juv, 1♀, AUMNH].

GenBank accessions.

16S-tRNAval-12S: EU569911, EU569912, JX103294-JX103300.

Distribution and natural history.

Aptostichus dantrippi as currently defined is distributed primarily throughout Kern County with a few specimens taken from the Temblor Range along the western border with San Luis Obispo County (Map 12). The distribution essentially “rings” the ranges that bound the southernmost extent of the Central Valley and includes the San Emigdio, Tehachapi, and Greenhorn Mountains. The species is mostly restricted to the south valley alluvium and basins, Sierran steppe and mixed and coniferous forests ecoregions of Kern County (Map 12). The only known male specimen was collected during late fall (October). The DM prediction corresponds closely to the known distribution but predicts a high probability of occurrence along the Transverse Ranges. Conversely, the Bakersfield locality along the banks of the Kern River is located in an area of relatively low probability of occurrence; it is likely that this population is relictual given the nature and paucity of the habitat at this location.

Maps 12, 13.

Aptostichus dantrippi sp. n. 12 distribution of known specimens 13 predicted distribution; cooler colors–blue shades–represent areas of high probability of occurrence, warmer colors–yellow and orange shades–represent areas of low probability of occurrence.

Conservation status.

The status of Aptostichus dantrippi appears to be relatively secure; the species is widespread and abundant. However, the type locality, along the banks of the Kern River, in Bakersfield, California is disturbed and has been highly impacted by proximal development of the last quarter century and thus the species is likely to be locally vulnerable.

Species concept applied.

Morphological/phylogenetic. As noted below the molecular data support the hypothesis that these populations constitute a single evolutionary lineage that has subtle morphological differences that distinguish it from sibling species.


I have included additional Kern County specimens from the El Paso Mountain and Tehachapi Mountains as part of the Aptostichus dantrippi species hypothesis. Specimens from both of these outlying populations appear to be mostly consistent, morphologically, with those specimens collected from the type locality with the exception of the two specimens collected from Water Canyon; they appear to have more prominent abdominal markings and a slightly darker cephalothorax than the type specimens. Molecular data to date obtained from specimens collected just west of the Tehachapi’s corroborate the hypotheses that these populations be included as Aptostichus dantrippi despite their somewhat divergence coloration.

Aptostichus pennjillettei sp. n.

‘The Atomic Penn Jillette Trapdoor Spider’



Figures 120–126, Map 1

Male holotype (AP413) and paratype (AP412) from Nevada, Clark Co., Mercury, Nuclear Test Site, 37.08906, -116.061873, elev. 1376m, coll. 12.ii.1962 & 3.i.1962, deposited in AMNH.


The specific epithet is a patronym in honor of Mr. Penn Jillette, freethinker and advocate of scientific skepticism.


Males (Fig. 120) can be diagnosed from all known species of Aptostichus by having a unique spination pattern on the distal most aspect of tibia I consisting of a few elongate spines (TSrd 3–5) that do not overlap (Figs 121–125). This spination pattern is similar to Aptostichus atomarius (Figs 69-75); however, male Aptostichus pennjillettei individuals are smaller and much lighter in color (Fig. 120).

Description of male holotype.

Specimen preparation and condition. Specimen collected from pitfall trap, preserved in 70% ethanol. Coloration presumed to be moderately faded. Pedipalp, leg I left side removed stored in vial with specimen. General coloration. Carapace, chelicerae, and legs red 2.5YR 4/6. Abdomen uniform strong brown 7.5YR 4/6 dorsally, ventrally spinnerets same. Cephalothorax. Carapace 4.50 long, 4.06 wide, glabrous, stout black bristles along fringe; surface smooth, pars cephalica moderately elevated (Fig. 120). Fringe, posterior margin with black bristles. Foveal groove deep, slightly procurved. Eyes on mound. AER slightly procurved, PER slightly recurved. PME, AME subequal diameter. Sternum moderately setose, STRl 2.79, STRw 2.25. Posterior sternal sigilla intermediate size, positioned centrally, not contiguous, anterior sigilla pairs small, oval, marginal. Chelicerae with distinct anterior tooth row comprising 6 teeth, posterior margin with single row of small denticles. Palpal endites with patch of 10 small cuspules on proximal, inner margin, labium 2 cuspules, LBw 0.78, LBl 0.51. Rastellum consists of 6 very stout spines. Abdomen. Setose, black setae intermingled with fine black setae. Legs. Leg I: 5.00, 3.60, 3.55, 2.33, 2.02; leg IV: 4.90, 2.50. Light tarsal scopulae on legs I, II. Tarsus I with single, slightly staggered row of 14 trichobothria. Leg I spination pattern illustrated in Figures 121-125; TSp 3, TSr 3, TSrd 3. Pedipalp. Articles slender, lacking distinct spines (Fig. 126). PTw 0.77, PTl 2.23, Bl 1.10. Embolus slender, tapering sharply toward tip, lacking serrations (Fig. 126).

Variation (10). Cl 4.06-5.81, 4.79±0.19; Cw 3.31-5.00, 3.98±0.19; STRl 2.19-3.54, 2.73±0.14; STRw 1.80-2.58, 2.18±0.09; LBw 0.53-0.98, 0.74±0.04; LBl 0.30-0.53, 0.40±0.03; leg I: 4.06-5.94, 4.85±0.21; 2.94-4.06, 3.43±0.12; 2.50-4.13, 3.26±0.20; 1.92-2.70, 2.22±0.09; 1.35-2.13, 1.75±0.11; leg IV: 3.81-5.88, 4.58±0.23; 2.13-2.88, 2.40±0.10; PTl 1.62-2.61, 2.05±0.13; PTw 0.54-0.86, 0.69±0.04; Bl 0.83-1.26, 1.03±0.05; TSp 3-4, 3.20±0.13; TSr 3-5, 4.20±0.2; TSrd 3-5, 4.10±0.18.

Figures 120–126.

Aptostichus pennjillettei sp. n. from Nevada, Clark Co., Mercury, Nuclear Test Site; scale bars = 1.0mm. 120 habitus, male holotype (AP413) [805830] 121–122 male paratype (AP412), leg I 121 retrolateral aspect [805838] 122 prolateral aspect [805834] 123–125 line drawings of spination patterns on leg I, retrolateral aspect, tibia and metatarsus 126 retrolateral aspect, holotype pedipalp [805832].

Description of female.

Known only from male specimens.

Material examined.

United States: Nevada: Nye Co.: Mercury Nuclear Testing Site, 37.089, -116.06183, 1376m, BYU-AEC 3.i.62 [AP412, 1♂, AMNH], 12.ii.62 [AP413, 1♂, AMNH], 19.i.61 [AP508, 1♂, AMNH], 2.ii.61 [AP509, 1♂, AMNH], 5.ii.62 [AP510, 1♂, AMNH], 20.ii.61 [AP511, 1♂, AMNH], 9.ii.61 [AP512, 1♂, AMNH], 30.i.61 [AP513, 1♂, AMNH], 20.ii.61 [AP514, 1♂, AMNH], 2.xi.60 [AP515, 1♂, AMNH], 16.i.61 [AP516, 1♂, AMNH]; Clark Co.: Lee Canyon, Spring Mountains, 36.3723, -115.62025, 1829m, D Giuliani 10.iii.82 [AP517, 1♂, CAS].

Distribution and natural history.

The known distribution of Aptostichus pennjillettei is restricted to Mojave Desert localities in Nye and Clark Counties of Nevada. Males appear to disperse during the winter months of November-March.

Conservation status.

The conservation status of Aptostichus pennjillettei is likely to be imperiled given its very restricted distribution.

Species concept applied.


Aptostichus asmodaeus sp. n.

‘The Demon Trapdoor Spider’



Figures 127–133, Map 1

Male holotype (AP428) and female paratype (AP427), from California, Contra Costa County, Mount Diablo State Park, 37.85309, -121.92913, 532m, coll. W. Icenogle 6-9.vi.74 deposited in AUMNH.


The specific epithet is the Latin spelling variation of Asmodeus (a King of Demons), from the Book of Tobias, in reference to the type locality, Mount Diablo State Park.


Males (Fig. 127) can be distinguished from all known species of Aptostichus by having a metatarsal I mating apophysis that forms a distinct knob (Figs 128-130). Females can potentially be recognized by having a large number of labial cuspules, > 8 that tend to form at least two distinctive rows. However, some Atomarius Sibling Species Complex individuals also have many labial cuspules but not forming two distinct rows.

Description of male holotype.

Specimen preparation and condition. Specimen collected from burrow raised to maturity in captivity (matured 24.ix.74), preserved in 70% ethanol. Coloration faded. Pedipalp, leg I left side removed stored in vial with specimen, excuviae. General coloration. Carapace, chelicerae, dark red 2.5YR 3/6; legs strong brown 7.5YR 4/6. Abdomen uniform brown 7.5YR 4/4 dorsally; ventrally, spinnerets pale yellow. Cephalothorax. Carapace 5.88 long, 4.56 wide, with fine white setae, stout black bristles along fringe; surface smooth, pars cephalica slightly elevated. Fringe, posterior margin with black bristles. Foveal groove deep, recurved slightly. Eyes on low mound. AER slightly procurved, PER slightly recurved. PME, AME subequal diameter. Sternum moderately setose, STRl 3.09, STRw 2.49. Posterior sternal sigilla small, positioned towards margin, not contiguous, anterior sigilla pairs small, oval, at margins. Chelicerae with distinct anterior tooth row comprising 7 teeth, posterior margin with single row of small denticles. Palpal endites with patch of small cuspules on proximal, inner margin, labium lacks distinct cuspules, LBw 0.84, LBl 0.40. Rastellum consists of 5 very stout spines arranged along anterior margin, not on distinct mound. Abdomen. Setose, heavy black setae intermingled with fine black setae; light markings (Fig. 120). Legs. Leg I: 5.25, 3.63, 4.00, 2.49, 1.98; leg IV: 5.25, 2.90. Very light tarsal scopulae on legs I, II. Tarsus I with single, slightly staggered row of 15 trichobothria. Leg I spination pattern illustrated in Figures 128-130, metatarsal I mating apophysis knob shaped (Figs 128, 130; TSp 7, TSr 6, TSrd 1. Pedipalp. Articles relatively slender, lacking distinct spines (Figs 131, 132). PTw 0.74, PTl 2.19, Bl 1.10. Embolus slender, tapering gradually toward tip, lacking serrations (Fig. 131).

Variation. Males known only from the holotype specimen.

Figures 127–133.

Aptostichus asmodaeus sp. n. from Contra Costa Co., Mt. Diablo. 127–132 male holotype (AP428); scale bars = 1.0mm 127 habitus [805850] 128–130 leg I 128 retrolateral aspect [805844] 129 prolateral aspect [805848] 130 line drawing of spination patterns on leg I, retrolateral aspect, tibia and metatarsus 131–132 pedipalp, retrolateral aspect of photograph [805852] and line drawing 133 cleared spermathecae (AP551) [806573]; scale bar = 0.1mm.

Description of female paratype.

Specimen preparation and condition. Female collected live from burrow with eggsac, preserved in same manner as male holotype. Genital plate removed stored in microvial with specimen. General coloration. Carapace, legs, chelicerae, strong brown 7.5YR 4/6. Abdomen uniform brown dorsally 7.5YR 5/4, ventral aspect spinnerets pale yellow; dusky mottled stripes dorsal abdomen. Cephalothorax. Carapace 6.44 long, 4.94 wide, with fine dark setae; generally smooth surface, pars cephalica moderately elevated. Fringe lacks setae. Foveal groove deep, procurved. Eye group elevated on low mound. AER straight, PER slightly recurved. PME-AME subequal diameter. Sternum widest at coxae II/III, moderately setose, STRl 3.39, STRw 2.88. Three pairs of sternal sigilla anterior pairs small, oval, marginal, posterior pair slightly larger, oval, laterally positioned. Chelicerae anterior tooth row comprising 6 teeth with posterior margin denticle patch. Palpal endites with 22 cuspules concentrated at inner (promargin) posterior heel; labium with 15 cuspules, LBw 1.01, LBl 0.53. Rastellum consists of 7 very stout spines not positioned on a mound; fringe of short spines along distal promargin extending upward from rastellum. Abdomen. Moderately setose. PLS all 3 segments with spigots. Terminal segment 1/2 length of medial segment, 2 enlarged spigots visible at tip. PMS single segment, with spigots, short with rounded terminus. Legs. Anterior two pairs more slender than posterior pairs. Leg I 14.26 long. Tarsus I with single staggered row of 7 trichobothria. Legs I, II, moderate to heavy scopulae on tarsi and metatarsi. PTLs 12, TBs 3. Distinct preening comb on retrolateral distal surface at tarsus - metatarsus joint of metatarsi III, IV. Spermathecae. Intermediate sized stalk, slightly larger terminal bulb; median stalk heavily sclerotized along entire length. Basal extension with well-developed, distinct, basal bulb (Fig. 133).

Variation (5). Cl 5.69-6.63, 6.24±0.17; Cw 4.25-5.19, 4.81±0.16; STRl 3.12-3.75, 3.41±0.12; STRw 2.61-2.94, 2.81±0.07; LBw 0.87-1.01, 0.94±0.03; LBl 0.53-0.60, 0.56±0.02; Leg I: 12.95-15.43, 13.96±0.45; ANTd 6-7, 6.20±0.20; PTLs 9-12, 10.80±0.58; TBs 3-4, 3.60±0.24.

Material examined.

United States: California: Contra Costa Co.: 0.80 km E of S Gate Mt Diablo St Park, 37.853, -121.92915, 532m, W Icenogle 6–10.vi.74, [AP427, AP428, AP547-552, 1♂, 5♀, 2juv, AUMNH].

Distribution and natural history.

Known only from the type locality (Map 1), Mt. Diablo in the Black Hills, in Contra Costa County. The ecoregion comprises California coastal chaparral forest and shrub habitat.

Conservation status.

The conservation status of this species is considered imperiled. Very few specimens have been collected and none over the past quarter century thus the species is rare; however, the type locality is a California State Park, which may afford this geographically restricted species some protection.

Species concept applied.


Aptostichus nateevansi sp. n.

‘The Nate Evans Trapdoor Spider’



Figures 134–141, Map 1

Male holotype (AP420) from California, Los Angeles County, Santa Catalina Island, Toyon Bay, 33.37079, -118.349634, 1m, coll. S. Bennett 1.xi.87, deposited in CAS. Male (AP429) and female (AP421) paratypes from California, Los Angeles County, San Clemente Island, 32.878, -118.464174, 500m, coll. R. Felger, P. Regal 2.v.65 and J. Scott 1.vi.38; deposited in CAS and AMNH respectively.


The specific epithet is patronym in honor of Nathaniel Evans in recognition of the Evans family support of biodiversity research at East Carolina University, Greenville, North Carolina.


Males (Fig. 134) can be distinguished having a distinctive row of spines on the prolateral surface of patella I (Figs 136, 138, 139). Females can be tentatively distinguished from all species, except some Aptostichus atomarius individuals, by having a large number of anterior margin denticles (ANTd= 8).

Description of male holotype.

Specimen preparation and condition. Specimen preserved in 75% ethanol, coloration faded. Pedipalp, leg I left side removed stored in vial with specimen. General coloration. Carapace, chelicerae, legs dark reddish brown 5YR 3/4. Abdomen uniform reddish brown 5YR 4/3 dorsally, ventrum, spinnerets pale yellow. Cephalothorax. Carapace 6.44 long, 5.44 wide, hirsute with thin white setae, stout black bristles along fringe; surface smooth, pars cephalica elevated slightly. Fringe, posterior margin with black bristles. Foveal groove deep, moderately straight to slightly recurved. Eyes on low mound. AER straight, PER slightly recurved. PME, AME subequal diameter. Sternum moderately setose, STRl 3.44, STRw 2.75. Posterior sternal sigilla small, heavily sclerotized, positioned towards mid sternum, not contiguous, anterior sigilla pairs small, oval, marginal. Chelicerae with distinct anterior tooth row comprising 8 teeth, posterior margin with single row of small denticles. Palpal endites with patch of small cuspules on proximal, inner margin, labium lacks cuspules, LBw 1.36, LBl 0.68. Rastellum consists of five stout spines arranged along anterior margin. Abdomen. Setose, heavy black setae intermingled with fine black setae. Legs. Leg I: 5.94, 4.06, 4.06, 2.44, 2.28; leg IV: 5.88, 3.06. Light tarsal scopulae on legs I, II. Tarsus I with single, slightly staggered row of 12 trichobothria. Leg I spination pattern illustrated in Figures 135–139; TSp 8, TSr 7, TSrd 5; numerous spines on patella prolateral surface. Pedipalp. Articles slender, lacking distinct spines (Fig. 140). PTw 0.84, PTl 2.70, Bl 1.28. Embolus slender, tapering gradually toward tip, lacks serrations (Fig. 140).

Variation (2). Cl 6.31-6.44, Cw 5.19-5.44, STRl 3.29-3.44, STRw 2.75-2.79, LBw 0.95-1.36, LBl 0.65-0.68, leg I: 5.45-5.94, 3.7-4.06, 3.75-4.06, 2.25-2.44, 2.25-2.28; leg IV: 5.35-5.88, 2.75-3.06; PTl 2.50-2.70, PTw 0.84-0.92, Bl 1.28-1.28, TSp 5-8, TSr 4-7, TSrd 5-5.

Description of female paratype.

Specimen preparation and condition. Female collected from burrow, prepared in same manner as male holotype. Genital plate removed stored in microvial with specimen. Color. Carapace, legs, chelicerae, dark reddish brown 2.5YR 2.5/4; abdomen uniform reddish brown dorsally 5YR 4/4, ventral aspect, spinnerets pale yellow. Cephalothorax. Carapace 7.39 long, 6.50 wide, lightly hirsute; generally smooth surface, pars cephalica moderately elevated. Fringe lacks setae. Foveal groove deep, procurved. Eye group slightly elevated on low mound. AER slightly procurved, PER slightly recurved. PME-AME subequal diameter. Sternum widest at coxae II/III, moderately setose, STRl 4.50, STRw 3.94. Three pairs of sternal sigilla, anterior pairs small, oval, marginal, posterior pair larger, oval, mesially positioned. Chelicerae anterior tooth row comprising 8 teeth with posterior margin denticle patch. Palpal endites with 48 cuspules concentrated at inner (promargin) posterior heel; labium with 6 cuspules, LBw 1.34, LBl 0.84. Rastellum consists of 5 very stout spines positioned along the anterior margin, not on mound; fringe of short spines along distal promargin extending upward from rastellum. Abdomen. Moderately setose. PLS all 3 segments with spigots. Terminal segment 1/2 length of medial segment, 2 enlarged spigots visible at tip. PMS single segment, with spigots, short with rounded terminus. Legs. Anterior two pairs noticeably more slender than posterior pairs. Leg I 17.76 long. Tarsus I with single staggered row of 11 trichobothria. Legs I, II with moderately heavy scopulae on tarsi, metatarsi. PTLs 9, TBs 3. Distinct preening combs lacking on legs III, IV. Spermathecae. Intermediate sized median stalk with larger terminal bulb; median stalk heavily sclerotized along its entire length. Basal extension well developed as distinct auxiliary bulb (Fig. 141).

Variation (2). Cl 7.00-7.39, Cw 5.70-6.50, STRl 4.25-4.50, STRw 3.70-3.94, LBw 1.26-1.34, LBl 0.84-0.85, Leg I: 17.45-17.76, ANTd 8-8, PTLs 9-12, TBs 3-4.

Figures 134–141.

Aptostichus nateevansi sp. n. from Los Angeles Co., Santa Catalina Island (holotype) and San Clemente Island (paratype). 134–136, 139, 140 male holotype (AP420); scale bars = 1.0mm 134 habitus [805860] 135 retrolateral aspect, leg I [805854] 136 prolateral aspect, leg I [808858] 137, 138 male paratype (AP429) 137 retrolateral aspect, leg I 138 prolateral aspect, leg I 139 line drawings of leg I spination patterns, retrolateral aspect of patella, tibia and metatarsus and prolateral aspect of patella and tibia 140 retrolateral aspect, pedipalp [805864] 141 cleared spermathecae (AP543) [806576]; scale bar = 0.1mm.

Material examined.

United States: California: Alameda Co.: Sunol Regional Wilderness Area, 37.5202, -121.82613, 220m, M Thompson 31.xii.1980 [AP610, 1♂, AMNH]; Los Angeles Co.: Toyon Bay, Santa Catalina Island, 33.3708, -118.34964, 1m, S Bennett 27.x.1979 [AP419, 1♂, CAS], 1.xi.1981 [AP420, 1♂, AMNH]; San Clemente Island, 32.878, -118.46416, 500m, J Scott 1.vi.1938, [AP421, 1♀, AMNH), R Felger, P Regal 2.v.1965 [AP429, 1♂, AMNH], A Menke 14.v.1973, [AP543, 1♀, AMNH), J Doyen 21.v.1972 [AP544, 1juv, CAS].

Distribution and natural history.

Aptostichus nateevansi is known primarily from Los Angeles County, Channel Islands of Santa Catalina and San Clemente (see comments below regarding the Alameda County specimen). The primary habitat is California coastal chaparral forest and shrub.

Conservation status.

Few specimens of this species have ever been collected, and none within the last quarter century; it is known from only a few localities. The Catalina Island Conservancy manages most of Santa Catalina Island and the United States Navy owns San Clemente Island which may afford the species some protection. Nevertheless, I would consider the status of this species likely imperiled due to low abundance and rarity in collections.

Species concept applied.



Despite the geographical distance that separate the type locality and Alameda County, the anomalous specimen from the Sunol Regional Wilderness area is placed as part of the Aptostichus nateevansi species construct because the mating clasper and somatic morphology of the specimen is indistinguishable from those of other specimens. I have little doubt that this is a related, yet disjunct sister species (like Aptostichus chiricahua, below), but have chosen to conservatively wait until more specimens are available to set the Alameda County specimen aside as a separate species.

Aptostichus chiricahua sp. n.

‘The Chiricahua Mountain Trapdoor Spider’



Figures 142–145, Map 1

Male holotype (AP645) from Arizona, Cochise County, Portal, 31.91369, -109.14081, 1450m, coll. S. Bennett 12.ix.1980; deposited in AMNH.


The specific epithet is a noun taken in apposition from the type locality, the Chiricahua Mountains of southeastern Arizona.


Males can be diagnosed on the basis of a unique conformation of the tibia leg I, spination pattern which comprises numerous spines on the prolateral and distal surfaces (Figs 142–144). This spination pattern is most similar to the Channel Islands species Aptostichus nateevansi, however the Aptostichus chiricahua type specimen has considerably more spines, two rows, along the distal, prolateral aspects of the mating clasper tibia. A considerable geographic distance separates Aptostichus chiricahua and Aptostichus nateevansi. The geographical proximate species, Aptostichus edwardabbeyi, has dissimilar mating clasper morphology and has a distinct offset prolateral rastellar spine and thus is a Hesperus group species.

Description of male holotype.

Specimen preparation and condition. Specimen presumably collected live, wandering, preserved in 70% EtOH. Pedipalp, leg I left side removed, stored in vial with specimen; leg IV left side missing. General coloration. Carapace, chelicerae, dark reddish brown 2.5YR 2.5/4. Abdomen yellowish red 5YR 4/6, distinct mottled dorsal markings. Cephalothorax. Carapace 6.25 long, 5.10 wide, hirsute with intermingled thin white, black setae; stout black bristles along fringe; surface smooth, pars cephalica elevated. Fringe, posterior margin with black bristles. Foveal groove deep, straight. Eyes elevated on high mound. AER slightly procurved, PER strongly recurved. PME, AME subequal diameter. Sternum moderately setose, STRl 3.35, STRw 2.88. Posterior sternal sigilla moderate in size, positioned towards margin, not contiguous, anterior sigilla pairs small, oval, marginal. Chelicerae with distinct anterior tooth row comprising 6 teeth, posterior margin with patch of small denticles. Palpal endites with patch of small cuspules on proximal, inner margin, labium with 2 cuspules, LBw 0.94, LBl 0.65. Rastellum consists of 5 stout spines not on prominent mound. Abdomen. Setose, heavy black setae intermingled with fine black setae. Legs. Leg I: 5.60, 3.88, 3.80, 2.48, 2.33; leg IV: 5.55, 2.92. Tarsus I, slender, tarsus IV straight. Light tarsal scopulae on all legs, light scopulae on metatarsus I, II. Tarsus I with single, slightly staggered row of 12 trichobothria. Leg I spination pattern illustrated in Figures 142-144 comprising heavy spination on the patella, tibia, metatarsus; TSp 5, TSr 4, TSrd 3. Pedipalp. Articles slender, lacking distinct spines (Fig. 145). PTw 0.85, PTl 2.57, Bl 1.11. Embolus broad, tapering sharply toward tip, lacking serrations (Fig. 145).

Variation. Known only from the type specimen.

Description of female.

Known only from male specimens.

Material examined.

Known only from the type material.

Distribution and natural history.

Aptostichus chiricahua is known only from a single specimen taken from the type locality in Arizona, Cochise Co., Portal (Map 1). Despite extensive collecting efforts in the area female burrows have never been observed. Based on the paucity of specimens, the species may be quite rare.

Figures 142–145.

Aptostichus chiricahua sp. n. holotype specimen from Arizona, Cochise Co., Portal Arizona; scale bars = 1.0mm. 142–144 leg I 142 retrolateral aspect [806094] 143 prolateral aspect [806090] 144 line drawings of leg I retrolateral and prolateral aspects 145 retrolateral aspect, pedipalp [806096].

Conservation status.

Undetermined but likely to be imperiled given its restricted distribution and rarity in collections.

Species concept applied.



As noted above in the description of Aptostichus nateevansi, Aptostichus chiricahua has a mating clasper that is very similar to the California Channel Island species and thus may be closely related despite the disjunct distribution.

Aptostichus icenoglei sp. n.

‘The Icenogle Trapdoor Spider’



Figures 146–156, Maps 14, 15

Male holotype (AP391), female paratype (AP390), and male paratype (AP024) from California, Riverside County, Winchester, 1.6km NW of town center, vicinity of Double Butte, 33.71492, -117.092201, 478m, coll. W. Icenogle; male specimens collected 20.xi.1967 and female 6.vii.1967. Male holotype and female paratype deposited in AUMNH; male paratype in CAS.

Etymology. The specific epithet is a patronym in honor of Wendell Icenogle who has collected many of the Aptostichus types and has studied this group’s natural history for many years. I am incredibly grateful to Wendell for his assistance, sage advice, patience, and friendship over many years; he has pointed out to me that he was collecting Aptostichus before I was born.


Males (Fig. 146) can be diagnosed on the basis of a unique conformation of the tibia I mating apophysis and TSrd spination pattern (Figs 147, 149). The Aptostichus icenoglei tibial I apophysis (Figs 147, 149) is rectangular in shape and bears a distal spine. In all other Aptostichus species the tibial I apophysis is triangular, rounded, or absent, with the exception of Aptostichus cabrillo which has a similar rectangular apophysis (Fig. 160). Aptostichus icenoglei (Fig. 149) and Aptostichus cabrillo (Fig. 160) males can be differentiated on the basis of the TSrd spination pattern. The TSrd of Aptostichus icenoglei consists of no more than 3 non–overlapping spines (usually 2), whereas the TSrd of Aptostichus cabrillo is always greater than 4 overlapping spines. Female Aptostichus icenoglei specimens tend to be darker in coloration, larger (Cw > 5.50) and with fewer prolateral tibial spines on leg III (TBs < 4) than Aptostichus cabrillo (Figs 162, 164). Females are distinguished from the sympatric species Aptostichus hesperus by lacking contiguous sigilla (see that species’ diagnosis) and Aptostichus cahuilla by virtue of its much larger size. Distinguishing female Aptostichus icenoglei (Fig. 151) and Aptostichus atomarius is problematic. Although their sampled distributions overlap, the sternum width to length ratio tends to be smaller in Aptostichus icenoglei (i.e., the sternum of Aptostichus icenoglei tends to be more narrow). Additionally, the lateral spermathecal base of Aptostichus atomarius is developed into a more distinctive auxiliary bulb that extends below (posteriorly) beyond, the lateral base. The secondary bulb of Aptostichus icenoglei is smaller and does not extend below the lateral base (Figs 152–155). As noted in the diagnosis of Aptostichus atomarius, Aptostichus icenoglei specimens in life tend to be much darker in coloration (Fig. 156).

Description of male holotype.

Specimen preparation and condition. Specimen collected in pitfall trap, preserved in 70%. Coloration only moderately faded. Pedipalp, leg I left side removed, stored in vial with specimen. General coloration. Carapace, chelicerae, legs dark reddish brown 5YR 3/4. Abdomen brown 7.5YR 4/3 with dark distinct chevron striping dorsally (Fig. 146), ventrum and spinnerets pale yellow. Cephalothorax. Carapace 5.25 long, 4.70 wide, hirsute with light white setae, stout black bristles along fringe; surface smooth, pars cephalica elevated. Fringe, posterior margin with black bristles. Foveal groove deep, straight. Eyes on low mound. AER slightly procurved, PER slightly recurved. PME, AME subequal diameter. Sternum moderately setose, STRl 3.08, STRw 2.70. Posterior sternal sigilla small, widely separated, anterior sigilla pairs small, oval, marginal. Chelicerae with distinct anterior tooth row comprising 7 teeth, posterior margin with patch of small denticles. Palpal endites with patch of small cuspules on proximal, inner margin, labium lacks cuspules, LBw 0.51, LBl 0.87. Rastellum consists of 5 stout spines not on mound. Abdomen. Setose, heavy black setae intermingled with fine black setae. Legs. Leg I: 5.63, 4.25, 4.25, 3.00, 2.30; leg IV: 5.80, 3.24. Light scopulae on tarsi, metatarsi legs I, II. Tarsus I with single, slightly staggered row of 12 trichobothria. Leg I spination pattern illustrated in Figures 147-149; TSp 3, TSr 3, TSrd 2. Tibia mating apophysis rectangular. Pedipalp. Articles stout, lacking distinct spines (Fig. 150). PTw 0.77, PTl 2.45, Bl 1.11. Embolus slender, tapering sharply toward tip, lacking serrations (Fig. 150).

Variation (9). Cl 5.13-5.81, 5.41±0.09; Cw 4.19-4.70, 4.45±0.07; STRl 2.79-3.30, 3.00±0.05; STRw 2.19-2.70, 2.41±0.05; LBw 0.63-0.87, 0.76±0.03; LBl 0.38-0.51, 0.43±0.02; leg I: 4.85-5.81, 5.33±0.1; 3.38-4.56, 3.90±0.12; 3.60-4.25, 3.91±0.07; 2.50-3.06, 2.76±0.06; 2.00-2.61, 2.38±0.07; leg IV: 5.00-5.80, 5.41±0.09; 2.60-3.24, 2.89±0.07; PTl 2.07-2.45, 2.24±0.04; PTw 0.66-0.81, 0.73±0.02; Bl 0.98-1.13, 1.04±0.02; TSp 2-5, 3.11±0.31; TSr 3-6, 4.44±0.34; TSrd 2-3, 2.33±0.17.

Description of female paratype.

Specimen preparation and condition. Female collected live from burrow, preserved in same manner as male holotype. Genital plate removed, cleared in trypsin, stored in microvial with specimen. General coloration. Carapace, legs, chelicerae, red 2.5YR 4/6. Abdomen brown dorsally 7.5YR 4/2 with distinct chevron striping, ventrum and spinnerets pale yellow. Cephalothorax. Carapace 7.30 long, 6.50 wide, glabrous; generally smooth surface, lightly hirsute, pars cephalica moderately elevated. Fringe lacks setae. Foveal groove deep, slightly procurved. Eye group slightly elevated on low mound. AER straight, PER slightly recurved. PME-AME subequal diameter. Sternum widest at coxae II/III, moderately setose, STRl 4.50, STRw 3.45. Three pairs of sternal sigilla anterior pairs moderate size, oval, positioned marginally, posterior pair larger, oval, mid-sternal positioned. Chelicerae anterior tooth row comprising 7 teeth with posterior margin denticle patch. Palpal endites with 12 cuspules concentrated at the inner (promargin) posterior heel; labium with 1 cuspule, LBw 1.45, LBl 0.80. Rastellum consists of 6 very stout spines not positioned on mound. Abdomen. Moderately setose. PLS all 3 segments with spigots. Terminal segment 1/2 length of medial segment, 2 enlarged spigots visible at tip. PMS single segment, with spigots, short with rounded terminus. Legs. Anterior two pairs noticeably more slender than posterior pairs. Leg I 16.20 long. Tarsus I with single staggered row of 16 trichobothria. Legs I, II with moderately heavy scopulae on tarsi, metatarsi, distal aspect tibia. PTLs 8, TBs 2. Distinct preening comb on retrolateral distal surface (at tarsus - metatarsus joint) of metatarsus III, IV. Spermathecae. Heavily sclerotized intermediate sized median stalk with well-developed basal extension (Figs 152–155).

Variation (8). Cl 6.56-8.80, 7.49±0.23; Cw 5.80-7.13, 6.43±0.15; STRl 3.96-5.05, 4.52±0.13; STRw 3.07-4.10, 3.59±0.11; LBw 1.19-1.45, 1.34±0.03; LBl 0.80-1.19, 0.94±0.05; Leg I: 15.10-18.03, 16.39±0.31; ANTd 6-7, 6.25±0.16; PTLs 8-14, 11±0.6; TBs 2-3, 2.25±0.16.

Figures 146–150.

Aptostichus icenoglei sp. n.; scale bars = 1.0mm. 146–148, 150 male holotype from Riverside Co., Winchester (AP391) 146 habitus [805874] 147 retrolateral aspect, leg I [805866] 148 prolateral aspect, leg I [805870] 149 line drawings of leg I article spination patterns of holotype and additional specimens from the type locality 150 retrolateral aspect, pedipalp [805872].

Figures 151–156.

Aptostichus icenoglei sp. n. female. 151 habitus, female paratype from Riverside Co., Winchester (AP391) [805876] 152–155 cleared spermathecae of specimens (MY0718, 2465, 2467, 2505) from Riverside and San Diego Counties [806579, 806582, 806585, 806588]; scale bars = 0.1mm. 156 live photograph of specimen (MY3759) from Los Angeles Co.

Material examined.

Mexico: Mexicali: Baja California Norte: 3.2km W Rancho Grande, 24.1k S San Vicente, 32.4689, -115.38445, 20m, V Roth 8.i.1965 [AP029, 1♂, AMNH]; United States: California: Los Angeles Co.: Chatsworth, intersection Lassen St & Valley Circle Blvd, ravine just E Oakwood Cemetery, 34.2512, -118.62274, 315m, W Icenogle 16.x.1966 [AP253, 1♀, AMNH]; Chatsworth, Limekiln Canyon Park, 34.2876, -118.56064, 407m W Icenogle 17.i.1971 [AP305, 1♀, 1juv, CAS]; Gabriel Mtns, Angeles Natl Forest, Evey Canyon, Off Brady Rd., 34.1638, -117.6851, 763m, J Bond 6.iv.1996 [AP719, 1♀, AUMNH]; Glendora Ridge Rd, San Gabriel Mountains, 34.2213, -117.73913, 1133m, W Icenogle 21.v.1974 [AP017, 1♀, CAS]; Henninger Flats, 34.1926, -118.08753, 792m, 27.x.1967 [AP018, AP297 2♀, 1juv, AMNH], F Coyle 19.vii.1972 [AP642, 1♀, 14juv, AMNH]; Mt Baldy Rd, 0.2km N jct w/ N Mountain Ave, 34.1773, -117.67671, 800m, M Hedin, J Satler, J Starrett, C Richart 15.ii.2009 [MY3759, 1♀, AUMNH]; Mt Washington, Los Angeles, 34.0992, -118.21943, 246m, G Bakker 1.ix.1967 [AP025, 1♂, AMNH]; Pasadena, Eaton Canyon Park, 34.1807, -118.0954, 325m, M Thompson 26.xii.1967 [AP049, 1♂, AMNH]; Placerita Canyon Park, 34.37, -118.4434, 655m, F Coyle 20.vii.1972 [AP452, 1♀, AMNH]; Puente Hills, intersection Azusa & Tomich Rd, 33.9816, -117.93351, 210m, J Bond, C Spruill, D Beamer 14.iii.2004 [MY2600, 1♀, AUMNH]; San Gabriel Mtns, Angles Natl Forest, hwy 3, 1.3km jct w/Big Tujunga Canyon Rd, 34.2907, -118.17061, 1030m, M Hedin, J Satler, J Starrett, C Richart 19.ii.2009 [MY3780, 1♀, AUMNH]; Santa Ysabel, Santa Ysabel Ecological Reserve, Kanaka Flat, 33.1083, -116.6161, 1277m, USGS-BRD San Diego Sta. 1.x.2002 [AP938, 1♂, CAS]; Santa Ysabel, Santa Ysabel Ecological Reserve, Santa Ysabel Creek, 33.133, -116.64841, 1018m, USGS-BRD San Diego Sta. 1.iv.2002 [AP937, 1juv, CAS]; Sierra Madre, 34.1621, -118.05323, 255m, M Thompson 8.ii.1972 [AP048, 1♂, CAS]; Orange Co.: Bell Canyon, 33.6178, -117.56271, 252m, USGS-BRD San Diego Sta. 1.ix.1998 [AP1144, 1♂, CAS]; Crow Canyon, 33.6029, -117.54421, 338m, USGS-BRD San Diego Sta. 1.xi.2000 [AP1129, 1♂, CAS], 1.xi.1998 [AP1130, 1♂, CAS]; N View Rancho Santa Margarita, 33.6138, -117.55041, 484m, USGS-BRD San Diego Sta. 1.xi.1998 [AP1140, 1♀, CAS]; Ridge E Bell Canyon, 33.6041, -117.55251, 518m, USGS-BRD San Diego Sta. 1.xi.1998 [AP1139, 1♂, CAS]; Ridge E Bell Canyon, S Fox Canyon, 33.6192, -117.55321, 384m, USGS-BRD San Diego Sta. 1.viii.1999, [AP1141, 1juv, CAS], 1.ix.1998 [AP1142, 1♂, CAS], 1.ix.1999 [AP1143, 1♂, CAS]; Ridge E Fox Canyon, 33.6174, -117.54381, 457m, USGS-BRD San Diego Sta. 1.ix.1998 [AP1135, 1♂, CAS]; Ridge N Crow Canyon, 33.6081, -117.54691, 427m, USGS-BRD San Diego Sta. 1.ix.1998 [AP1132, 1133 2♂, CAS]; Salt Creek 2.4km N Dana Pt, 33.4819, -117.72063, 21m, W Icenogle 6.xii.1968 [AP605, 1♀, 1juv, AMNH]; Santa Ana Mountains, 4.0km E an Juan Fire Station, Hot Spring Canyon Rd turnout, 33.5907, -117.47541, 366m, W Icenogle 7.ix.2000 [AP366, 1♂, CAS]; SE View Rancho Santa Margarita, 33.6113, -117.54651, 480m, USGS-BRD San Diego Sta. 1.ix.1998 [AP1134, 1♂, CAS]; S View Rancho Santa Margarita, 33.6118, -117.54821, 530m, USGS-BRD San Diego Sta. 1.x.1999 [AP1136, 1♂, CAS]; SW View Rancho Santa Margarita, 33.6092, -117.55241, 500m, USGS-BRD San Diego Sta. 1.vii.1998 [AP1137, 1♂, CAS]; Weir Canyon, 33.8299, -117.73911, 252m, USGS-BRD San Diego Field Station 1.iv.2000 [AP1128, 1♂, CAS]; Bell Canyon, 33.6302, -117.55391, 297m, USGS-BRD San Diego Sta. 1.x.1999 [AP1113, 1♂, CAS]; S Aliso Wood Canyon, 33.5185, -117.73861, 7m, USGS-BRD San Diego Sta. 1.ix.2000 [AP975, 1♂, CAS]; Riverside Co.: 1.6km NW Winchester town center, 33.7148, -117.09211, 470m, W Icenogle 27.vii.1968 [AP013, 1♀, 100+juv, CAS], 17.viii.1968 [AP186, AP460, 2♀, 180juv, CAS]; 3.2km NW Tenaja Ranger Station, 33.5298, -117.38866, 515m, W Icenogle 19.ix.1968 [AP008, 1♀, 50+juv, AMNH]; 6.4km W Mountain Center, 33.7011, -116.7693, 1124m, W Icenogle 28.viii.1968 [AP459, 1♀, 100+juv, CAS]; Bautista Canyon, 33.6978, -116.85195, 669m, K Cooper 19.ii.1978 [AP589, 1juv, UCR]; Bautista Canyon, along Bautista Canyon Rd, 33.7099, -116.87751, 611m, J Bond 1.ii.2004 [MY2480, 1♀, AUMNH]; between Squaw Mountains & Redonda Mesa, N Tenja Rd, 33.5035, -117.33681, 634m, USGS-BRD San Diego Sta. 1.ix.2000 [AP899, 1♂, CAS]; between Squaw Mtn. & Redona Mesa, N Tenaja Rd., 33.5026, -117.34641, 646m, USGS-BRD San Diego Sta. 1.x.1999 [AP872, 873 2♂, CAS]; Cleveland Natl Forest, along H74, 33.6297, -117.42522, 706m, J Bond, C Spruill, D Beamer 18.iii.2004 [MY2668, 2669, 2juv, AUMNH]; De Luz Murrieta Rd, 33.4956, -117.24331, 366m, M Hedin 11.i.2003 [MY0718, 1♀, AUMNH]; E Gavilan Mtn, N Santa Margarita River, 33.4589, -117.1721, 820m, USGS-BRD San Diego Sta. 1.ix.1998 [AP891, 1♂, CAS]; E Skinner Reservoir, 33.5898, -117.02331, 452m, USGS-BRD San Diego Sta. 1.viii.1998 [AP1032, 1♂, CAS]; James Reserve Lake Fulmor on hwy 243, 33.8042, -116.78033, 1599m, 26.vii.1997 [AP030, 1♂, CAS]; Joshua Tree Natl Monument, 33.9617, -116.22946, 1400m, 1.iii.1978 [AP583, 1♀, UCR]; Kabian Park, between Canyon Lake & Perris, off Goetz Rd 6.1km S Case & Goetz Rds jct in Perris, 33.7272, -117.24361, 512m, S Kirshtner 8.xi.2003 [AP1231, 1♂, CAS]; Lake Matthews, 33.8266, -117.4381, 446m, J Bond 20.xi.1998 [AP691, 1juv, AUMNH]; Lake Skinner, 13.1km NW Winchester, 33.595, -117.0583, 485m, 7.xii.1997 [AP044, 1♂, CAS], J Bond 13.xii.1997 [AP676, 1♀, AUMNH]; Menifee Valley, 33.6848, -117.1751, 434m, S Frommer 7.vi.1992 [AP011, 1♀, UCR], 12.i.1991 [AP582, 1♀, UCR]; N base Avenaloca Mesa, S Tenaja Rd, 33.500, -117.32921, 692m, USGS-BRD San Diego Field Station 1.ix.2000 [AP965, 1♂, CAS]; N Perris, E Mayer Farms, 33.8045, -117.25181, 571m, USGS-BRD San Diego Sta. 1.ii.1999 [AP1099, 1♂, CAS]; N Perris, E Mayer Farms, 33.8073, -117.25721, 571m, USGS-BRD San Diego Sta. 1.i.2000 [AP1102, 1♂, CAS]; N Tenja Canyon, S Wildomar Rd., 33.5104, -117.36871, 604m, USGS-BRD San Diego Sta. 1.i.2000 [AP875, 1♂, CAS], 1.ix.2000 [AP876, 1♂, CAS]; Ortega hwy H74, 2.7km N Orange Co/Riverside Co line, 33.6127, -117.43461, 523m, J Bond 2.ii.2004 [MY2492, 1juv, AUMNH]; Pigeon Pass, 33.993, -117.2763, 584m, W Rose 27.xii.1967 [AP032, 1♂, AMNH]; San Bernardino Natl Forest, Juan Diego Flats Rd, ~1km from intersection w/Reed Valley Rd, 33.5836, -116.81411, 1110m, J Bond 7.iv.1996 [AP718, 1♀, AUMNH]; Santa Margarita Ecological Reserve, Santa Margarita River, E Gavilan Mtn, 33.455, -117.17291, 786m, USGS-BRD San Diego Sta. 1.xi.1998 [AP892, 1♂, CAS]; Santa Margarita Ecological Reserve, S Santa Margarita River, N Royal Oak Ranch, 33.4411, -117.16371, 396m, USGS-BRD San Diego Sta. 1.ix.1999 [AP895, 1♂, CAS]; S Santa Margarita river, N Royal Oak Ranch, 33.4399, -117.16051, 421m, USGS-BRD San Diego Sta. 1.xi.1999 [AP894, 1♂, CAS]; University of California, Riverside Campus, 33.9742, -117.32513, 327m, W Icenogle 5.x.1967 [AP010, 1♀, 100+juv, AUMNH], 13.ix.1967 [AP014, 1♀, 100+juv, CAS], 27.x.1967 [AP188, 1♀, CAS], W De Luz Creek, S Tenaja Rd, 33.505, -117.31381, 674m, USGS-BRD San Diego Field Station 1.ix.1999 [AP988, 1♂, CAS]; W De Luz Creek, S Tenaja Rd, 33.5097, -117.31391, 650m, USGS-BRD San Diego Field Station 1.xii.1999 [AP991, 1♂, CAS]; W De Luz Creek, S Tenaja Rd, 33.5114, -117.31351, 661m, USGS-BRD San Diego Field Sta. 1.ix.2009 [AP989, 990, 2♂, CAS]; Winchester, 33.7138, -117.09151, 470m, W Icenogle 28.ix.1984 [AP035, 1♂, AUMNH]; W Icenogle 22.ix.1985 [AP040, 1♂, FMNH], 1.vi.1986 [AP041, 1♂, AUMNH], 31.xii.1972 [AP046, 1♂, FMNH], 15.i.1991 [AP047, 1♂, CAS], 25.v.1970 [AP656, 1♀, CAS]; Winchester, 1.6km NW of town center, vicinity of Double Butte, 33.7149, -117.09221, 478m, W Icenogle 18.iii.1974 [AP012, 1♀, CAS], 19.vi.1979 [AP022, 1♀, 100+juv, CAS], 28.xii.1972 [AP023, 1♂, CAS], 25.xii.1971 [AP024, 1♂, AMNH], 25.i.1975 [AP027, 1juv, CAS], 12.xi.1971 [AP033, 034 2♂, CAS], 3.xii.1975 [AP036, 1♂, AMNH], 16.xi.1997 [AP039, 1♂, FMNH], 30.ix.1967 [AP042, 1♂, CAS], 5.xi.1985 [AP043, 1♂, AMNH], 25.xi.1967 [AP045, 1♂, AMNH], 6.viii.1967 [AP390, 1♀, CAS], 20.xi.1967 [AP391, 1♂, CAS], 28.v.1967 [AP454, 1♀, AMNH], 6.viii.1967 [AP455, 1♀, 116juv., AMNH]; Winchester, Grand Ave ~1km E intersection Grand & Matthews, 33.7147, -117.111, 460m, J Bond 17.v.2009 [MY3776, 1juv, FMNH; MY3777, 1♀, AUMNH]; Winchester, 1.6km NW of town center, vicinity of Double Butte, 33.7156, -117.09361, 465m, J Bond 29.i.2004 [MY2505, 2512, 2523 3♀, AUMNH]; Winchester, Leona Rd ~1.6km S intersection w/Patton Ave, 33.6771, -117.11571, 444m, J Bond, W Icenogle, et al. 13.iii.2004 [MY2597, 1juv, AUMNH]; between Squaw Mountain & Redonda Mesa, N Tenaja Rd, 33.5025, -117.33861, 1020m, USGS-BRD San Diego Sta. 1.x.1999 [AP967, 1♂, CAS]; N base Avenaloca Mesa, S Tenaja Rd, 33.5, -117.32791, 685m, USGS-BRD San Diego Sta. 1.x.1999 [AP963, 964, 2♂, CAS]; SE Skinner Reservoir, 33.5766, -117.03161, 482m, USGS-BRD San Diego Sta. 1.ii.2000 [AP1022, 1♂, CAS]; S Skinner Reservoir, 33.577, -117.04241, 508m, USGS-BRD San Diego Sta. 1.iv.1999 [AP1021, 1♂, CAS]; W base Mesa de Colorado, W Temecula, 33.5125, -117.30121, 605m, USGS-BRD San Diego Sta. 1.ix.1999 [AP979, 1♂, CAS]; San Bernardino Co.: Alta Loma, 34.122, -117.5973, 412m, D Bixler 4.iv.1969 [AP021, 1♂, AMNH]; E Silverwood Lake, E fork of W fork Mojave River, 34.2718, -117.2971, 1099m, USGS-BRD San Diego Sta. 1.viii.2002 [AP1171, 1♂, CAS]; E Silverwood Lake, E fork of W fork Mojave River, 34.2727, -117.2931, 1090m, USGS-BRD San Diego Sta. 1.x.2000 [AP1172, 1♂, CAS], 1.vii.2002 [AP1173, 1♂, CAS]; Silverwood lake, E fork of W fork Mojave River, 34.2777, -117.31691, 1035m, USGS-BRD San Diego Sta. 1.vii.2002 [AP1170, 1♂, CAS]; N Silverwood Lake, 34.303, -117.33461, 1069m, USGS-BRD San Diego Sta. 1.viii.2002 [AP1174, 1♂, CAS]; Silverwood Lake, 34.2935, -117.30056, 1099m, C Brown 5.x.2000 [AP1215, 1216, 1217, 3♂, CAS]; W Silverwood Lake, S of W fork Mojave River, 34.283, -117.35841, 1074m, USGS-BRD San Diego Sta. 1.viii.2002 [AP1167, 1♂, CAS], 1.v.2000 [AP1168, 2♂, CAS]; Fawnskin, 34.2681, -116.94173, 2077m, L Underwood [AP028, 4♂, UCR]; Fontana, 34.0922, -117.43426, 377m, E Schlinger 16.vii.1942 [AP450, 1♂, AMNH]; Just N Alta Loma, end Archibald Avenue, N/S running ravine, E facing slope, 34.1722, -117.59471, 850m, J Bond 6.iv.1996 [AP715, 1♀, AUMNH]; Lytle Creek Rd, near Scotland, 34.244, -117.49521, 950m, M Hedin, J Satler, J Starrett, C Richart 15.ii.2009 [MY3763, 1juv, AUMNH]; San Bernardino, N edge city limits, beside hwy 18, 0.8km before turnoff to Waterman Canyon, 34.1918, -117.27733, 696m, W Icenogle 25.iv.1999 [AP1192, 1281, 1juv, 1♀, CAS]; Yucaipa, 0.8km W junction Grape Avenue & Bryant Street, 34.0641, -117.04251, 853m, W Icenogle 20.ii.2000 [AP353, 1♂, AUMNH], 23.i.2000 [AP359, 1♂, FMNH], 3.ii.2000 [AP364, 1♂, CAS], 14.xi.2000 [AP1242, 1♂, FMNH]; Yucaipa, residential area 183m S intersection Yucaipa Blvd, 34.065, -117.04224, 853m, W Icenogle 3.xi.1968 [AP457, 1♀, 140juv, AMNH]; Yucaipa, Grape Rd, Housing Development, 34.065, -117.04221, 852m, J Bond 17.xii.1997 [AP704, 1♀, AUMNH]; San Diego Co.: 0.8km N San Ysidro, 32.5629, -117.03644, 104m, W Icenogle 5.iii.1974 [AP638, 1♀, 1juv, AMNH]; Border Field St Park, S of Monument Blvd., just N international border, 32.5351, -117.11911, 16m, USGS-BRD San Diego Sta. 1.ii.2000 [AP1191, 1♂, CAS]; Carmel Mountain, 32.9283, -117.22271, 118m, USGS-BRD San Diego Field Sta. 1.xii.2002 [AP939, AP941, 2♂, CAS], 1.xi.2002 [AP943, 1♂, CAS]; Chula Vista, E Long Canyon, 32.65, -116.99081, 91m, USGS-BRD San Diego Field Sta. 1.ii.2000 [AP1069, 1♂, CAS]; Chula Vista, E Long Canyon, 32.6501, -116.99211, 90m, USGS-BRD San Diego Field Sta. 1.xi.1998 [AP1073, 1♂, CAS]; Chula Vista, Proctor Valley, SE Horseshoe Bend, S Proctor Valley Rd, 32.663, -116.98061, 152m, USGS-BRD San Diego Field Sta. 1.xi.1998 [AP1096, 2♂, CAS]; Chula Vista, Proctor Valley, SE Horseshoe Bend, S Proctor Valley Rd, 32.6637, -116.97981, 151m, USGS-BRD San Diego Sta. 1.vii.2000 [AP1066, 1♂, CAS], 1.xi.1998 [AP1068, 1♂, CAS], 1.ii.2000 [AP1224, 1♂, CAS]; Chula Vista, Terra Nova, N Rice Canyon, 32.6401, -117.03811, 94m, USGS-BRD San Diego Sta. 1.ii.2000 [AP1092, 1♂, CAS], 1.xi.1998 [AP1093, 1♂, CAS], 1.x.2000 [AP1094, 1♂, CAS]; Chula Vista, Terra Nova, N Rice Canyon, 32.6409, -117.03631, 88m, USGS-BRD San Diego Field Sta. 1.v.2000 [AP1088, 1♂, CAS], 1.xi.1998 [AP1084, 1♂, CAS]; Chula Vista, Terra Nova, N of Rice Canyon, 32.6432, -117.03771, 105m, USGS-BRD San Diego Field Sta. 1.ii.2000 [AP1095, 1♂, CAS]; Del Mar, 32.96, -117.2653, 37m, J Comstock 20.x.1956 [AP031, 2♂, AMNH]; E Lakeside between El Monte Park & entrance to El Capitan Res, El Monte Rd, 32.8836, -116.82231, 180m, M Hedin 23.ii.2008 [MY3635, 1juv, AUMNH]; E of Border Field St Park, W Goat Canyon, just N international border, 32.5378, -117.10731, 63m, USGS-BRD San Diego Sta. 1.xi.2002 [AP919, 1♂, CAS], 16.i.2003 [AP920, 1♂, CAS]; El Cajon, 32.7946, -116.96165, 132m, P Smock 25.i.1969 [AP037, 1♂, AMNH], 30.xi.1968, [AP654, 1♀, 1juv, AMNH]; El Monte Park Rd., 32.8839, -116.82141, 166m, M Hedin 19.i.2002 [MY0305, 0306, 2♀, AUMNH]; Fallbrook, 8km SE Fallbrook town center, Wilt Rd, 6.4km NW of hwy 76 & 395 jct, 33.3518, -117.17613, 206m, W Icenogle 1.v.1968 [AP270, AP461, 1♀, 3juv, CAS]; hwy 395 6.4km E Fallbrook, 0.4km from jct Mission Rd, 33.3844, -117.17654, 238m, W Icenogle 20.ix.1971, [AP263, 1♀, CAS]; hwy 76, 11.4km E junction with South 15, 33.2587, -116.81, 768m, M Hedin, J Starrett, J Skejic 10.ii.2002 [AP1246, 1♀, AUMNH]; Jamul Hollenbeck Canyon, E hwy 94, 32.6799, -116.82111, 245m, USGS-BRD San Diego Field Sta. 7.xi.2003 [AP886, 2♂, CAS]; Jamul, S Sweetwater River & Steele Canyon jct, 32.7241, -116.94431, 108m, USGS-BRD San Diego Sta. 1.xi.1998, [AP906, 1♂, CAS]; Jamul, S Sweetwater River & Steele Canyon junction, 32.7192, -116.95211, 104m, USGS-BRD San Diego Sta. 1.ii.2000 [AP912, 2♂, CAS]; Jamul, S Sweetwater River & Steele Canyon Junction, 32.7227, -116.94931, 108m, USGS-BRD San Diego Sta. 1.xi.1998 [AP909, 910, 2♂, CAS]; Jamul, S Sweetwater River & Steele Canyon Junction, 32.7251, -116.94781, 105m, USGS-BRD San Diego Sta. 1.ii.2000 [AP907, 2♂, CAS]; Jamul, SE Jamul Butte, E HWY 94, 32.6916, -116.83441, 280m, USGS-BRD San Diego Sta. 7.xi.2003 [AP885, 1♂, CAS]; Jamul, SW Honey Springs Ranch, S Honey Springs Rd, 32.6632, -116.79891, 389m, USGS-BRD San Diego Sta. 7.xi.2003 [AP887, 3♂, CAS]; Little Cedar Canyon, NE Otay Mtn, 32.6181, -116.86051, 420m, USGS-BRD San Diego Sta. 1.xi.2000 [AP914, 1♂, CAS]; Nate Harrison Grade Rd, 3.4km E jct w/hwy 76, 33.3269, -116.96521, 549m, M Hedin 11.i.2003 [MY0719, 1juv, AUMNH]; N Fallbrook on DeLuz Rd, 33.4109, -117.28981, 232m, J Bond, M Hedin 30.i.2004 [MY2465, MY2467, 2♀, AUMNH]; Otay Mesa, E Spring Canyon, N Wruck Canyon 1, 32.5545, -116.99881, 138m, R Fisher 16.i.2003 [AP821, 2♂, CAS]; Palomar Mountain area Cleveland Natl Forest, St Rd S6, ~4.8 rd km SW intersection of S6 & S7, 33.3048, -116.87864, 1275m, W Icenogle 15.vii.1970 [AP009, 2♀, CAS]; Palomar Mtns, HWY S6, 1.4km N jct w/St Park Rd, 33.343, -116.90041, 1445m, M Hedin, J Starrett, J Skejic 10.ii.2002 [AP1255, 1♀, AUMNH]; Rt 395, 0.3km S turnoff to Fallbrook onto Co Rd 513, 33.3811, -117.17394, 217m, F Coyle 28.vii.1972 [AP639, 1♀, AMNH]; San Diego, 32.732, -117.1023, 85m, B Kaston 1.xi.1970 [AP019, 1♂, AMNH]; San Diego Area, 32.7327, -117.11047, 65m, L Hutton 5.xi.1976 [AP038, 1♂, CAS]; San Diego, near San Diego St University, N end Hewlett Dr, 32.7776, -117.0794, 85m, B Kaston 1.xii.1970 [AP449, 3♂, CAS]; Tijuana Estuary, W Imperial Beach Naval Air station, 32.5603, -117.12631, 4♂, USGS-BRD San Diego Field Sta. 1.iv.1999 [AP922, 923, 2♂, CAS]; Tijuana Estuary, W Imperial Beach Naval Air station, 32.5616, -117.12571, 20m, USGS-BRD San Diego Sta. 1.ii.1999 [AP924, 1♂, CAS]; Torrey Pines St Reserve, 32.9205, -117.25743, 60m, R Fisher 1.xi.1998 [AP862, 2♂, CAS]; Torrey Pines St Reserve 8, 32.927, -117.25623, 12m, R Fisher 1.xii.1999 [AP868-870 2♂, 1juv, CAS]; Torrey Pines St Reserve, E beach, W of N Torrey Pines Rd 1, 32.9205, -117.25741, 62m, R Fisher 1.ii.2000 [AP861, 1♂, CAS]; Torrey Pines St Reserve, E of beach, W of N Torrey Pines Road 3, 32.9217, -117.25681, 59m, R Fisher 1.xi.1998 [AP864, 1♂, CAS], 1.xii.1999 [AP865, 1♂, CAS]; Torrey Pines St Reserve, S Del Mar Heights School 11, 32.9442, -117.25321, 90m, R Fisher 1.v.1998 [AP858, 3♂, CAS]; Torrey Pines St Reserve, S Del Mar Heights School 2, 32.9398, -117.25181, 62m, R Fisher 1.xii.1999 [AP849, 1♂, CAS]; Torrey Pines St Reserve, S Del Mar Heights School 5, 32.9414, -117.25041, 85m, R Fisher 1.xi.1998 [AP852, 1♂, CAS], 1.xii.1999 [AP853, 1♂, CAS]; Torrey Pines St Reserve, S Del Mar Heights School 7, 32.9402, -117.25281, 62m, R Fisher 1.xi.1998 [AP854, 1♂, CAS]; Torrey Pines St Reserve, W of N Torrey Pines Rd, 32.9258, -117.25051, 11m, USGS-BRD San Diego Sta. 1.ii.2000 [AP929, 1♂, CAS], 1.xii.1999 [AP930, 1♂, CAS]; Torrey Pines St Reserve, W of N Torrey Pines Rd, 32.9208, -117.25681, 66m, USGS-BRD San Diego Sta. 1.xi.1998 [AP927, 1♂, CAS]; Torrey Pines St Reserve, W of N Torrey Pines Rd 2, 32.9144, -117.25061, 101m, R Fisher 1.iv.2000 [AP845, 1♂, CAS]; University of California Elliot Reserve, Carroll Canyon, 32.8943, -117.10581, 166m, USGS-BRD San Diego Sta. 1.xi.1998 [AP877, 1♂, CAS]; University of California Elliot Reserve, S of Carroll Canyon, 32.8945, -117.08671, 218m, USGS-BRD San Diego Sta. 1.iv.2000 [AP883, 1♂, CAS]; University of California Elliot Reserve, S of Carroll Canyon, 32.8917, -117.09711, 194m, USGS-BRD San Diego Sta. 1.xi.1999 [AP880, 1♂, CAS]; University of California Elliot Reserve, S of Carroll Canyon, 32.8926, -117.10581, 186m, USGS-BRD San Diego Sta. 1.ii.2000 [AP878, 1♂, CAS]; vic. Chula Vista, 32.6405, -117.10413, 5m, R Fisher 21.ii.2000 [AP1250, 1♂, CAS]; San Diego, 32.7153, -117.15647, 20m, B Kaston 1.xii.1971 [AP026, 2♂, AMNH]; Camp Pendleton Marine Corps Base, E of De Luz Creek Rd, SW of Sandia Canyon, Pitfall array CAM-23, 33.4112, -117.2951, 337m, R Fisher [AP825, 1♂, CAS]; Del Mar Mesa, 32.9404, -117.17421, 105m, USGS-BRD San Diego Sta. 1.ix.2002 [AP1033, 1♂, CAS]; Marron Valley, 32.5673, -116.77371, 171m, USGS-BRD San Diego Sta. 1.xi.2000 [AP970, 1♂, CAS]; Pt Loma, Ft Rosecrans, US Navy Reservation, NE of cemetery, 32.6949, -117.24351, 90m, R Fisher 1.x.1998 [AP817, 1♂, CAS].

GenBank accessions.

16S-tRNAval-12S: JX103319-JX103339.

Distribution and natural history.

Most Aptostichus icenoglei specimens have been collected from the southern California counties Los Angeles, Orange, Riverside, San Bernardino, and San Diego (Map 14). Although only a single specimen is known from the northern reaches of the Baja Peninsula, it is likely that the species is distributed more extensively in this region of Mexico. The species is distributed widely throughout the Transverse Ranges to the north of the Los Angeles Basin and southward into the Santa Ana and San Jacinto Mountains and the ranges and hills surrounding the San Diego area (San Ysidro and Jamul Mountains and points north of the city). The DM (Map 15) indicates that considerable suitable habitat likely can be found in the areas surrounding San Diego and throughout the Santa Ana and San Jacinto Mountains. Interestingly the model shows the Transverse Ranges to the north and west of the Los Angeles Basin to be an area of lower probability. Given genetic structuring in populations and diversity of habitat it may very well be likely that Aptostichus icenoglei as defined here comprises more than one species. Primary habitat types for this species include coastal chaparral forest and shrub and coastal range open woodland shrub and coniferous forest. Based on pitfall trap records, male dispersal is wide ranging (August–May), however, most wandering males at lower altitudes appear to be taken during the early winter months of November–January likely associated with the winter rains.

Maps 14, 15.

Aptostichus icenoglei sp. n. 14 distribution of known specimens 15 predicted distribution; cooler colors–blue shades–represent areas of high probability of occurrence, warmer colors–yellow and orange shades–represent areas of low probability of occurrence.

Conservation status.

The status of this species is likely secure given how abundant it is in collections and how widespread it is geographically.

Species concept applied.



Despite some subtle differences, female Aptostichus icenoglei specimens can be difficult to distinguish from Aptostichus atomarius; juveniles are very problematic; molecular data were used to place many specimens (adults and juveniles) collected over the course of this study. As discussed above, Aptostichus icenoglei as currently defined is found in a diversity of habitats across a considerable geographical range. The ~20 mtDNA sequences thus far collected for the species show considerable structuring that is consistent with cryptic species complexes hypothesized for other Aptostichus species. As such this taxon will likely be further divided at some point in the future on the basis of more detailed molecular and ecological studies.

Aptostichus cabrillo sp. n.

‘The Cabrillo Monument Trapdoor Spider’



Figures 157–164, Maps 16, 17

Male holotype and paratype (AP1161) from California, San Diego County, Point Loma, Cabrillo National Monument, 32.66818, -117.242301, 42m, coll. R. Fisher (USGS-BRD San Diego Field Station) vii.2002. Female paratype (MY3800) from type locality, 32.7101, -117.25231, coll. J. Satler 13.vii.2009. Deposited in AUMNH.


The specific epithet is a noun taken in opposition taken from the type locality, Cabrillo National Monument, named in honor of Juan Rodríguez Cabrillo one of the first European explorers of the North American west coast.


Aptostichus cabrillo most closely resembles Aptostichus icenoglei specimens and are differentiated from that species in its diagnosis (above).

Description of male holotype.

Specimen preparation and condition. Specimen collected live from pitfall trap, preserved in 80% ETOH. Coloration lightly faded. Pedipalp, leg I left side removed, stored in vial with specimen. General coloration. Carapace, chelicerae, legs strong brown 7.5YR 5/8. Abdomen strong brown 7.5YR 4/6, with light mottled striping, ventrum, spinnerets pale yellow (Fig. 157). Cephalothorax. Carapace 6.00 long, 4.75 wide, lightly hirsute with thin white spines, stout black bristles along fringe; pars cephalica elevated. Fringe, posterior margin with black bristles. Foveal groove deep, straight. Eyes on moderately high mound. AER slightly procurved, PER slightly recurved. PME, AME subequal diameter. Sternum moderately setose, STRl 3.32, STRw 2.60. Posterior sternal sigilla small, positioned more towards outer margin, not contiguous, anterior sigilla pairs small, oval, marginal. Chelicerae with distinct anterior tooth row comprising 7 teeth, posterior margin with small patch of small denticles. Palpal endites with patch of small cuspules on proximal, inner margin, labium with 4 poorly formed cuspules, LBw 0.94, LBl 0.60. Rastellum consists of 6 stout spines not on mound. Abdomen. Setose, heavy black setae intermingled with fine black setae. Legs. Leg I: 5.35, 3.90, 3.95, 3.00, 1.75; leg IV: 5.30, 3.25. Very light tarsal scopulae on legs I, II. Tarsus I with single, slightly staggered row of 12 trichobothria. Leg I spination pattern illustrated in Figures 160, 161; TSp 4, TSr 3, TSrd 4. Pedipalp. Articles stout, lacking distinct spines (Fig. 159). PTw 1.0, PTl 2.25, Bl 1.05. Embolus slender, sinuous, tapering sharply toward tip, lacking serrations (Fig. 158).

Variation (7). Cl 5.05-6.00, 5.40±0.14; Cw 3.75-4.75, 4.20±0.12; STRl 2.73-3.32, 3.07±0.08; STRw 2.10-2.60, 2.37±0.06; LBw 0.74-0.94, 0.81±0.03; LBl 0.43-0.60, 0.5±0.02; leg I: 4.65-5.35, 5.00±0.09; 3.50-3.90, 3.69±0.06; 3.21-3.95, 3.52±0.10; 2.40-3.00, 2.57±0.08; 1.60-1.95, 1.77±0.05; leg IV: 4.75-5.30, 5.03±0.08; 2.69-3.25, 2.84±0.07; PTl 1.93-2.25, 2.08±0.04; PTw 0.77-1.00, 0.91±0.03; Bl 0.96-1.10, 1.02±0.02; TSp 2-4, 3.29±0.36; TSr 2-6, 3.14±0.51; TSrd 4-10, 5.57±0.92.

Description of female paratype.

Specimen preparation and condition. Female collected live from burrow, preserved in same manner as male holotype. Genital plate removed, cleared in trypsin, stored in microvial with specimen. Color. Carapace, legs, chelicerae, yellowish brown 10YR 5/4. Abdomen brown dorsally 10YR 4/3 with distinct chevron striping, ventrum, spinnerets pale yellow. Cephalothorax. Carapace 6.19 long, 5.25 wide, glabrous; generally smooth surface, lightly hirsute, pars cephalica moderately elevated (Figs 162, 164). Fringe lacks setae. Foveal groove deep, procurved. Eye group slightly elevated on low mound. AER slightly procurved, PER slightly recurved. PME, AME subequal diameter. Sternum widest at coxae II/III, moderately setose, STRl 4.16, STRw 3.07. Three pairs of sternal sigilla anterior pairs small , oval, positioned marginally, posterior pair slightly larger, oval, mesially positioned but not contiguous. Chelicerae anterior tooth row comprising 8 teeth with posterior margin denticle patch comprising two rows. Palpal endites with 37 cuspules concentrated at inner (promargin) posterior heel; labium with 4 cuspules, LBw 1.19, LBl 0.66. Rastellum consists of 6 very stout spines not positioned on mound. Abdomen. Moderately setose. PLS all 3 segments with spigots. Terminal segment 1/2 length of medial segment, 2 enlarged spigots visible at tip. PMS single segment, with spigots, short with rounded terminus. Legs. Anterior two pairs noticeably more slender than posterior pairs. Leg I 14.71 long. Tarsus I with single staggered row of 17 trichobothria. Legs I, II with moderately heavy scopulae on tarsi, metatarsi, distal aspect tibia. PTLs 10, TBs 6. Distinct preening comb on retrolateral distal surface at tarsus-metatarsus joint of metatarsus III, IV. Spermathecae. Heavily sclerotized intermediate sized median stalk with small slender basal extension (Fig. 163).

Variation (3). Cl 6.00-6.38, 6.19±0.11; Cw 4.95-5.45, 5.22±0.15; STRl 3.72-4.16, 3.89±0.14; STRw 2.85-3.30, 3.07±0.13; LBw 1.07-1.19, 1.13±0.03; LBl 0.66-0.77, 0.73±0.04; Leg I: 14.20-15.16, 14.69±0.28; ANTd 6-8, 7.00±0.58; PTLs 10-14, 12.00±1.15; TBs 4-6, 5.33±0.67.

Figures 157–161.

Aptostichus cabrillo sp. n. male holotype from San Diego Co. (AP1161). 157 habitus [806592]; scale bars = 1.0mm 158 retrolateral aspect, palpal bulb [806596] 159 retrolateral aspect, pedipalp [806713] 160, 161 leg I, retrolateral and prolateral aspect views [806600, 806598].

Figures 162–164.

Aptostichus cabrillo female from San Diego Co., type locality. 162, 163 habitus and cleared spermathecae of paratype (MY3800) [806605]; scale bar = 0.1mm 164 live photograph (MY3801).

Material examined.

Mexico: Baja California: 9km NW Rancho Santa Ines, 29.766, -114.7661, 550m, [AP634, 1♂, AMNH], P Blom, W Clark [AP635, 422, 423, 3♂, AMNH]; Sierra San Pedro Martir Natl Park, Vallecitos, 32.3833, -116.88336, 500m, 21.vii.1977 [AP633, 1♂, CAS]; United States: California: San Diego: 0.8km N of Mexican border & 2.4km E of ocean, 32.5434, -117.11435, 3♂, W Icenogle 19.i.1969 [AP637, 1♀, AMNH]; Otay Mesa, S hwy 905, Spring Canyon, 32.5601, -117.00051, 107m, USGS-BRD San Diego Sta. 1.vii.2001 [AP973, ♂, CAS]; Chula Vista, Terra Nova, N Rice Canyon, 32.6401, -117.03811, 94m, USGS-BRD San Diego Sta. 1.vii.1998 [AP1091, 1♂, CAS]; Chula Vista, Terra Nova, N Rice Canyon, 32.6409, -117.03631, 88m, USGS-BRD San Diego Field Sta. 1.ix.1999 [AP1087, 1♂, CAS]; Chula Vista, Terra Nova, N Rice Canyon, 32.6415, -117.03581, 102m, USGS-BRD San Diego Field Sta. 1.vii.1998 [AP1086, 1♂, CAS]; Chula Vista, E Long Canyon, 32.6501, -116.99211, 90m, USGS-BRD San Diego Field Sta. 1.vii.2000 [AP1078, 1♂, CAS], 1.vii.1998 [AP1076, 1♂, CAS], 1.vii.1999 [AP1074, AP1079, 3♂, CAS]; Pt Loma, Cabrillo Natl Monument, 32.667, -117.241, 89m, J Javier 16.ii.2002 [AP1197, 1♀, CAS]; Pt Loma, US Coast Guard Reservation, S of Cabrillo Natl Monument, 32.667, -117.24211, 22m, R Fisher 1.vii.2002 [AP871, 1♂, CAS]; Pt Loma, Cabrillo Natl Monument, N of U.S. Coast Guard reservation, 32.6681, -117.24231, 33m, USGS-BRD San Diego Sta. 1.vii.2002 [AP1161, 3♂, CAS]; Pt Loma, Cabrillo Natl Monument, (Zuniga Point) E facing slope, 32.6689, -117.2381, 54m, USGS-BRD San Diego Sta. 1.vii.2002 [AP1162, 1♂, CAS], 1.ix.2002 [AP1163, 2♂, CAS]; Pt Loma, Cabrillo Natl Monument, W [beach] facing slopes, 32.6719, -117.24441, 22m, USGS-BRD San Diego Sta. 1.vii.2002 [AP1160, 1♂, CAS]; Pt Loma, Cabrillo Natl Monument, W [beach] facing slopes, 32.672, -117.2441, 22m, USGS-BRD San Diego Sta. 1.x.2002, [AP1164, 1♂, CAS]; Pt Loma, Ft Rosecrans, US Navy Reservation, NE of cemetery, 32.6959, -117.24291, 83m, USGS-BRD San Diego Sta. 1.viii.2002 [AP1001, 1♂, CAS]; Cabrillo Natl Monument, Pt Loma, 32.7101, -117.25231, 79m, J Satler 13.vii.2009 [MY3800, 3801, 2♀, AUMNH]; El Cajon, 32.7946, -116.96165, 132m, M Hoff 2.xi.1965, [AP572, 1♂, AMNH]; San Diego, Kearny Mesa area, 32.8284, -117.14475, 124m, S Johnson 1.vii.1981, [AP573, 1♂, AMNH]; Flinn Spring, Rios Canyon, 32.8423, -116.87251, 256m, USGS-BRD San Diego Sta. 1.i.2001 [AP1081, 1♂, CAS]; Del Mar Mesa, 32.9403, -117.17171, 126m, USGS-BRD San Diego Sta. 1.vii.2001 [AP996, 1♂, CAS]; Del Mar Mesa, 32.9404, -117.17421, 105m, USGS-BRD San Diego Sta. 1.vi2002 [AP1064, 1♂, CAS]; Del Mar Mesa, 32.942, -117.17491, 104m, USGS-BRD San Diego Field Sta. 1.vii.2001 [AP1060, 2♂, CAS], 12.ix.2002 [AP1061, 1♂, CAS]; Del Mar Mesa, 32.9423, -117.1681, 102m, USGS-BRD San Diego Field Sta. 1.vi.2002 [AP1062, 1♂, CAS].

Distribution and natural history.

The distribution of Aptostichus cabrillo is restricted geographically to a small area in around San Diego, San Diego Co. with one specimen known from just to the south in Mexico (Baja California); the primary habitat throughout this region is coastal chaparral forest and shrub. The DM for this species indicates that suitable habitat in San Diego is restricted to the San Diego area along the coast. Failure to predict the occurrence of some of the outlying localities to the east may suggest that some of those specimens may have been misidentified–however, many of these are males that are easy to distinguish from Aptostichus icenoglei. Most male specimens have been collected during the summer months (June–September) with a few taken from pitfalls in October, November and January.

Maps 16, 17.

Aptostichus cabrillo sp. n. 16 distribution of known specimens 17 predicted distribution; cooler colors–blue shades–represent areas of high probability of occurrence, warmer colors–yellow and orange shades–represent areas of low probability of occurrence.

Conservation status.

Because this species is generally rare in collections and restricted in distribution to an area that is highly impacted by development, I consider its status to be vulnerable.

Species concept applied. Morphological.

Aptostichus isabella sp. n.

‘The Lake Isabella Trapdoor Spider’



Figures 165–168, Map 1

Male holotype (MY3824), from California, Kern County, Erskine Creek Rd., 5.6km E or intersection with Lake Isabella Blvd., E of Bodfish, 35.5689, -118.43831, 925m, coll. J. Satler 8–29x.2010; deposited in AUMNH.


The specific epithet is a noun taken in apposition from the type locality, Lake Isabella.


Males can be diagnosed on the basis of a unique conformation of the tibia I mating apophysis and TSrd spination pattern (Figs 165–167. Like Aptostichus icenoglei, the Aptostichus isabella tibial I apophysis (Figs 165, 167) is rectangular in shape and bears a distal spine. In all other Aptostichus species the tibial I apophysis is triangular, rounded, or absent, with the exception of Aptostichus cabrillo which has a similar rectangular apophysis. Aptostichus isabella males can be differentiated from Aptostichus icenoglei and Aptostichus cabrillo males on the basis of the TSr (Figs 165, 167) spination pattern. The TSr of Aptostichus isabella consists of a number of spines offset proximally with no TSrd spines whereas Aptostichus icenoglei and Aptostichus cabrillo have 2-4 non–overlapping TSrd spines.

Description of male holotype.

Specimen preparation and condition. Specimen collected in pitfall trap, preserved in 80%. Coloration in relatively pristine condition. Pedipalp, leg I left side removed, stored in vial with specimen. General coloration. Carapace, chelicerae, legs very dark brown 10YR 2/2. Abdomen yellowish brown 10YR 5/4 with dark distinct chevron striping dorsally. Cephalothorax. Carapace 5.60 long, 4.50 wide, very hirsute with white setae, stout black bristles along fringe; surface smooth, pars cephalica elevated. Fringe, posterior margin with black bristles. Foveal groove deep, straight. Eyes on relatively high mound. AER slightly procurved, PER slightly recurved. PME, AME subequal diameter. Sternum moderately setose, STRl 3.13, STRw 2.38. Posterior sternal sigilla small, widely separated, anterior sigilla pairs small, oval, marginal. Chelicerae with distinct anterior tooth row comprising 6 teeth, posterior margin with patch of small denticles. Palpal endites with very small patch of small cuspules on proximal, inner margin, labium lacks cuspules, LBw 0.92, LBl 0.44. Rastellum consists of 6 stout spines not on mound. Abdomen. Setose, heavy black setae intermingled with fine black setae. Legs. Leg I: 5.69, 4.20, 3.88, 2.79, 2.33; leg IV: 6.00, 3.13. Light scopulae on tarsi, metatarsi legs I, II. Tarsus I with single, slightly staggered row of 10 trichobothria. Leg I spination pattern illustrated in Figures 165-167; TSp 10, TSr 3, TSrd 0. Pedipalp. Articles slender, lacking distinct spines (Fig. 168). PTw 0.80, PTl 2.58, Bl 1.26. Embolus long, very slender, tapering gradually toward tip, lacking serrations (Fig. 168).

Variation. Known only from the type specimen.

Figures 165–168.

Aptostichus isabella sp. n. male holotype (MY3824) from Kern Co. 165–167 leg I 165 retrolateral aspect [805901] 166 prolateral aspect [806607] 167 line drawing, retrolateral aspect 168 retrolateral aspect, pedipalp [805903]. Scale bars = 1.0mm.

Description of female.

Known only from male specimens.

Material examined.

Known only from the type specimen.

Distribution and natural history.

Aptostichus isabella is known only from a single specimen collected from the type locality (Map 1) in Kern Co., Piute Mountains; the habitat in the region is primarily classified as Sierran steppe, mixed coniferous forest.

Conservation status.


Species concept applied.



Although based on a single specimen, the morphology of this hypothesized species is significantly divergent, and represents an interesting form such that recognizing it as a nominal taxon is warranted.

Aptostichus muiri sp. n.

‘The Yosemite Valley Trapdoor Spider’



Figures 169–173, Map 1

Male holotype (AP409) from California, Mariposa County, 3.2km SE of Mariposa, 37.4668, -119.93845, 640m, coll. M. Bentzien 20.ix.1972, deposited in CAS. Female paratype (AP1263) from California, Mariposa County, Yosemite National Park, west facing slope of valley off of “4 Mile” trailhead, 37.7226, -119.59431, 1128m, coll. J. Bond 10.v.1997, deposited in AUMNH.


The specific epithet is a patronym in honor of John Muir, one of the first European explorers to visit Yosemite Valley, and to subsequently fight for its preservation.


Males of this species are similar to those of Aptostichus atomarius complex individuals, however Aptostichus muiri has fewer TSrd spines and a more slender palpal tibia (Figs 169-172). They can be distinguished from all other species of Aptostichus by their unique tibia I spination pattern. The female paratype of this species, collected not far from the type locality, is tentatively placed as a conspecific with the male holotype. This female specimen can be distinguished from Aptostichus atomarius by having fewer labial cuspules and a secondary spermathecal bulb (Fig. 173) that is much smaller than that observed for most putative Aptostichus atomarius specimens.

Description of male holotype.

Specimen preparation and condition. Specimen collected live, preserved in 80%. Coloration faded. Pedipalp, leg I left side removed, stored in vial with specimen. General coloration. Carapace, chelicerae, legs strong brown 7.5YR 4/6. Abdomen brown 10YR 4/3 dorsally with distinct mottled striping, ventrum, spinnerets pale yellow. Cephalothorax. Carapace 5.70 long, 4.70 wide, glabrous, stout black bristles along fringe; surface hirsute with light white spines, pars cephalica elevated. Fringe, posterior margin with black bristles. Foveal groove deep, straight. Eyes on low mound. AER slightly procurved, PER slightly recurved. PME, AME subequal diameter. Sternum moderately setose, STRl 2.91, STRw 2.53. Posterior sternal sigilla moderate size, positioned centrally, not contiguous, anterior sigilla pairs small, oval, marginal. Chelicerae with distinct anterior tooth row comprising 6 teeth, posterior margin with single row of small denticles. Palpal endites with patch of small cuspules on proximal, inner margin, labium lacks cuspules, LBw 0.85, LBl 0.51. Rastellum consists of 5 very stout spines not on mound. Abdomen. Setose, heavy black setae intermingled with fine black setae. Legs. Leg I: 5.10, 3.50, 3.50, 2.33, 2.05; leg IV: 5.40, 2.75. Light tarsal scopulae on legs I, II. Tarsus I with single, slightly staggered row of 11 trichobothria. Leg I spination pattern illustrated in Figures 171, 172; TSp 3, TSr 3, TSrd 3. Pedipalp. Articles slender, lacking distinct spines (Fig. 170). PTw 0.94, PTl 2.18, Bl 1.21. Embolus slender, sinuous, lacking serrations (Fig. 170).

Figures 169–173.

Aptostichus muiri sp. n. from Mariposa Co. 169–172 male holotype (AP409); scale bars = 1.0mm 169 habitus [805918] 170 retrolateral aspect, pedipalp [805916] 171 retrolateral aspect, leg I [805910] 172 prolateral aspect, leg I [805914] 173 female paratype (AP1263), cleared spermathecae [805906]; scale bar = 0.1mm.

Variation. Known only from the type specimen.

Description of female paratype.

Specimen preparation and condition. Female collected live from burrow, prepared in same manner as male holotype. Genital plate removed, cleared in trypsin, stored in microvial with specimen. General coloration. Carapace, legs, chelicerae, brown 7.5YR 4/4. Abdomen black dorsally 7.5YR 2.5/1 with light mottled striping, ventrum, spinnerets pale yellow. Cephalothorax. Carapace 5.00 long, 4.08 wide, lightly hirsute with thin black spines; generally smooth surface, pars cephalica moderately elevated. Fringe lacks setae. Foveal groove deep, procurved. Eye group slightly elevated on low mound. AER slightly procurved, PER slightly recurved. PME’s larger in diameter than AME’s. Sternum widest at coxae II/III, moderately setose, STRl 2.83, STRw 2.40. Three pairs of sternal sigilla anterior pairs small, oval, marginal, posterior pair larger, oval, mesially positioned. Chelicerae anterior tooth row comprising 6 teeth with posterior margin denticle patch. Palpal endites with 17 cuspules concentrated at the inner (promargin) posterior heel; labium with 3 cuspules, LBw 0.94, LBl 0.58. Rastellum consists of 6 very stout spines not positioned on mound; fringe of short spines along distal promargin extending upward from rastellum. Abdomen. Moderately setose. PLS all 3 segments with spigots. Terminal segment 1/2 length of medial segment, 2 enlarged spigots visible at tip. PMS single segment, with spigots, short with rounded terminus. Legs. Anterior two pairs noticeably more slender than posterior pairs. Leg I 11.44 long. Tarsus I with single staggered row of 15 trichobothria. Legs I, II, III with moderately light scopulae on tarsi only. PTLs 12, TBs 3. Rudimentary preening comb on retrolateral distal surface at tarsus-metatarsus joint) of metatarsus III, IV. Spermathecae. Median stalk lightly sclerotized, basal extension lacks a well-developed bulb that does not extend below lateral plane of base (Fig. 173)

Variation. Known only from the paratype specimen.

Material examined.

Known only from the type material.

Distribution and natural history.

Aptostichus muiri is known only from Mariposa County in the Sierra Nevada Mountains (Map 1); the habitat from which the single female was collected from a shallow burrow is classified as mixed coniferous forest.

Conservation status.


Species concept applied.


Aptostichus barackobamai sp. n.

‘The Barack Obama Trapdoor Spider’



Figures 174–187, Maps 18, 19

Male holotype (AP411) and male paratype (AP411) from California, Mendocino County, Hopland Field Station, 39.0016, -123.08553, 253m, coll. M. Bentzien 29.viii.1973, 21.xii.1972; deposited in AMNH. Male paratype (MY3805) from California, Tehama County, Cottonwood, 40.31677, -122.349981, 183m, coll. C. Will 15.x.2009; female paratype (MY3158) from California, Mendocino County, County Rd 201, 6.8km N of JCT w/ Hwy 175, 39.02832, -123.130343, coll. A. Stockman 18.v.2005; deposited in AUMNH.


The specific epithet is a patronym in honor of Barack Obama, first African American President of the United State and reputed fan of spiders.


Aptostichus barackobamai males (Fig. 174) can be distinguished from all other Aptostichus species on the basis of a unique TSrd spination pattern which comprise numerous spines offset proximally (similar to Aptostichus isabella) in combination with a triangular shaped metatarsal mating apophysis (Figs 175-178); male Aptostichus isabella specimens have a similar TSrd pattern but have a rectangular mating apophysis. Females can be distinguished from all other known Aptostichus species by having a medial auxiliary spermathecal bulb (Figs 181, 182).

Description of male holotype.

Specimen preparation and condition. Specimen collected live, preserved in 70% EtOH. Coloration presumed faded. Pedipalp, leg I left side removed, stored in vial with specimen. General coloration. Carapace, chelicerae, legs dark red 2.5YR 3/6. Abdomen reddish brown 5YR 4/4, distinct mottled striping dorsally Figs 174, 183, 184, 186, 187). Cephalothorax. Carapace 5.94 long, 5.06 wide, covered in thin white setae, stout black bristles along fringe; surface smooth, pars cephalica elevated. Fringe, posterior margin with few black bristles. Narrow foveal groove deep, slightly procurved. Eyes on low mound. AER slightly procurved, PER slightly recurved. PME, AME subequal diameter. Sternum moderately setose, STRl 3.16, STRw 2.64. Posterior sternal sigilla moderate in size, positioned towards margin, not contiguous, anterior sigilla pairs small, oval, marginal. Chelicerae with distinct anterior tooth row comprising 6 teeth, posterior margin with single row of small denticles. Palpal endites with single cuspules on proximal, inner margin, labium lacks cuspules, LBw 0.94, LBl 0.53. Rastellum consists of 6 stout spines not on mound. Abdomen. Setose, heavy black setae intermingled with fine black setae. Legs. Leg I: 5.45, 4.05, 3.80, 2.79, 2.00; leg IV: 5.69, 3.20. Heavy to moderate scopulae on tarsus, metatarsus legs I, II; light scopulae on tarsus legs III, IV. Tarsus I with single, slightly staggered row of 12 trichobothria. Leg I spination pattern illustrated in Figures 175-178; TSp 4, TSr 6, TSrd 7. Pedipalp. Articles slender, lacking distinct spines (Fig. 179). PTw 0.75, PTl 2.55, Bl 1.29. Embolus broad, tapering sharply towards very thin tip, curved distally, lacking serrations (Fig. 179).

Variation (4). Cl 5.00-6.25, 5.81±0.28; Cw 4.08-5.06, 4.79±0.24; STRl 2.75-3.47, 3.14±0.15; STRw 2.23-2.79, 2.58±0.12; LBw 0.78-0.94, 0.9±0.04; LBl 0.43-0.60, 0.54±0.04; leg I: 4.55-6.13, 5.53±0.36; 3.26-4.45, 4.02±0.27; 3.04-4.00, 3.66±0.21; 2.13-2.79, 2.62±0.16; 1.70-2.17, 1.97±0.1; leg IV: 5.00-6.38, 5.83±0.31; 2.52-3.20, 3.01±0.16; PTl 2.18-2.95, 2.62±0.17; PTw 0.60-0.77, 0.72±0.04; Bl 1.07-1.33, 1.25±0.06; TSp 4-4, 4.00±0; TSr 1-6, 3.25±1.11; TSrd 5-9, 7.00±0.82.

Description of female paratype.

Specimen preparation and condition. Female collected live from burrow, prepared in same manner as male holotype. Genital plate removed, cleared in trypsin, stored in microvial with specimen. General coloration. Carapace, legs, chelicerae, dark reddish brown 2.5YR 2.5/4. Abdomen dark brown dorsally 10YR 3/3, distinct mottled chevron marking pattern. Cephalothorax. Carapace 8.00 long, 6.88 wide, lightly hirsute with fine black setae intermingled with white setae; generally smooth surface, pars cephalica moderately elevated. Fringe lacks setae. Foveal groove deep, slightly procurved. Eye group slightly elevated on low mound. AER slightly procurved, PER slightly recurved. PME-AME subequal diameter. Sternum widest at coxae II/III, moderately setose, STRl 4.56, STRw 3.76. Three pairs of sternal sigilla anterior pairs small in size, oval, marginal; posterior pair moderate in size, oval, positioned between margin, midpoint. Chelicerae anterior tooth row comprising 8 teeth with posterior margin denticle patch. Palpal endites with 12 cuspules concentrated at the inner promargin posterior heel; labium with 3 cuspules, LBw 1.39, LBl 1.02. Rastellum consists of 7 very stout spines not positioned on mound, forming a contiguous row; fringe of short spines along distal promargin extending upward from rastellum. Abdomen. Moderately setose. PLS all 3 segments with spigots. Terminal segment 1/2 length of medial segment, 2 enlarged spigots visible at tip. PMS single segment, with spigots, short with rounded terminus. Legs. Anterior two pairs noticeably more slender than posterior pairs. Leg I 17.25 long. Tarsus I with 12 trichobothria arranged in three staggered rows. Legs I, II with moderately heavy scopulae on tarsus, metatarsus; heavy scopulae distal most aspect tibia I, light scopulae on distal aspect tarsus legs III, IV. PTLs 17, TBs 3. Distinct preening comb on retrolateral distal surface, tarsus-metatarsus joint, of metatarsus III, IV. Spermathecae. 2 complex spermathecal bulbs with an elongate curved stalk, large basal extension, third medial bulb (Fig. 181, 182).

Variation (5). Cl 7.52-8.56, 8.05±0.19; Cw 6.31-7.52, 6.90±0.20; STRl 4.56-5.35, 4.88±0.16; STRw 3.72-4.40, 3.87±0.13; LBw 1.36-1.65, 1.43±0.06; LBl 0.82-1.11, 0.97±0.05; Leg I: 16.04-19.55, 17.66±0.63; ANTd 8-10, 8.60±0.40; PTLs 13-19, 17.00±1.41; TBs 2-5, 3.50±0.65.

Figures 174–180.

Aptostichus barackobamai sp. n. 174–176 male holotype from Mendocino Co. (AP411) 174 habitus [806630] 175 retrolateral aspect, leg I [806634] 176 prolateral aspect, leg I [806636] 177–179 male paratype from Tehama Co. (MY3805) 177 retrolateral aspect, leg I [806638] 178 prolateral aspect, leg I [806642] 179 retrolateral aspect, pedipalp [806644] 180 line drawings of leg I holotype and paratype specimens; retrolateral aspect of holotype pedipalp. Scale bars = 1.0mm.

Figures 181, 182.

Aptostichus barackobamai sp. n. cleared spermathecae; scale bars = 0.1mm. 181 paratype from Mendocino Co. (MY3158) [806709] 182 from Sutter Co. (AP285) [806712].

Figures 183–187.

Photographs of live Aptostichus barackobamai sp. n. 183, 184 male paratype specimen from Tehama Co. (MY3805) 185 female specimen from Tehama Co. (MY3804) 186, 187 male specimen from Marin Co. (AUMS001).

Material examined.

United States: California: Mendocino Co.: Hopland Field Station, 39.0016, -123.08553, 253m, M Bentzien 21.xii.1972 [AP410, 1♂, AMNH], 29.viii.1973 [AP411, 1♂, AMNH], 6.x.1972 [AP525, 1juv, AMNH], 7.iv.1972 [AP526, 1♀, AMNH], 27.ix.1972 [AP527, 1♂, AMNH], 10.x.1972 [AP528, 1♀, AMNH]; Hwy 253, SW Ukiah, 10.8km W jct W/Hwy 101, 39.0552, -123.2451, 600m, M Hedin, J. Starrett, D Leavitt 20.xii.2007 [MY3625, 1♀, AUMNH]; Co Rd 201, 6.8km N jct w/hwy 175, 39.0283, -123.13031, 175m, A Stockman 18.v.2005 [MY3158, 1♀, AUMNH]; Orr Springs Rd, Ackerman Creek- 1st stream crossing W hwy 101, 39.1807, -123.2331, 211m, J Bond 14.iii.2005 [MY3025, 1♀, AUMNH]; Orr Springs Rd, 3.8km W bridge, 39.1924, -123.26591, 543m, J Bond 14.iii.2005 [MY3026, 1♀, AMNH]; Orr Springs Rd, W of Hwy 101, 13.4km W 1st bridge, 39.2293, -123.34261, 571m, J Bond 14.iii.2005 [MY3027, 1♀, FMNH], [MY3028, 1juv, AUMNH]; Orr Springs Rd, 19.5km W Ackerman Creek, 39.2352, -123.39411, 225m, J Bond 14.iii.2005 [MY3029, 1♀, AUMNH]; Orr Springs Rd, 38.8km W Ackerman Creek, 39.2609, -123.54851, 246m, J Bond 14.iii.2005 [MY3038, 1♀, AUMNH]; Napa Co.: Berryessa Knoxville Rd, 38.7235, -122.26561, 195m, A Stockman 16.v.2005 [MY3138, 1♀, AUMNH]; Shasta Co.: Rock Creek Rd, crossing Rock Creek, E Manton, 40.4591, -121.78281, 970m, M Hedin, J Starrett, D Leavitt 19.xii.2007 [MY3629, 1♀, AUMNH]; hwy 44, intersection hwy and Bear Creek, 32.2km E Redding, 6.4km E Millville, 40.5333, -122.12025, 252m, W Icenogle 7.xi.1972 [AP518, 1♀, AMNH]; Platina Rd, 4.7km NE Hwy 36, 40.3656, -122.8581, 724m, A Stockman 22.v.2005 [MY3173, 1juv, AUMNH]; Lower Springs Rd, 0.8km S Hwy 299, 40.5807, -122.45011, 225m, A Stockman 23.v.2005 [MY3175, 1♀, FMNH], [MY3176, 1juv, AUMNH]; Sutter Co.: Sutter Buttes, Moore Canyon, 39.2085, -121.79933, 61m, W Icenogle 19.vii.1974 [AP285, 1♀, CAS]; Sutter Buttes, Dean Place, 39.223, -121.78121, 259m, M. Hedin, P Paquin, J Starrett 4.iv.2003 [MY729, 1♀, AUMNH]; Sutter Buttes, Hough Canyon, Pete & Margit Sand Ranch, NW Mallot Rd, 39.2236, -121.78921, 239m, A Stockman 13.vi.2005 [MY3336, 3382, 1♀, 1juv, AUMNH]; Tehama Co.: Hwy32, S Deer Creek, 5.3km SW Potato Patch CG, 40.1599, -121.57041, 1100m, M Hedin, J Starrett, D Leavitt 19.xii.2007 [MY3622, 1♀, AUMNH]; Cottonwood, 40.3159, -122.34761, 183m, C Will 27.ix.2009 [MY3802, MY3804, 1♂, 1♀, AUMNH], 15.x.2009 [MY3803, MY3805, 1♀, 1♂, AUMNH].

GenBank accessions.

16S-tRNAval-12S: JX103422-JX103440.

Distribution and natural history.

Distributed widely throughout north-central California with populations known from Mendocino, Napa, Shasta, Sutter, and Tehama Counties (Map 18). Aptostichus barackobamai has been collected in the Mayacamas Mountains in the west, Sutter Butte in the Central Valley, and the ridges to the north ringing the northernmost extension of the Central Valley. The DM (Map 19) indicates that the species is likely to be more widely distributed throughout the region and should occur further to the south along the Central Valley eastern ranges. The primary habitat type is mixed redwood and coniferous forest. Males have been collected in August, September, and December.

Maps 18, 19.

Aptostichus barackobamai sp. n. 18 distribution of known specimens 19 predicted distribution; cooler colors–blue shades–represent areas of high probability of occurrence, warmer colors–yellow and orange shades–represent areas of low probability of occurrence.

Conservation status.

The conservation status of this species is likely to be secure due to its abundance and widespread distribution; however, may be locally vulnerable (e.g., Sutter Butte locality).

Species concept applied.



Originally thought to be rare, only a few specimens were originally known from the Hopland Field Station locality, collecting efforts in recent years have recovered considerably more specimens and have significantly extended the known distribution of the species.

The Hesperus species group

Included species.

Aptostichus hesperus Chamberlin, 1919

Aptostichus hedinorum Bond sp. n.

Aptostichus cahuilla Bond sp. n.

Aptostichus killerdana Bond sp. n.

Aptostichus serrano Bond sp. n.

Aptostichus aguacaliente Bond sp. n.

Aptostichus chemehuevi Bond sp. n.

Aptostichus sarlacc Bond sp. n.

Aptostichus derhamgiulianii Bond sp. n.

Aptostichus mikeradtkei Bond sp. n.

Aptostichus edwardabbeyi Bond sp. n.

Aptostichus anzaborrego Bond sp. n.

Aptostichus sinnombre Bond sp. n.

Aptostichus hesperus Chamberlin, 1919

‘The Riverside Trapdoor Spider’



Figures 188–196, Maps 20, 21
Nemesoides hespera Chamberlin, 1919: 2. Male holotype (379), California, Los Angeles County, Claremont, 34.0968, -117.71955, coll. W. Hilton, in MCZ, examined.
Aptostichus hesperusBond and Opell 2002: 518.

Female (Figs 188–191) and male (Figs 192–196) Aptostichus hesperus can be distinguished from all other Aptostichus species by having posterior sternal sigilla that are positioned mid - ventrally and are either very closely positioned, or contiguous (Fig. 188). The sigilla of other Aptostichus species are distinctly separated and tend to be positioned more posteriorly. A longer palpal bulb length and greater PTw/PTl ratio (Figs 195, 196) also help to distinguish this species from