Research Article |
Corresponding author: Li Gong ( gongli1027@163.com ) Academic editor: Jiri Frank
© 2019 Liqin Liu, Yao Zhang, Xiaoyu Hu, Zhenming Lü, Bingjian Liu, Li Hua Jiang, Li Gong.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Liu L, Zhang Y, Hu X, Lü Z, Liu B, Jiang LH, Gong L (2019) Multiple paternity assessed in the cuttlefish Sepiella japonica (Mollusca, Cephalopoda) using microsatellite markers. ZooKeys 880: 33-42. https://doi.org/10.3897/zookeys.880.33569
|
Multiple paternity was demonstrated for seven clutches of eggs and 40 offspring sampled from these clutches in the cuttlefish Sepiella japonica from Fujian Shacheng Harbor Cultivation Base (Fujian Province, China), using four microsatellite DNA markers. It was observed that female cuttlefish copulated with different males. In this study, genotyping data suggest that at least three paternal allele genotypes were present in all seven clutches indicating that at least two males were responsible for each brood. Combined with behavioral observations, this study provides evidence for sperm competition and multiple paternity in S. japonica.
genetic diversity, mating, polyandry, reproductive strategy, sperm competition
The cuttlefish Sepiella japonica Sasaki, 1929 (Mollusca, Cephalopoda) is a commercially important marine species in China. Production from wild stocks reached 60,000 tons in Zhejiang Province and accounted for more than 9.3% of provincial fishing catches in 1957 (
An important factor that affects the genetic diversity of a population is the effective population size (Ne) which in turn is greatly influenced by the mating system of a species (
In recent years, multiple paternity in several marine species has been documented using different genetic markers including allozymes, DNA fingerprinting, RAPDs, and microsatellites. Microsatellites are the preferred marker because they are widely distributed in the genomes of most organisms and are highly polymorphic (
Sexually mature adult S. japonica were obtained from the Fujian Shacheng Harbor Cultivation Base (Fujian Province, China). A sample of 200 wild adults was captured using traps and kept mixed into a cage (9 m3). Seawater parameters were continuously maintained at 25–27 °C and 23‰ salinity. From this sample, seven mating pairs were randomly chosen as breeders to produce the next generation. All behavioral interactions were recorded using closed-circuit television with infrared to observe individual animals. Each mating pair was gently captured and placed in a spawning tank until oviposition. Egg strings derived from each clutch were transferred to a hatchery tank. After hatching, 280 offspring were randomly collected for population genotyping, maintained in a tank until they reached a pre-determined age. The muscles from the mantle cavity of parents and offspring were taken and placed in 95% ethanol and stored at –20 °C until DNA extraction. Seven clutches (called A–G) were analyzed.
Total genomic DNA was isolated from each offspring and from the muscular tissue of the respective parents using the standard method of phenol-chloroform (
The amplifications were carried out in a 2720 thermal cycler (ABI, USA) and in a 10 uL reaction volume: 2–10 ng DNA (0.5 µL), 0.5 µL of each forward and reverse primers, 5 µL 2×Es Taq MasterMix and 3.5 µL of double distilled water. The Polymerase Chain Reaction (PCR) conditions were initial denaturation for 5 min at 94 °C, followed by 30 cycles of denaturation for 40 s at 94 °C, annealing for 40 s at a primer-specific annealing temperature, extension for 40 s at 72 °C. PCR products were detected using capillary electrophoresis (BIOptic’s Qsep100 dna-CE, Taiwan) and allele size was estimated using Q-Analyzer software.
Parents and their offspring were genotyped by determining alleles at three of the four microsatellite loci. We considered evidence from at least two loci to be necessary for estimation of multiple paternity, because evidence from one locus may have been caused by mutations or genotyping error (
Mating behavior in S. japonica involves courtship of a female by a male, and females may copulate with multiple males. Mating pairs mated in the head-to-head position during which males transfer spermatophores to the buccal membrane of the females or to an internal seminal receptacle (Fig.
Locus | Repeat motif | Primer Sequences(5’-3’) | Ta(°C) | GenBank Accession |
CL168 | (AAC)6 | F:ACAATCAACGGCTGTAAAGTCA | 55 | KU306816 |
R:GACTATGGTTTGGATTTGGCAT | ||||
CL3354 | (CTG)5…(TGC)5 | F:CCTCGGCTTCTGATGAAAAT | 55 | KU306828 |
R:AGCCTTACTTCTGCAACATG | ||||
CL904 | (AT)8 | F:TCTAGGCCTGTGGTTAATGT | 55 | KU306823 |
R:TGATCGTTACTTGATGGCAG | ||||
CL327 | (TA)6 | F: ACAGCATCTTCTGGTAAGCCAT | 58 | KX839255 |
R: TAGTCCTGTCACCACAGTTATGC |
Three of the four microsatellite markers were chosen to test paternity in seven offspring clutches. These loci exhibited three or more alleles and were polymorphic in each individual. We chose the locus which followed Mendelian inheritance to analyze paternity. Two hundred and eighty-seven individuals were genotyped at three loci, seven adult females and 280 offspring. The analysis was highly reproducible. We analyzed paternity including sampled males and non-sampled males that had copulated with females prior to capture. The exclusionary power of paternity assignments varied between 0.951 and 0.981. Maternal and offspring genotypes for each clutch are given in Table
Genotypes of maternal cuttlefish, offspring and estimated paternal cuttlefish of Sepiella japonica.
Maternal Genotype | Offspring Genotype | Estimated Paternal Genotype | |||||||||
Clutch Code | Locus | Genotype | I | II | III | IV | V | 1 | 2 | 3 | 4 |
A | CL168 | 155/170 | 155/160(21) | 155/165(10) | 175/170(9) | 160/165 | 175/160 | ||||
CL3354 | 240/260 | 240/250(3) | 260/270(18) | 240/230(19) | 250/270 | 230/270 | |||||
CL327 | 140/170 | 130/170(2) | 140/160(15) | 140/170(17) | 160/170(6) | 130/170 | 160/140 | ||||
B | CL168 | 175/185 | 175/180(12) | 180/185(13) | 185/200(5) | 160/185(10) | 180/180 | 180/200 | 160/200 | ||
CL3354 | 230/250 | 230/240(21) | 235/250(9) | 230/235(9) | 230/250(1) | 230/230(1) | 240/230 | 235/235 | 240/235 | ||
CL327 | 160/160 | 145/160(16) | 155/160(13) | 150/160(11) | 145/155 | 145/150 | 155/150 | ||||
C | CL168 | 150/160 | 140/150(14) | 150/155(10) | 140/160(12) | 136/150(4) | 140/140 | 140/136 | 150/136 | ||
CL3354 | 200/230 | 195/230(16) | 195/200(6) | 200/225(11) | 210/230(3) | 225/230(4) | 200/195 | 230/195 | 195/225 | ||
CL327 | 140/154 | 136/140(13) | 140/150(6) | 136/154(13) | 140/140(3) | 150/154(5) | 136/136 | 150/140 | 136/150 | ||
D | CL168 | 160/180 | 175/180(13) | 160/175(15) | 165/180(5) | 160/165(6) | 160/160(1) | 175/165 | 175/160 | 175/165 | |
CL3354 | 220/240 | 220/235(14) | 230/240(7) | 255/240(2) | 220/225(8) | 220/245(9) | 235/255 | 235/245 | 230/225 | ||
CL327 | 150/180 | 145/150(14) | 160/180(6) | 145/180(15) | 150/160(1) | 180/180(4) | 145/160 | 145/160 | 160/180 | ||
E | CL3354 | 260/270 | 250/260(29) | 260/263(10) | 260/265(1) | 250/263 | 250/265 | ||||
CL904 | 210/230 | 205/230(2) | 200/210(4) | 200/230(26) | 205/210(4) | 210/220(4) | 200/220 | 205/200 | |||
CL327 | 140/160 | 135/140(24) | 140/145(8) | 135/160(4) | 140/150(4) | 135/135 | 145/150 | ||||
F | CL168 | 150/160 | 140/150(15) | 140/160(8) | 145/150(9) | 150/180(7) | 160/180(1) | 140/180 | 145/145 | 140/145 | |
CL3354 | 240/250 | 240/250(26) | 240/240(1) | 240/250(1) | 250/260(10) | 240/260(2) | 250/260 | 240/250 | 240/260 | ||
CL904 | 220/230 | 220/230(9) | 215/230(15) | 210/230(9) | 230/230(7) | 215/210 | 230/215 | 230/210 | |||
G | CL168 | 160/150 | 160/170(5) | 140/160(20) | 160/160(2) | 150/160(4) | 130/160(9) | 170/160 | 170/150 | 150/130 | 130/140 |
CL3354 | 220/250 | 240/250(16) | 225/250(1) | 220/240(12) | 220/225(10) | 220/250(1) | 240/220 | 240/225 | 225/220 | 250/240 | |
CL904 | 260/280 | 250/280(7) | 250/260(14) | 260/270(15) | 240/260(1) | 260/280(2) | 250/270 | 240/250 | 240/270 | 280/270 |
Almost all females were heterozygous at these loci (CL168, CL327, CL3354, CL904), except for CL327 (160/160) in the clutch B female. For clutches A and E, three different alleles which the father contributed were observed at the three chosen loci, suggesting that these two clutches had been sired by at least two males. The offspring of four females (B, C, D, and F) had three or four paternal alleles in each locus, and three paternal genotypes were observed in all loci. The number of paternal genotypes at these three loci indicated that females B, C, D, and F had mated with three different males. Within clutch G, five different alleles were detected at loci CL168 and CL3354, two of which were from maternal alleles. Clutch G showed four alleles for the locus CL904 in addition to the two alleles detected in the female. Four different paternal genotypes were estimated in clutch G, suggesting the female G was fertilized by at least four different males.
We observed female S. japonica mating with different males during the reproductive period, a behavior also recorded in other species of cephalopods (
Microsatellite markers are particularly useful in paternity studies because of their polymorphism, codominance, and repeatability. Cephalopod biologists have determined multiple paternity in many species, including squid (
Despite the prevalence of multiple paternity in cephalopod species, these studies show widely differing incidences of multiple paternity. In our study, multiple paternity was demonstrated in all sampled clutches (100%). In Sepia apama, one-third of the females mated with multiple males and 67% of females’ eggs had multiple sires (
This work was financially supported by the Chinese National Natural Science Foundation (41406138), Natural Science Foundation of Zhejiang Province (LY130190001).