Print
The first stygobiont species of Coleoptera from Portugal, with a molecular phylogeny of the Siettitia group of genera (Dytiscidae, Hydroporinae, Hydroporini, Siettitiina)
expand article infoIgnacio Ribera, Ana Sofia P.S. Reboleira§
‡ Institute of Evolutionary Biology (CSIC-Universitat Pompeu Fabra, Barcelona, Spain
§ University of Copenhagen, København, Denmark
Open Access

Abstract

Iberoporus pluto sp. n., the first stygobiont beetle from Portugal (Dytiscidae, Hydroporinae), is described from a single female from the cave Soprador do Carvalho (Coimbra). The species is highly troglomorphic, depigmented, blind, and with elongated appendages not adapted for swimming. A molecular phylogeny based on a combination of three mitochondrial and two nuclear genes showed the new species to be sister to I. cermenius Castro & Delgado, 2001 from Córdoba (south of Spain), within the subtribe Siettitiina of the tribe Hydroporini. Both species are included in a clade with Siettitia avenionensis Guignot, 1925 (south of France) and Rhithrodytes agnus Foster, 1992 and R. argaensis Fery & Bilton, 1996 (north of Portugal), in turn sister to the rest of species of genus Rhithrodytes Bameul, 1989, in what is here considered the Siettitia group of genera. We resolve the paraphyly of Rhithrodytes by transferring the two Portuguese species to Iberoporus Castro & Delgado, 2001, I. agnus (Foster, 1992), comb. n. and I. argaensis (Fery & Bilton, 1996), comb. n.

Keywords

Diving beetles, groundwater, new species, stygofauna, troglomorphy

Introduction

The knowledge of the subterranean fauna from Portugal has significantly increased over the last decade, with the description of a high number of obligate subterranean species (tripling their number) and the establishment of new biogeographic patterns (Reboleira 2012). A high number of these species are stygobiont (i.e., confined to groundwater), mostly from wells in the north of the country, where evapotranspiration is higher (Reboleira et al. 2011, 2013). They include 62 species of crustaceans, mostly asellids, syncarids and amphipods, and one species of annelid (Reboleira et al. 2013).

In this work we describe the first stygobiont species of Coleoptera from Portugal, a diving beetle of the subtribe Siettitiina (Dytiscidae, Hydroporinae, Hydroporini; type genus: Siettitia Abeille de Perrin, 1904). Siettitiina includes the only known European genera of Dytiscidae which have stygobiont members: Siettitia, with two species in France, Iberoporus Castro & Delgado, 2001, with one species in south Spain, Etruscodytes Mazza et al., 2013, with one Italian species, and Graptodytes Seidlitz, 1887, with the Moroccan G. eremitus Ribera & Faille, 2010 among several epigean members (Ribera and Faille 2010, Nilsson and Hájek 2018a). The subtribe also includes some North American stygobiont species, with an uncertain phylogenetic position (Miller et al. 2013, Kanda et al. 2016, Miller and Bergsten 2016, Nilsson and Hájek 2018b). The new species is known from a single female found in a well-studied cave in central Portugal. Despite multiple visits to the same cave no additional specimens have been found, so we describe here the species on the basis of its morphological singularity and of the molecular data that places it unambiguously among the west Mediterranean species of Siettitiina.

Material and methods

Taxon sampling, DNA extraction and sequencing

For the phylogenetic placement of the new species we used the datasets of Ribera and Faille (2010) and Abellán et al. (2013), with the inclusion of additional sequences (mostly nuclear genes) and taxa (Table 1). Most notably is the inclusion of Siettitia avenionensis Guignot, 1925, the second oldest described stygobiont water beetle worldwide. Partial sequences of the genes COI and 18S were obtained from a larva preserved in 70% ethanol, collected in 1989 (Table 1). Other attempts to extract and sequence different larvae from the same locality collected in 1984 and 1992 (Ph. Richoux leg.) proved unsuccessful. Extractions of single specimens were non-destructive, using a standard phenol-chloroform method or the DNeasy Tissue Kit (Qiagen GmbH, Hilden, Germany). Vouchers and DNA samples are kept in the collections of the Museo Nacional de Ciencias Naturales, Madrid, Madrid (MNCN), the Institute of Evolutionary Biology, Barcelona (IBE) and the Natural History Museum of Denmark (NHMD).

Material used in the molecular phylogeny of the Siettitia group of genera, with locality, collector, and EMBL accession numbers. Newly obtained sequences are in bold typeface. Nomenclature follows Nilsson and Hájek (2018a).

N Species Voucher Locality, date, and collector COI-5’ COI-3’ 16S+ 18S H3
1 Graptodytes aequalis NHM-IR206 Morocco: Debdou, Meson forestiere; 6.4.1999, I Ribera, P Aguilera, C Hernando, A Millán LS999725 HM588264 AY250910 AJ850509 EF670184
2 G. atlantis MNCN-AI921 Morocco: Lac Afenourir, Azrou; 29.4.2000, I Ribera LS999726 HM588265 HM588602 LS999692 LS999771
3 G. bilineatus MNCN-AI608 Sweden: Västerbotten prov., Åmsele, Vindelälven; 18.9.2005, AN Nilsson LS999727 HM588267 HM588603 LS999693 LS999772
4 G. castilianus MNCN-AI1316 Spain: Navarra, Pitillas: pond in crossroad; 21.7.2004, I Ribera, A Cieslak HF947943 HM588268 HM588604 LS999694 LS999773
5 G. delectus MNCN-AI1092 Tenerife (Spain): Chamorga, Bco. Roque Bermejo; 20.7.2006, A Castro LS999728 HM588269 HM588605 LS999695 LS999774
6 G. eremitus IBE-AF33 Morocco: Tiqqi, cave Doussoulile; 28.7.2008, JM Bichain et al. LS999729 HM588271 HM588606 LS999696 LS999775
7 G. flavipes NHM-IR40 Spain: Huelva, Almonte, poblado forestal; 26.7.1998, I Ribera HM588273 AY250914 AJ318730 EF056561
8 G. fractus MNCN-AI627 Spain: Córdoba, Sa. de Córdoba, Arroyo de los Arenales; 16.4.2005, A Castro LS451100 HM588274 HM588608 LS453474 LS453168
9 G. granularis MNCN-AI609 Sweden: Västerbotten prov., Åmsele, Vindelälven; 18.9.2005, AN Nilsson LS999730 HM588278 HM588611 LS999697 LS999776
10 G. ignotus NHM-IR531 Spain: Girona, Estanys de Capmany, 3.2001, P Aguilera LS999731 HM588287 AY250915 AJ850510 EF670185
11 G. kuchtae MNCN-AI177 Mallorca (Spain): Ternelles, Torrent de Ternelles; 14.10.2004, I Ribera, A Cieslak LS999732 HM588288 HM588614 LS999698 LS999777
12 G. laeticulus MNCN-HI16 Algeria: Algeria, Aïn Damous; 24.8.2006, S Bouzid HM588300 HM588621 LS999699 LS999778
13 G. pictus MNCN-AI660 Poland: Zachodniopomorsky, Dygowo: pond; 16.8.2004, I Ribera, A Cieslak LS999733 HM588290 HM588615 LS999700 LS999779
14 G. pietrii MNCN-DM37 Tunisia: Rd. Beja-Teboursouk, NW Teboursouk; 23.10.2001, I Ribera, A Cieslak LS999734 HM588292 HM588616 LS999701 LS999780
15 G. sedilloti sedilloti NHM-IR585 Cyprus; 3.2001, K Miller LS451098 HM588294 HM588619 LS453473 LS453167
16 G. sedilloti phrygius MNCN-AI111 Chios (Greece): Marmaro marsh; 19.4.2004, GN Foster LS999735 HM588293 HM588618 LS999702 LS999781
17 G. siculus MNCN-AH162 Sicily (Italy): Parco dei Nebrodi, Stream Trail Lago Urio; 13.6.2007, P Abellán, F Picazo LS999736 HM588295 HM588620 LS999703 LS999782
18 G. varius MNCN-AH160 Sicily (Italy): Parco dei Nebrodi, Stream Trail Lago Urio; 13.6.2007, P Abellán, F Picazo LS999737 HM588297 HM588622 LS999704 LS999783
19 G. veterator veterator MNCN-AH161 Sicily (Italy): Parco dei Nebrodi, Stream Trail Lago Urio; 13.6.2007, P Abellán, F Picazo LS451095 HM588304 HM588625 LS453472 LS453105
20 G. veterator behningi MNCN-AI774 Turkey: Düzce, Rd. to Kartalkaya from Çaydurt; 23.4.2006, I Ribera LS999738 HM588303 HM588624 LS999705 LS999784
21 Iberoporus cermenius NHM-IR276 Spain: Cordoba, Priego de Cordoba; 29.4.2000, A Castro LS451107 AY250958 AY250918 AJ850511 EF670186
22 I. pluto sp. n. IBE-AN151 Portugal: Soprador do Carvalho; 24.10.2014, ASPS Reboleira LS999739 LS999756 LS999763 LS999706 LS999785
23 Metaporus meridionalis NHM-IR34 Spain: Albacete, Robledo, Ojos de Villaverde; 7.9.1997, I Ribera HM588307 AY250919 AJ318739 EF670187
24 Porhydrus genei IBE-RA86 Algeria: Garaet Aïn Nechma, nr Ben-Azzouz (Skikda); 29.6.2009, S Bouzid LS999740 HF931320 HF931543 LS999707 LS999786
25 P. lineatus NHM-IR24 England (UK): Sommerset Levels, Chilton Trinity; 4.7.1998, I Ribera LS999741 AY250973 AY250933 AJ318743 EF670188
26 P. obliquesignatus IBE-RA147 Italy: Piano Grande. Piano di Castelluccio; 20.7.2009, M Toledo LS999742 HF931305 LS999764 LS999708 LS999787
27 P. vicinus MNCN-AH113 Portugal: Cercal, ephemeral pond btw. Cercal and Vilanova; 24.1.2008, I Ribera LS999743 HF931132 HF931350 LS999709 LS999788
28 Rhithrodytes agnus MNCN-AI1007 Portugal: Viana do Castelo, N Ponte de Lima, W Labruja; 28.5.2006, H Fery LS999744 HF931143 HF931362 LS999710 LS999789
29 R. argaensis MNCN-AI179 Portugal: Serra de Arga, Pools on summit; 9.5.2005, DT Bilton HF948005 HF931183 HF931405 LS999711 LS999790
30 R. bimaculatus IBE-RA727 Spain: Huesca, Aragués del Puerto; 23.7.2011, I Esteban LS999745 LS999757 LS999765 LS999712 LS999791
31 R. crux MNCN-AI302 Italy: Alessandria, stream; 2.5 km S Praglia; 18.10.2002, I Ribera, A Cieslak LS451084 HF931187 HF931410 LS453475 LS453108
32 R. numidicus MNCN-DM34 Tunisia: Rd. Tabarka-Aïn-Draham, stream Aïn-Draham; 23.10.2001, I Ribera, A Cieslak LS999758 LS999766 LS999713 LS999792
33 R. sexguttatus NHM-IR183 Corsica (France): Porto-Vecchio: l’Ospedale; 18.9.1999, I Ribera, A Cieslak AY250975 AY250936 AJ850513 EF670190
34 Siettitia avenionensis MNCN-AI897 France: Barbentane; 22.2.1992, J Dalmon LS999759 LS999714
35 Stictonectes abellani IBE-PA312 Spain: Ciudad Real, PN Cabañeros; 7.7.2008, A Millán and col. LS451083 HF931298 HF931530 LS453469 LS453169
36 S. azruensis NHM-IR661 Morocco: Moyen Atlas, nr. Azrou, Col du Zad; 16.4.2001, Pellecchia, Pizzetti LS999746 AY250979 AY250940 LS999715 LS999793
37 S. canariensis IBE-AF114 Gran Canaria (Spain): Barranco Güigüi grande; 1.4.2008, J Hájek, K Kaliková LS999747 HF931113 HF931330 LS999716 LS999794
38 S. epipleuricus MNCN-AH73 Portugal: Serra de São Mamede, Portalegre: r. Caia; 25.7.1998, I Ribera LS999748 LS999760 LS999767 LS999717
39 S. escheri MNCN-AH107 Morocco: Asilah, rd. N1, stream ca.; 4 km S Asilah; 27.3.2008, I Ribera, P Aguilera, C Hernando LS999749 HF931130 HF931349 LS999718 LS999795
40 S. formosus MNCN-AH108 Morocco: Asilah, rd. N1, stream ca.; 4 km S Asilah; 27.3.2008, I Ribera, P Aguilera, C Hernando LS999750 HF931131 LS999768 LS999719 LS999796
41 S. lepidus MNCN-AI632 Spain: Córdoba, Sierra Morena, cta. Villaviciosa; 16.4.2005, A Castro LS999751 LS999761 LS999769 LS999720 LS999797
42 S. occidentalis NHM-IR529 Portugal: Algarve; 2001, P Aguilera AY250980 AY250942 LS999798
43 S. optatus MNCN-AI1089 Spain: Jaén, Sierra de Cazorla, cta. Del Tranco; 3.8.2006, A Castro LS999752 LS999762 LS999770 LS999721 LS999799
44 S. optatus NHM-MsC Corsica (France): Porto-Vecchio: l’Ospedale; 18.9.1999, I Ribera, A Cieslak AY250981 AY250943 AJ850514 EF670192
45 S. rebeccae MNCN-AH72 Portugal: Serra Estrela, Sabugueiro, r. above village; 12.5.2005, I Ribera LS999753 FR851207 FR851208 LS999722 LS999800
46 S. rufulus MNCN-AI1299 Sardinia (Italy): Road from Óschiri to Mount Limbara; 17.10.2006, GN Foster LS999754 HF931179 HF931400 LS999723 LS999801
47 S. samai IBE-AF142 Algeria: Oued Bagrat; 24.3.2006, S Bouzid LS999755 HF931119 HF931336 LS999724 LS999802

Examples of most species of Palaearctic Siettitiina were included, including all stygobiont or interstitial species with the exception of Graptodytes aurasius Jeannel, 1907 (Algeria), Siettitia balsetensis Abeille de Perrin, 1904 (France) and Etruscodytes nethuns Mazza et al., 2013 (Italy). Trees were rooted in the split between Graptodytes+Metaporus Guignot, 1945 and the rest of Siettitiina, based on previous phylogenetic results (Ribera et al. 2008, Abellán et al. 2013).

Fragments of five genes in five sequencing reactions were sequenced, three mitochondrial (1) 5’ end of cytochrome c oxidase subunit 1 (COI-5, “barcode” fragment of Hebert et al. 2003); (2) 3’ end of cytochrome c oxidase subunit 1 (COI-3); (3) 5’ end of 16S RNA plus the Leucine tRNA plus 5’ end of NADH dehydrogenase subunit I (16S); and two nuclear fragments (4) an internal fragment of the small ribosomal unit, 18S RNA (18S) and (5) an internal fragment of Histone 3 (H3). Details on primers used are provided in Table 2. Sequences were assembled and edited with Geneious v6.0.6 (Kearse et al. 2012); new sequences (111) have been submitted to the EMBL database with accession numbers LS999692-LS999802 (Table 1).

Primers used in the amplifying and sequencing reactions.

Gene Primer Sequence Reference
COI-3’ Jerry (5’) CAACATTTATTTTGATTTTTTGG Simon et al. (1994)
Pat (3’) TCCAATGCACTAATCTGCCATATTA
Chy (5’) T(A/T)GTAGCCCA(T/C)TTTCATTA(T/C)GT Ribera et al. (2010)
Tom (3’) AC(A/G)TAATGAAA(A/G)TGGGCTAC(T/A)A
COI-5’ Uni LepF1b TAATACGACTCACTATAGGGATTCAACCAATCATAAAGATATTGGAAC Hebert et al. (2004)
Uni LepR1 ATTAACCCTCACTAAAGTAAACTTCTGGATGTCCAAAAAATCA
16S+trnL+nad1 16SaR (5’) CGCCTGTTTAACAAAAACAT Simon et al. (1994)
ND1 (3’) GGTCCCTTACGAATTTGAATATATCCT
16Sb CCGGTCTGAACTCAGATCATGT
18S 18S 5’ GACAACCTGGTTGATCCTGCCAGT(1) Shull et al. (2001)
18S b5.0 TAACCGCAACAACTTTAAT(1)
H3 H3aF (5’) ATGGCTCGTACCAAGCAGACRCG Colgan et al. (1998)
H3aR (3’) ATATCCTTRGGCATRATRGTGAC

Phylogenetic analyses

Edited sequences were aligned using the online version of MAFFT 7 with the G-INS-I algorithm (Katoh and Toh 2008).

BEAST 1.8 (Drummond and Rambaut 2007) was used for Bayesian phylogenetic analyses, using a molecular-clock approach for estimating divergence times. We applied a partition by genes with uncorrelated lognormal relaxed clocks to estimate substitution rates and a Yule speciation process as the tree prior, using GTR+I+G and HKY+I+G evolutionary models. We calibrated the tree using rates estimated in Andújar et al. (2012) for a genus of Carabidae (Carabus Linnaeus, 1758), in the same suborder Adephaga (rate of 0.0113 [95% confidence interval 0.0081 – 0.0147] substitutions per site per million years (subst/s/Ma) for COI-5; 0.0145 [0.01 – 0.0198] subst/s/Ma for COI-3 and 0.0016 [0.001 – 0.0022] subst/s/Ma for 16S+tRNA). Analyses were run for 100 million generations, assessing that convergence was correct and estimating the burn-in fraction with Tracer v1.6 (Drummond and Rambaut 2007). We also used a fast Maximum Likelihood (ML) heuristic algorithm in RAxML-HPC2 (Stamatakis 2006) in the CIPRES Science Gateway (Miller et al. 2010), using the same partition scheme as in BEAST with a GTR+G evolutionary model independently estimated for each partition and assessing node support with 100 pseudoreplicates with a rapid bootstrapping algorithm (Stamatakis et al. 2008).

Results

The two BEAST analyses (GTR and HKY evolutionary models) resulted in identical topologies and very similar branch lengths, although convergence for GTR evolutionary models was poor for some genes (nad1, 18S), so we present here only the results of the HKY models (Fig. 1). The topology was also almost identical to that obtained with RAxML (Fig. 1).

Figure 1. 

Phylogeny of the Siettitia group of genera, obtained with Bayesian methods. Numbers in nodes, Bayesian posterior probabilities/maximum likelihood bootstrap support (obtained in RAxML); c.n., constrained node in the Bayesian analysis. See Table 1 for details on the specimens.

We obtained a well-supported, well-resolved phylogeny of Siettitiina (Fig. 1). In agreement with previous results we recovered three clades, Graptodytes+Metaporus, Stictonectes Brinck, 1943 + Porhydrus Guignot, 1945, and the Siettitia group of genera as here defined, including Siettitia, Rhithrodytes, and Iberoporus (plus most likely Etruscodytes, see Discussion). The new species was placed as sister to Iberoporus cermenius Castro & Delgado, 2001 with strong bootstrap support (BS = 73%), although in the Bayesian analyses the support was lower (posterior probability, pp = 0.73). Both species were in turn sister to Rhithrodytes argaensis Bilton & Fery, 1996 plus R. agnus Foster, 1992 in a very well supported clade (BS = 94; pp = 0.97), and then to Siettitia (Fig. 1). All other sampled species of Rhithrodytes were placed as sister to this clade, rendering the genus paraphyletic. In order to preserve the monophyly of Rhithrodytes we thus transfer the two species to the genus Iberoporus, Iberoporus agnus (Foster, 1992) comb. n. and Iberoporus argaensis (Bilton & Fery, 1996), comb. n.

According to our calibration, the separation between the new species and Iberoporus cermenius was dated at ca. 10 Ma (95% HPD 13.4-6.9 Ma), with a similar age for the split from I. agnus + I. argaensis (11.4 Ma [15.0-8.3]), during the Tortonian (Fig. 1).

Taxonomy

Iberoporus pluto sp. n.

Figures 2, 3, 4, 6

Type locality

Portugal, Penela, Gruta Soprador do Carvalho (39°59'N, 8°23'W) (Fig. 6).

Type material

Holotype female (NHMD) Portugal, Penela, Gruta Soprador do Carvalho, ASPS Reboleira leg., 24.X.2014, with red holotype label and DNA voucher label “IBE-AN151”.

Diagnosis

A blind and depigmented species of Iberoporus, larger and wider than the other subterranean species of the genus, with a cordiform pronotum without lateral stria, less prominent constriction between pronotum and elytra and with a more transverse pronotum. Appendages longer and more slender, especially antennae and pro- and mesotibiae. Male unknown.

Description

Body length 2.8 mm, maximum width 1.1 mm. Habitus: Body elongate, strongly parallel-sided (including pronotum and head) (Fig. 2), flattened in lateral view (Fig. 3a); in dorsal view lateral outline with a slight discontinuity between posterior angles of pronotum and base of elytra. Body and appendages uniformly pale orange (cuticle appears translucent after DNA extraction due to digestion of soft tissue).

Figure 2. 

Habitus of Iberoporus pluto sp. n., dorsal view (holotype, after DNA extraction). Scale bar: 1 mm.

Figure 3. 

Iberoporus pluto sp. n., holotype. a Lateral view (scale bar, 1 mm) b Detail of the sensory setae of pronotum and elytra (both previous to DNA extraction).

Head (Fig. 2): Wide, anterior margin almost perfectly semicircular, deeply encased in pronotum, with two lateral dark scars in place of eyes; surface smooth, with very sparse small shallow punctures, surface weakly micro-reticulated, stronger on margins, glabrous. Antennae with ovoid pedicel, distal antennomeres conical, more elongate.

Pronotum (Figs 2, 3): Cordiform, margins sinuated, anterior part slightly wider than head, posterior part narrower than head and base of elytra; anterior margin more or less straight (except angles), angles strongly acute; posterior margin sinuated, angles acute; sides without rim, anterior margin with transverse depression with irregular row of large punctures; posterior margin with some sparse large punctures very loosely forming a row. Pronotum without sublateral stria on each side, with only a slight depression and very irregular row of larger punctures. Surface smooth, with fine shallow punctures denser on disk, with very fine microreticulation, stronger near margins, cells not contiguous; centre of disc with small longitudinal rectangular mark. Pronotum with long lateral sensorial setae (Fig. 3b).

Elytra (Figs 2, 3): almost parallel-sided on basal 2/3, apical third regularly acuminate. Sides of elytra with weak rim, not visible from above. In lateral view margin of elytra almost straight, only very weakly ascending to humeral angle in anterior quarter; epipleuron not visible until shoulders. Surface with same structure as on pronotum, with very sparse larger punctures; larger punctures forming very loose and irregular lines on elytra; more distinct near to suture and on disk. With long sensorial setae on margins (Fig. 3b). Without traces of hind wings.

Ventral surface (Fig. 4): Uniformly pale, colour similar to dorsal surface. Prosternal process lanceolate, apex acuminate; not reaching anteromedial metaventral process. Epipleuron becoming narrower short before mid-length, without oblique carina near shoulder. Metepisternum more or less triangular in shape. Metacoxal lines obsolete; joint hind margin of metacoxal processes incised; lobes of processes rounded.

Figure 4. 

Iberoporus pluto sp. n., holotype, ventral view (previous to DNA extraction).

Legs (Figs 24): long and slender, especially posterior legs. Metafemora very thin, not enlarged, regularly curved; without natatorial setae.

Etymology

From “Πλούτων” (Ploutōn), the ruler of the underworld in the Greek mythology. Name in apposition.

Notes on the habitat

Soprador do Carvalho is a cave with approximately 4 km of horizontal development (Fig. 7). It is the largest cave of the so-called Dueça Speleological System, located in the north-eastern part of the Sicó karst area in central Portugal (Neves et al. 2005). The subterranean stream feeds the spring of the Dueça River, a contributor to the Mondego River. The substrate of the river is mostly composed of clasts and gravel, with large clay deposits on the margins. The specimen was found in the bottom of a clay pound connected to the margin of the subterranean stream. Other invertebrate stygobionts are found in this stream, such as a new species of the asellid genus Proasellus and of the amphipod genus Pseudoniphargus, and unidentified copepods (Reboleira 2012). In the terrestrial compartment of the cave, several cave-adapted species are known: the pseudoscorpion Occidenchthonius duecensis Zaragoza & Reboleira, 2018; the millipede Scutogona minor Enghoff & Reboleira, 2013; the woodlice Trichoniscoides sicoensis Reboleira & Taiti, 2015 (which has an amphibian behaviour and can be collected inside the stream totally submerged) and Porcellio cavernicolus Vandel, 1946; and the dipluran Podocampa cf. fragiloides Silvestri, 1932 (Enghoff and Reboleira 2013, Reboleira et al. 2015, Zaragoza and Reboleira 2018). Over recent years, the cave is being explored for tourism. This may represent a major threat, as tourists constantly trample the bottom of the subterranean stream where the new species was found.

Remarks

Iberoporus pluto sp. n. is most similar in its external morphology to I. cermenius. Both share a similar shape of the head, a cordiform pronotum without lateral stria, and similar general appearance (Figs 2, 5a). In the absence of males of I. pluto sp. n. (and in addition to the genetic differences), both species can be easily separated by the body shape, larger and wider in I. pluto sp. n., and with a less prominent constriction between pronotum and elytra (clearly visible in I. cermenius) and with a more transverse pronotum. The appendages of I. pluto sp. n. are also longer and more slender, especially the antennae and the pro- and mesotibiae (Figs 2, 5a). Iberoporus cermenius has also well-defined parasutural rows on the elytra formed by large punctures, which are absent in I. pluto sp. n.

Figure 5. 

Habitus of the species of Iberoporus. a I. cermenius (modified from Millán et al. 2014) b I. agnus comb. n. c I. argaensis comb. n. (both modified from Fery 2016).

Figure 6. 

Distribution map of the Iberian species of Rhithrodytes and Iberoporus. Key: red star, I. pluto sp. n.; blue diamond, I. cermenius; filled purple circle, I. argaensis comb. n.; empty purple circle, I. agnus comb. n.; black circles, R. bimaculatus (data from Millán et al. 2014).

Figure 7. 

Soprador do Carvalho Cave, type locality of Iberoporus pluto sp. n.

Discussion

We obtained for the first time a phylogeny of Siettitiina including a species of its type genus, Siettitia. Despite the incomplete data, there is strong support for the existence of a clade including Siettitia, Iberoporus, and Rhithrodytes, what we call the Siettitia group of genera. Our results also clearly demonstrate the parayphyly of Rhithrodytes, and the need to transfer two of the species to maintain its monophyly. The relationships between Rhithrodytes and the other three European stygobiont genera of Siettitiina (Siettitia, Iberoporus, and Etruscodytes), although widely recognised, had not been clearly established. Originally, the genus Rhithrodytes was erected for a group of species of Graptodytes (the group IV of Zimmermann 1919, or the group “crux” of Guignot 1947) with a curved apex of the median lobe of the aedeagus, a lateral stria running the whole length of the pronotum (Bameul 1989) and (as recognised later), a transverse carina in the epipleura (Fery 2013). With the exception of the epipleural carina, the rest of the characters are shared with the subterranean genus Siettitia, which has been for long recognised to be closely related to some of the species included in Rhithrodytes (e.g., R. bimaculatus (Dufour, 1852); Régimbart 1905, Zimmermann 1932) (Table 3).

Summary comparison of some character states among the taxa of the Siettitia group of genera (character states of Etruscodytes obtained from Mazza et al. 2013).

Character and character state Siettitia Etruscodytes Iberoporus cermenius, I. pluto sp. n. Iberoporus agnus, I. argaensis Rhithrodytes sensu novo
sublateral pronotal stria long long absent long long
subhumeral epipleural carina absent absent? absent present present
pigmentation of elytra weak weak weak strong generally strong
eyes absent absent absent present present
body shape, general parallel parallel parallel oval-parallel generally oval
constriction at bases of pronotum and elytra absent absent present absent absent
contact between prosternal process and anteromedial metaventral process absent present absent present present
ventrites II and III fused not fused fused in I. cermenius not fused not fused
elytra fused partly fused? not fused not fused not fused

Subsequent to the description of Rhithrodytes two genera were described each for a single European stygobiont species: Iberoporus and Etruscodytes. Iberoporus cermenius shares the structure of the male genitalia with Rhithrodytes and Siettitia, but it is in particular very similar to that of I. agnus and I. argaensis. These two species (formerly in Rhithrodytes) have a more straight median lobe and a different shape of the apex of the parameres (Bilton and Fery 1996, Fery 2016).

The body shape of I. agnus and I. argaensis has also some similarities to the species of Iberoporus, parallel-sided and elongated (Figs 5b, c; see figs 12–19 in Fery 2016). Iberoporus cermenius shares with Siettitia the structure of the metacoxal processes, something that could be related to the subterranean habitat and a poor swimming ability (Castro and Delgado 2001).

Etruscodytes, described from a male and a female, also shares with Rhithrodytes and Siettitia the general structure of the aedeagus (note that the tip of the aedeagus in the figure of Mazza et al. 2013 seems to be broken) and the long lateral striae of the pronotum (Table 3), but nevertheless was described in a separate genus due to some morphological peculiarities (Mazza et al. 2013). Thus, according to the description by Mazza et al. (2013), the species would have (1) head wide and “subsquare” (regularly rounded in Siettitia and Rhithrodytes; although more similar to that of Iberoporus); (2) presence of short and flattened setae on pronotum and elytra; (3) prosternal process contacting anteromedial process of metaventrite (also in Rhithrodytes, not in Siettitia and Iberoporus, Table 3); (4) anteromedial process of metaventrite rounded (pointed in Siettitia according to Mazza et al. 2013); (5) ventrites II and III not fused (fused in Siettitia and I. cermenius, not in I. pluto sp. n. or Rhithrodytes); (6) elytra not completely fused (fused in Siettitia, not in Iberoporus and Rhithrodytes). Some of these characters seem to be clear autapomorphies related to the subterranean life (fusion of elytra or ventrites, particularly shaped setae, lack of lateral striae on the pronotum, lack of carina on the epipleuron), and others are of uncertain interpretation. Thus, the structure of the prosternal process is sometimes difficult to appreciate, but there do not seem to be fundamental differences between the species (note that in fig. 7 in Mazza et al. 2013 the prosternal process seems to fit below the anteromedial process of the metaventrite, which is likely an artefact), being the differences consequence of the different position of the mesocoxa (contiguous or not) and ultimately the width of the body, which in turn may depend on the habitat and ecology of the species. More data, especially molecular sequences of Etruscodytes and Siettitia, and the likely discovery of other subterranean taxa would contribute to the understanding of the evolution of this western Mediterranean lineage.

Acknowledgements

We thank all collectors listed in Table 1 for their material, in particular P Richoux (Lyon) for providing specimens of Siettitia avenionensis; A Cardoso and A Villastrigo (IBE) for laboratory work; and H Fery (Berlin) for multiple comments and improvements of the manuscript. Molecular work was partly funded by projects CGL2013-48950-C2-1-P and CGL2016-76705-P (AEI/FEDER, UE) to IR. ASR is supported by a research grant (15471) from VILLUM FONDEN. The holotype was collected under permits of the Instituto de Conservação da Natureza e das Florestas.

References

  • Abellán P, Sánchez-Fernández D, Picazo F, Millán A, Lobo JM, Ribera I (2013) Preserving the evolutionary history of freshwater biota in Iberian National Parks. Biological Conservation 162: 116–126. https://doi.org/10.1016/j.biocon.2013.04.001
  • Andújar C, Serrano J, Gómez-Zurita J (2012) Winding up the molecular clock in the genus Carabus (Coleoptera: Carabidae): Assessment of methodological decisions on rate and node age estimation. BMC Evolutionary Biology 12: 40. https://doi.org/10.1186/1471-2148-12-40
  • Bameul F (1989) Description de Rhithrodytes, nouveau genre d’Hydroporinae d’Europe et d’Afrique du Nord: analyse phylogénétique et biogéographie (Coleoptera: Dytiscidae). Annales de la Société Entomologique de France N.S. 25: 481–503.
  • Bilton DT, Fery H (1996) Revisional notes on Rhithrodytes Bameul 1989, with the description of a new subspecies and the introduction of Rhithrodytes dorsoplagiatus (Fairmaire) as a valid species (Coleoptera, Dytiscidae). Linzer Biologische Beiträge 28: 917–931.
  • Castro A, Delgado JA (2001) Iberoporus cermenius, a new genus and species of subterranean water beetle (Coleoptera : Dytiscidae) from Spain. Aquatic Insects 23: 33–43. https://doi.org/10.1076/aqin.23.1.33.4931
  • Colgan DJ, McLauchlan A, Wilson GDF, Livingston SP, Edgecombe GD, Macaranas J, Cassis G, Gray MR (1998) Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Australian Journal of Zoology 46: 419–437. https://doi.org/10.1071/ZO98048
  • Enghoff H, Reboleira ASPS (2013) A new cave-dwelling millipede of the genus Scutogona from central Portugal (Diplopoda, Chordeumatida, Chamaesomatidae). Zootaxa 3736(2): 175–186. http://dx.doi.org/10.11646/zootaxa.3736.2.5
  • Fery H (2013) Rhithrodytes—are we all blind? Latissimus 34: 13–15.
  • Fery H (2016) Notes on Rhithrodytes Bameul, 1989, with the description of R. minimus nov. sp. from Algeria (Coleoptera, Dytiscidae. Hydroporini, Siettitiina). Linzer Biologische Beiträge 48: 431–450.
  • Guignot F (1947) Coléoptères hydrocanthares. Faune de France 48: 1–287.
  • Hebert PD, Ratnasingham S, De Waard JR (2003) Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society B: Biological Sciences 270: S96–S99. https://doi.org/10.1098/rsbl.2003.0025
  • Hebert PD, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences of the United States of America 101(41): 14812–14817. https://doi.org/10.1073/pnas.0406166101
  • Kanda K, Gómez RA, Van Driesche RV, Miller KB, Maddison DR (2016) Phylogenetic placement of the Pacific Northwest subterranean endemic diving beetle Stygoporus oregonensis Larson & LaBonte (Dytiscidae, Hydroporinae). ZooKeys 632: 75–91. https://doi.org/10.3897/zookeys.632.9866
  • Katoh K, Toh H (2008) Recent developments in the MAFFT multiple sequence alignment program. Briefings in Bioinformatics 9: 286–298. https://doi.org/10.1093/bib/bbn013
  • Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A (2012) Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. https://doi.org/10.1093/bioinformatics/bts199
  • Mazza G, Cianferoni F, Rocchi S (2013) Etruscodytes nethuns n. gen., n. sp.: the first phreatic water beetle from Italy (Coleoptera: Dytiscidae: Hydroporinae). Italian Journal of Zoology 80(2): 233–241.
  • Millán A, Sánchez-Fernández D, Abellán P, Picazo F, Carbonell JA, Lobo JM, Ribera I (2014) Atlas de los coleópteros acuáticos de España peninsular. Madrid: Ministerio de Agricultura, Alimentación y Medio Ambiente, 819 pp.
  • Miller KB, Bergsten J (2016) Diving beetles of the world: Systematics and biology of the Dytiscidae. Johns Hopkins University Press, Baltimore, 320 pp.
  • Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Proceedings of the Gateway Computing Environments Workshop (GCE) IEEE, New Orleans, 1–8. https://doi.org/10.1109/GCE.2010.5676129
  • Miller KB, Jean A, Alarie Y, Hardy N, Gibson R (2013) Phylogenetic placement of North American subterranean diving beetles (Insecta: Coleoptera: Dytiscidae). Arthropod Systematics & Phylogeny 71: 75–90.
  • Neves J, Pessoa M, Redinha N (2005) O sistema espeleológico do Dueça. Espeleo Divulgação 6: 14–18.
  • Nilsson AN, Hájek J (2018a) Catalogue of Palaearctic Dytiscidae (Coleoptera), 88 pp. Internet Version 31.I.2018. http://www.waterbeetles.eu [Accessed 11 September 2018]
  • Nilsson AN, Hájek J (2018b) A world catalogue of the family Dytiscidae (Coleoptera, Adephaga), 304 pp. Internet version 31.I.2018. Available from: http://www.waterbeetles.eu [Accessed 11 September 2018]
  • Régimbart M (1905) Note sur le Siettitia balsetensis. Bulletin de la Société Entomologique de France 1905: 252.
  • Reboleira ASPS (2012) Biodiversity and conservation of subterranean fauna of Portuguese karst. Ph.D. thesis, University of Aveiro, 333 pp. http://hdl.handle.net/10773/10865
  • Reboleira ASPS, Borges P, Gonçalves F, Serrano ARM, Oromí P (2011) The subterranean fauna of a biodiversity hotspot region - Portugal: an overview and its conservation. International Journal of Speleology 40(1): 23–37. http://dx.doi.org/10.5038/1827-806X.40.1.4
  • Reboleira ASPS, Gonçalves F, Oromí P (2013) Literature survey, bibliographic analysis and a taxonomic catalogue of subterranean fauna from Portugal. Subterranean Biology 10: 51–60. http://dx.doi.org/10.3897/subtbiol.10.4025
  • Reboleira ASPS, Gonçalves F, Oromí P, Taiti S (2015) The cavernicolous Oniscidea (Crustacea: Isopoda) of Portugal. European Journal of Taxonomy 161: 1–61. http://dx.doi.org/10.5852/ejt.2015.161
  • Ribera I, Fresneda J, Bucur R, Izquierdo A, Vogler AP, Salgado JM, Cieslak A (2010) Ancient origin of a Western Mediterranean radiation of subterranean beetles. BMC Evolutionary Biology 10: 29. https://doi.org/10.1186/1471-2148-10-29
  • Ribera I, Faille A (2010) A new microphthalmic stygobitic Graptodytes Seidlitz from Morocco, with a molecular phylogeny of the genus (Coleoptera, Dytiscidae). Zootaxa 2641: 1–14. https://doi.org/10.11646/zootaxa.2351.1.1
  • Seidlitz G (1887) Bestimmungs-Tabelle der Dytiscidae und Gyrinidae des europäischen Faunengebietes. Verhandlungen des Naturforschenden Vereines in Brünn 25(1886): 3–136.
  • Shull VL, Vogler AP, Baker MD, Maddison DR, Hammond PM (2001) Sequence alignment of 18S ribosomal RNA and the basal relationships of Adephagan beetles: evidence for monophyly of aquatic families and the placement of Trachypachidae. Systematic Biology 50: 945–969. https://doi.org/10.1080/106351501753462894
  • Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene-sequences and a compilation of conserved polymerase chain-reaction primers. Annals of the Entomological Society of America 87: 651–701. https://doi.org/10.1093/aesa/87.6.651
  • Zaragoza JA, Reboleira ASPS (2018) Five new hypogean Occidenchthonius (Pseudoscorpiones, Chthoniidae) from Portugal. Journal of Arachnology 46(1): 81–103. https://doi.org/10.1636/JoA-S-17-031.1
  • Zimmermann A (1919) Die Schwimmkäfer des Deutschen Entomologischen Museums in Berlin-Dahlem. Archiv für Naturgeschichte 83A(12) (1917): 68–249.
  • Zimmermann A (1932) Monographie der paläarktischen Dytisciden. III. Hydroporinae (3. Teil). Koleopterologische Rundschau 18: 69–111.