Research Article |
|
Corresponding author: Sho Tsukamoto ( esutukamoto153@gmail.com ) Academic editor: Marzio Zapparoli
© 2019 Sho Tsukamoto, Satoshi Shimano, Takashi Murakami, Shimpei F. Hiruta, Takeshi Yamasaki, Katsuyuki Eguchi.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Tsukamoto S, Shimano S, Murakami T, Hiruta SF, Yamasaki T, Eguchi K (2019) A new species of the genus Arrup from a limestone cave in Akiyoshi-dai, Western Japan (Chilopoda, Geophilomorpha, Mecistocephalidae). ZooKeys 830: 33-51. https://doi.org/10.3897/zookeys.830.33060
|
Arrup akiyoshiensis Tsukamoto & Shimano, sp. n. is described from a limestone cave, Kagekiyo-ana, in Akiyoshi-dai, one of the largest karst regions in Japan, Yamaguchi prefecture. It is distinguishable from 14 valid named congeners by some unique characteristics including entire areolation on the cephalic pleurite, elongation of distal part of female gonopod, and a tubercle on forcipular segment II. In addition, the 18S rRNA gene sequences of A. akiyoshiensis Tsukamoto & Shimano, sp. n. and A. ishiianus, one of the most morphologically similar species, differed by four bp out of 1821 bp. The fact that only troglobionts and troglophilic species are found in the collection site suggests that this new species might be a cave-dweller.
Arrupinae, Chilopoda, Kagekiyo-ana, limestone, taxonomy, 18S rRNA gene
Centipedes are for the most part soil-dwellers, and common in various habitats such as forests, grasslands, coastal areas and so on (
Akiyoshi-dai, where is a one of the largest karst regions in Japan, has a spread of 16 km in northeast direction and 6 km northwest direction, with more than 400 limestone caves (
Two adult female specimens and four juvenile specimens of A. akiyoshiensis sp. n. were collected by hand under rocks inside Kagekiyo-ana cave (a limestone cave; 34°17.50'N, 131°20.00'E), in Akiyoshi-dai (a karst region), Mitou-cho, Mine-shi, Yamaguchi Prefecture, Japan. The exact position of the collection site is shown in Fig.
Specimens were observed and drawn in lactic acid on temporary cavity slides using a Nikon Eclipse E600 microscope, and were then mounted with Hoyer’s medium (gum arabic, chloral hydrate and glycerol). Some characters were photographed by using Panasonic LUMIX DMC-GX8 and Canon EOS Kiss X9, and focus stack images were produced from a series of pictures at different focal planes by Helicon Focus Pro version 6.6.1 on a desktop PC. Note that the external shape might be slightly distorted when immersed in lactic acid because of expansion of internal tissue. Besides, specimens were measured with their each part mounted with Hoyer’s medium in order to avoid distortion of the external shape. The morphological terminology used below is mainly based on
Genomic DNA was extracted from part of the appendage using a DNeasy Blood & Tissue Kit (Qiagen), with modifications from
Table
| Gene | Name | Sequence (5'–3') | Direction | Source | Used for PCR |
|---|---|---|---|---|---|
| 18S rRNA | 18S-F1 | TACCTGGTTGATCCTGCCAG | forward |
|
* |
| 18S-F2 | CCTGAGAAACGGCTRCCACAT | forward |
|
||
| 18S-F3 | GYGRTCAGATACCRCCSTAGTT | forward |
|
||
| 18S-F4 | GGTCTGTGATGCCCTYAGATGT | forward |
|
||
| 18S-R6 | TYTCTCRKGCTBCCTCTCC | reverse |
|
||
| 18S-R7 | GYYARAACTAGGGCGGTATCTG | reverse |
|
||
| 18S-R8 | ACATCTRAGGGCATCACAGACC | reverse |
|
||
| 18S-R9 | GATCCTTCCGCAGGTTCACCTAC | reverse |
|
* |
Amplification products were purified with the ExoSAP-IT kit (Thermo Fisher Scientific). All nucleotide sequences were determined by direct sequencing using a BigDye Terminator Cycle Sequencing Kit ver. 3.1 with an ABI 3500XL automated sequencer (Thermo Fisher Scientific). The amplification primers and internal primers were used in sequencing 18S rRNA gene. Nucleotide sequences were assembled and edited with MEGA7 (
| Species | Collection site | Specimen identification no. | Accession no. |
|---|---|---|---|
| Arrup akiyoshiensis | Kagekiyo-ana, Yamaguchi | TS-20180330-01 (holotype) | LC460298 |
| Arrup akiyoshiensis | Kagekiyo-ana, Yamaguchi | TS-20180418-01 (paratype) | LC460299 |
| Arrup akiyoshiensis | Kagekiyo-ana, Yamaguchi | TS-20180418-02 | LC460300 |
| Arrup ishiianus | Imperial Palace, Tokyo | TS-20090729-01 | LC460301 |
Holotype 1 female, Kagekiyo-ana, Mitou Town (Mitou-cho), Mine City (Mine-shi), Yamaguchi Prefecture, Japan, 30th of March 2018, coll. Takashi Murakami (labeled as TS-20180330-01). Paratype 1 female, Kagekiyo-ana, Mitou Town (Mitou-cho), Mine City (Mine-shi), Yamaguchi Prefecture, Japan, 18th of April 2018, coll. Takashi Murakami (labeled as TS-20180418-01).
The species name is derived from the name of Akiyoshi-dai Karst region, which includes the type locality.
Arrup akiyoshiensis sp. n. can be distinguished from the all named congeners by a combination of the following morphological characteristics: frontal line curved; seven pectinate lamellae in mandible; comma-shaped distal lobe of coxal projection in first maxillae; a tiny tubercle on outer-distal corner of each article of the telopodite; distal article of the telopodite of the second maxillae without claw; the well-developed tooth of forcipular article I; the triangular basal tooth in tarsungulum; the poison calyx overreaching forcipular article I; 31–35 pores on lateral and ventral sides on coxopleura.
Measurements of the holotype (adult female, TS-20180330-01) are followed by those of 1 paratype (adult female, TS-20180418-01) in parentheses. Body length 36.0 (34.5) mm, maximum body width 1.0 (0.95) mm, cephalic plate length 1.45 (1.30) mm, maximum cephalic plate width 0.92 (0.78) mm.
Antenna (Figs
Arrup akiyoshiensis sp. n., holotype (TS-20180330-01), A right antennal article, I–VI, dorsal B right antennal article, I–VI, ventral C right antennal article, VII–XIII, dorsal D right antennal article, VII–XIII, ventral E a pointed sensillum on the dorsal side of article XIII. Setae are not drawn, only their sockets. Scale bars: 500 µm (A–D); 10 µm (E).
Arrup akiyoshiensis sp. n., holotype (TS-20180330-01), A right antennal article, XIV, dorsal B right antennal article, XIV, ventral C right antennal article, XIV, outer-lateral D right antennal article, XIV, inner-lateral E a claviform sensillum on the antennal article XIV (triangle in fig. 9) F a pointed sensillum on the antennal article XIV (arrow in fig. 9). Setae are indicated only with sockets. Scale bars: 100 µm (A–D); 25 µm (E); 12.5 µm (F).
Number of right antennal setae of Arrup akiyoshiensis sp. n., holotype (TS-20180330-01).
| Antennal article | I | II | III | IV | V | VI | VII | VIII | IX | X | XI | XII | XIII | XIV |
| Number of Setae | 45 | 53 | 57 | 73 | 98 | 102 | 140 | 155 | 207 | 201 | 215 | 207 | 194 | 343 |
Number of claviform sensilla on antennal article XIV of Arrup akiyoshiensis sp. n., holotype (TS-20180330-01), paratype (TS-20180418-01).
| Side of antenna | Right | Left | ||
| Inner-lateral | Outer-lateral | Inner-lateral | Outer-lateral | |
| Holotype (TS-20180330-01) | 43 | 58 | 36 | 60 |
| Paratype (TS-20180418-01) | 38 | 61 | n/a | n/a |
Number of antennal pointed sensilla of Arrup akiyoshiensis sp. n., holotype (TS-20180330-01).
| Antennal article | I | II | III | IV | V | VI | VII | VIII | IX | X | XI | XII | XIII | XIV |
| Right, dorsal | 0 | 3 | 0 | 0 | 8 | 0 | 0 | 0 | 4 | 0 | 0 | 0 | 3 | 6 |
| Right, ventral | 0 | 2 | 0 | 0 | 5 | 0 | 0 | 0 | 4 | 0 | 0 | 0 | 3 | |
| Left, dorsal | 0 | 1 | 0 | 0 | 7 | 0 | 0 | 0 | 7 | 0 | 0 | 0 | 3 | 9 |
| Left, ventral | 0 | 2 | 0 | 0 | 5 | 0 | 0 | 0 | 5 | 0 | 0 | 0 | 3 |
Cephalic plate (Figs
Arrup akiyoshiensis sp. n., holotype (TS-20180330-01), A cephalic plate, dorsal B clypeus and clypeal pleurite, ventral C labrum, ventral D right mandible, dorsal E maxillae complex, ventral. Note that A–C are distorted by the effects of lactic acid. Scale bars: 500 µm (A, B); 100 µm (C, D); 250 µm (E).
Clypeus (Figs
Labrum (Fig.
Cephalic pleurite (Figs
Mandible (Fig.
Number of the pectinate lamellae of Arrup akiyoshiensis sp. n., holoype (TS-20180330-01) and paratype (TS-20180418-01).
| Pectinate lamellae | Right | Left | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| I | II | III | IV | V | VI | VII | I | II | III | IV | V | VI | VII | |
| Holotype (TS-20180330-1) | 6 | 11 | 11 | 11 | 8 | 5 | 2 | 6 | 11 | 11 | 11 | 8 | 5 | 2 |
| Paratype (TS-20180418-1) | 6 | 11 | 15 | 12 | 8 | 4 | 2 | 6 | 11 | 13 | 9 | 3 | 4 | –* |
First maxillae (Figs
Second maxillae (Figs
Forcipular segment (Figs
Arrup akiyoshiensis sp. n., A, B paratype (TS-20180418-01) C, D holotype (TS-20180330-01) A forcipular segment and left forcipule, dorsal B forcipular segment and left forcipule, ventral C claw of left tarsungulum, dosral D claw of left tarsungulum, ventral. Scale bars: 500 µm (A, B); 200 µm (C, D).
Leg-bearing segments (excepting last leg-bearing segment) (Fig.
Arrup akiyoshiensis sp. n., holotype (TS-20180330-01), A four leg-bearing segments, dorsal B four leg-bearing segments, ventral C left leg (pair 4), ventral D claw of right leg (pair 4), lateral E last leg-bearing and postpedal segments, dorsal F last leg-bearing and postpedal segments, ventral G right telopodite of last leg-bearing segment, dorsal H right telopodite of last leg-bearing segment, ventral. Scale bars: 300 µm (A–C); 100 µm (D); 500 µm (E–H).
Last leg-bearing segment (Figs
Postpedal segment (Figs
Coloration (Fig.
Known from only the type locality.
Kagekiyo-ana, Mitou Town (Mitou-cho), Mine City (Mine-shi), Yamaguchi Prefecture, Japan (34°17.50'N, 131°20.00'E).
Arrup akiyoshiensis sp. n. is morphologically similar to several other congeners, especially A. holstii (Pocock, 1895) and A. ishiianus Uliana, Bonato & Minelli, 2007 (Fig.
Morphological comparison between A. akiyoshiensis sp. n. and other similar congeners based on
| Characteristics | A. akiyoshiensis sp. n. | A. holstii | A. ishiianus | A. obtusus | A. kyushuensis | A. longicalix |
|---|---|---|---|---|---|---|
| Body length | approx. 3.5 cm | approx. 2 cm | 4–5 cm | approx. 2 cm | 1.5–3 cm | approx. 2 cm |
| Shape of the distal lobe of medial projection | clavate at the top | clavate at the top | slightly clavate | –* | slightly clavate | very elongate |
| distal tooth of forcipular article I | well developed, pointed | sharp and short | well developed, rounded | well developed | large and subtriangular | pointed, medium sized |
| basal tooth of forcipular tarsungulum | triangular | sharp | rounded or slightly pointed | shallow and rounded | well developed | very shallow and obtuse |
| Sternite of ultimate leg-bearing segment | as long as wide | as long as wide | wider than long | wider than long | as long as wide | wider than long |
| Number of coxal pore | 31–35 | around 12 | around 35 | around 40 | –* | around 15 |
The two adult female specimens examined were morphologically almost identical (except for the body size), and were therefore concluded to be conspecific. Male characteristics are unknown at present.
Arrup akiyoshiensis sp. n. exhibits unique characteristics which are not observed in other valid named congeners, i.e., the entire areolation of the crypeal pleurite, elongation of distal part of female gonopod, and tiny tubercle on forcipular article II. It is most similar to A. holstii (Pocock, 1895) and A. ishiianus Uliana, Bonato & Minelli, 2007 (Fig.
Arrup akiyoshiensis sp. n. and A. holstii can be found in the same area, Akiyoshi-dai. However, it is unclear whether the both species occur in the same cave or not, because the cave where A. holstii was found is not clearly mentioned (
Arrup akiyoshiensis sp. n. has no troglomorphic traits such as exceptionally long antennae, legs, and claws (
We are grateful to Dr Manabu Hori (Yamaguchi University) for helpful support. We also thank Mr Tatsumi Suguro (Keio Yochisha Elementary School), Ms Mari Ishida (Akiyoshi-dai Museum of Natural History), Mr Keisuke Kawano (The Firefly Museum of Toyota Town), Dr Kiyoshi Ishii (Professer Emeritus, Dokkyo University), and Dr Makiko Hasegawa (Showa University) for much support and advice. A part of this study was supported by Nippon Life Insurance Foundation (Leader: Takeshi Yamasaki, FY2017–FY2018), Asahi Glass Foundation (Leader: Katsuyuki Eguchi; FY2017–FY2020) and JSPS KAKENHI Grant Numbers 15H02858 for Satoshi Shimano.