Research Article |
Corresponding author: Ignacio Ribera ( ignacio.ribera@ibe.upf-csic.es ) Academic editor: Mariano Michat
© 2019 Ignacio Ribera, Ana Sofia P.S. Reboleira.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Ribera I, Reboleira ASPS (2019) The first stygobiont species of Coleoptera from Portugal, with a molecular phylogeny of the Siettitia group of genera (Dytiscidae, Hydroporinae, Hydroporini, Siettitiina). ZooKeys 813: 21-38. https://doi.org/10.3897/zookeys.813.29765
|
Iberoporus pluto sp. n., the first stygobiont beetle from Portugal (Dytiscidae, Hydroporinae), is described from a single female from the cave Soprador do Carvalho (Coimbra). The species is highly troglomorphic, depigmented, blind, and with elongated appendages not adapted for swimming. A molecular phylogeny based on a combination of three mitochondrial and two nuclear genes showed the new species to be sister to I. cermenius Castro & Delgado, 2001 from Córdoba (south of Spain), within the subtribe Siettitiina of the tribe Hydroporini. Both species are included in a clade with Siettitia avenionensis Guignot, 1925 (south of France) and Rhithrodytes agnus Foster, 1992 and R. argaensis Fery & Bilton, 1996 (north of Portugal), in turn sister to the rest of species of genus Rhithrodytes Bameul, 1989, in what is here considered the Siettitia group of genera. We resolve the paraphyly of Rhithrodytes by transferring the two Portuguese species to Iberoporus Castro & Delgado, 2001, I. agnus (Foster, 1992), comb. n. and I. argaensis (Fery & Bilton, 1996), comb. n.
Diving beetles, groundwater, new species, stygofauna, troglomorphy
The knowledge of the subterranean fauna from Portugal has significantly increased over the last decade, with the description of a high number of obligate subterranean species (tripling their number) and the establishment of new biogeographic patterns (
In this work we describe the first stygobiont species of Coleoptera from Portugal, a diving beetle of the subtribe Siettitiina (Dytiscidae, Hydroporinae, Hydroporini; type genus: Siettitia Abeille de Perrin, 1904). Siettitiina includes the only known European genera of Dytiscidae which have stygobiont members: Siettitia, with two species in France, Iberoporus Castro & Delgado, 2001, with one species in south Spain, Etruscodytes Mazza et al., 2013, with one Italian species, and Graptodytes Seidlitz, 1887, with the Moroccan G. eremitus Ribera & Faille, 2010 among several epigean members (
For the phylogenetic placement of the new species we used the datasets of
Material used in the molecular phylogeny of the Siettitia group of genera, with locality, collector, and EMBL accession numbers. Newly obtained sequences are in bold typeface. Nomenclature follows
N | Species | Voucher | Locality, date, and collector | COI-5’ | COI-3’ | 16S+ | 18S | H3 |
---|---|---|---|---|---|---|---|---|
1 | Graptodytes aequalis | NHM-IR206 | Morocco: Debdou, Meson forestiere; 6.4.1999, I Ribera, P Aguilera, C Hernando, A Millán | LS999725 | HM588264 | AY250910 | AJ850509 | EF670184 |
2 | G. atlantis |
|
Morocco: Lac Afenourir, Azrou; 29.4.2000, I Ribera | LS999726 | HM588265 | HM588602 | LS999692 | LS999771 |
3 | G. bilineatus |
|
Sweden: Västerbotten prov., Åmsele, Vindelälven; 18.9.2005, AN Nilsson | LS999727 | HM588267 | HM588603 | LS999693 | LS999772 |
4 | G. castilianus |
|
Spain: Navarra, Pitillas: pond in crossroad; 21.7.2004, I Ribera, A Cieslak | HF947943 | HM588268 | HM588604 | LS999694 | LS999773 |
5 | G. delectus |
|
Tenerife (Spain): Chamorga, Bco. Roque Bermejo; 20.7.2006, A Castro | LS999728 | HM588269 | HM588605 | LS999695 | LS999774 |
6 | G. eremitus | IBE-AF33 | Morocco: Tiqqi, cave Doussoulile; 28.7.2008, JM Bichain et al. | LS999729 | HM588271 | HM588606 | LS999696 | LS999775 |
7 | G. flavipes | NHM-IR40 | Spain: Huelva, Almonte, poblado forestal; 26.7.1998, I Ribera | – | HM588273 | AY250914 | AJ318730 | EF056561 |
8 | G. fractus |
|
Spain: Córdoba, Sa. de Córdoba, Arroyo de los Arenales; 16.4.2005, A Castro | LS451100 | HM588274 | HM588608 | LS453474 | LS453168 |
9 | G. granularis |
|
Sweden: Västerbotten prov., Åmsele, Vindelälven; 18.9.2005, AN Nilsson | LS999730 | HM588278 | HM588611 | LS999697 | LS999776 |
10 | G. ignotus | NHM-IR531 | Spain: Girona, Estanys de Capmany, 3.2001, P Aguilera | LS999731 | HM588287 | AY250915 | AJ850510 | EF670185 |
11 | G. kuchtae |
|
Mallorca (Spain): Ternelles, Torrent de Ternelles; 14.10.2004, I Ribera, A Cieslak | LS999732 | HM588288 | HM588614 | LS999698 | LS999777 |
12 | G. laeticulus |
|
Algeria: Algeria, Aïn Damous; 24.8.2006, S Bouzid | – | HM588300 | HM588621 | LS999699 | LS999778 |
13 | G. pictus |
|
Poland: Zachodniopomorsky, Dygowo: pond; 16.8.2004, I Ribera, A Cieslak | LS999733 | HM588290 | HM588615 | LS999700 | LS999779 |
14 | G. pietrii |
|
Tunisia: Rd. Beja-Teboursouk, NW Teboursouk; 23.10.2001, I Ribera, A Cieslak | LS999734 | HM588292 | HM588616 | LS999701 | LS999780 |
15 | G. sedilloti sedilloti | NHM-IR585 | Cyprus; 3.2001, K Miller | LS451098 | HM588294 | HM588619 | LS453473 | LS453167 |
16 | G. sedilloti phrygius |
|
Chios (Greece): Marmaro marsh; 19.4.2004, GN Foster | LS999735 | HM588293 | HM588618 | LS999702 | LS999781 |
17 | G. siculus |
|
Sicily (Italy): Parco dei Nebrodi, Stream Trail Lago Urio; 13.6.2007, P Abellán, F Picazo | LS999736 | HM588295 | HM588620 | LS999703 | LS999782 |
18 | G. varius |
|
Sicily (Italy): Parco dei Nebrodi, Stream Trail Lago Urio; 13.6.2007, P Abellán, F Picazo | LS999737 | HM588297 | HM588622 | LS999704 | LS999783 |
19 | G. veterator veterator |
|
Sicily (Italy): Parco dei Nebrodi, Stream Trail Lago Urio; 13.6.2007, P Abellán, F Picazo | LS451095 | HM588304 | HM588625 | LS453472 | LS453105 |
20 | G. veterator behningi |
|
Turkey: Düzce, Rd. to Kartalkaya from Çaydurt; 23.4.2006, I Ribera | LS999738 | HM588303 | HM588624 | LS999705 | LS999784 |
21 | Iberoporus cermenius | NHM-IR276 | Spain: Cordoba, Priego de Cordoba; 29.4.2000, A Castro | LS451107 | AY250958 | AY250918 | AJ850511 | EF670186 |
22 | I. pluto sp. n. | IBE-AN151 | Portugal: Soprador do Carvalho; 24.10.2014, ASPS Reboleira | LS999739 | LS999756 | LS999763 | LS999706 | LS999785 |
23 | Metaporus meridionalis | NHM-IR34 | Spain: Albacete, Robledo, Ojos de Villaverde; 7.9.1997, I Ribera | – | HM588307 | AY250919 | AJ318739 | EF670187 |
24 | Porhydrus genei | IBE-RA86 | Algeria: Garaet Aïn Nechma, nr Ben-Azzouz (Skikda); 29.6.2009, S Bouzid | LS999740 | HF931320 | HF931543 | LS999707 | LS999786 |
25 | P. lineatus | NHM-IR24 | England (UK): Sommerset Levels, Chilton Trinity; 4.7.1998, I Ribera | LS999741 | AY250973 | AY250933 | AJ318743 | EF670188 |
26 | P. obliquesignatus | IBE-RA147 | Italy: Piano Grande. Piano di Castelluccio; 20.7.2009, M Toledo | LS999742 | HF931305 | LS999764 | LS999708 | LS999787 |
27 | P. vicinus |
|
Portugal: Cercal, ephemeral pond btw. Cercal and Vilanova; 24.1.2008, I Ribera | LS999743 | HF931132 | HF931350 | LS999709 | LS999788 |
28 | Rhithrodytes agnus |
|
Portugal: Viana do Castelo, N Ponte de Lima, W Labruja; 28.5.2006, H Fery | LS999744 | HF931143 | HF931362 | LS999710 | LS999789 |
29 | R. argaensis |
|
Portugal: Serra de Arga, Pools on summit; 9.5.2005, DT Bilton | HF948005 | HF931183 | HF931405 | LS999711 | LS999790 |
30 | R. bimaculatus | IBE-RA727 | Spain: Huesca, Aragués del Puerto; 23.7.2011, I Esteban | LS999745 | LS999757 | LS999765 | LS999712 | LS999791 |
31 | R. crux |
|
Italy: Alessandria, stream; 2.5 km S Praglia; 18.10.2002, I Ribera, A Cieslak | LS451084 | HF931187 | HF931410 | LS453475 | LS453108 |
32 | R. numidicus |
|
Tunisia: Rd. Tabarka-Aïn-Draham, stream Aïn-Draham; 23.10.2001, I Ribera, A Cieslak | – | LS999758 | LS999766 | LS999713 | LS999792 |
33 | R. sexguttatus | NHM-IR183 | Corsica (France): Porto-Vecchio: l’Ospedale; 18.9.1999, I Ribera, A Cieslak | – | AY250975 | AY250936 | AJ850513 | EF670190 |
34 | Siettitia avenionensis |
|
France: Barbentane; 22.2.1992, J Dalmon | – | LS999759 | – | LS999714 | – |
35 | Stictonectes abellani | IBE-PA312 | Spain: Ciudad Real, PN Cabañeros; 7.7.2008, A Millán and col. | LS451083 | HF931298 | HF931530 | LS453469 | LS453169 |
36 | S. azruensis | NHM-IR661 | Morocco: Moyen Atlas, nr. Azrou, Col du Zad; 16.4.2001, Pellecchia, Pizzetti | LS999746 | AY250979 | AY250940 | LS999715 | LS999793 |
37 | S. canariensis | IBE-AF114 | Gran Canaria (Spain): Barranco Güigüi grande; 1.4.2008, J Hájek, K Kaliková | LS999747 | HF931113 | HF931330 | LS999716 | LS999794 |
38 | S. epipleuricus |
|
Portugal: Serra de São Mamede, Portalegre: r. Caia; 25.7.1998, I Ribera | LS999748 | LS999760 | LS999767 | LS999717 | – |
39 | S. escheri |
|
Morocco: Asilah, rd. N1, stream ca.; 4 km S Asilah; 27.3.2008, I Ribera, P Aguilera, C Hernando | LS999749 | HF931130 | HF931349 | LS999718 | LS999795 |
40 | S. formosus |
|
Morocco: Asilah, rd. N1, stream ca.; 4 km S Asilah; 27.3.2008, I Ribera, P Aguilera, C Hernando | LS999750 | HF931131 | LS999768 | LS999719 | LS999796 |
41 | S. lepidus |
|
Spain: Córdoba, Sierra Morena, cta. Villaviciosa; 16.4.2005, A Castro | LS999751 | LS999761 | LS999769 | LS999720 | LS999797 |
42 | S. occidentalis | NHM-IR529 | Portugal: Algarve; 2001, P Aguilera | – | AY250980 | AY250942 | – | LS999798 |
43 | S. optatus |
|
Spain: Jaén, Sierra de Cazorla, cta. Del Tranco; 3.8.2006, A Castro | LS999752 | LS999762 | LS999770 | LS999721 | LS999799 |
44 | S. optatus | NHM-MsC | Corsica (France): Porto-Vecchio: l’Ospedale; 18.9.1999, I Ribera, A Cieslak | – | AY250981 | AY250943 | AJ850514 | EF670192 |
45 | S. rebeccae |
|
Portugal: Serra Estrela, Sabugueiro, r. above village; 12.5.2005, I Ribera | LS999753 | FR851207 | FR851208 | LS999722 | LS999800 |
46 | S. rufulus |
|
Sardinia (Italy): Road from Óschiri to Mount Limbara; 17.10.2006, GN Foster | LS999754 | HF931179 | HF931400 | LS999723 | LS999801 |
47 | S. samai | IBE-AF142 | Algeria: Oued Bagrat; 24.3.2006, S Bouzid | LS999755 | HF931119 | HF931336 | LS999724 | LS999802 |
Examples of most species of Palaearctic Siettitiina were included, including all stygobiont or interstitial species with the exception of Graptodytes aurasius Jeannel, 1907 (Algeria), Siettitia balsetensis Abeille de Perrin, 1904 (France) and Etruscodytes nethuns
Fragments of five genes in five sequencing reactions were sequenced, three mitochondrial (1) 5’ end of cytochrome c oxidase subunit 1 (COI-5, “barcode” fragment of
Gene | Primer | Sequence | Reference |
---|---|---|---|
COI-3’ | Jerry (5’) | CAACATTTATTTTGATTTTTTGG |
|
Pat (3’) | TCCAATGCACTAATCTGCCATATTA | ||
Chy (5’) | T(A/T)GTAGCCCA(T/C)TTTCATTA(T/C)GT |
|
|
Tom (3’) | AC(A/G)TAATGAAA(A/G)TGGGCTAC(T/A)A | ||
COI-5’ | Uni LepF1b | TAATACGACTCACTATAGGGATTCAACCAATCATAAAGATATTGGAAC |
|
Uni LepR1 | ATTAACCCTCACTAAAGTAAACTTCTGGATGTCCAAAAAATCA | ||
16S+trnL+nad1 | 16SaR (5’) | CGCCTGTTTAACAAAAACAT |
|
ND1 (3’) | GGTCCCTTACGAATTTGAATATATCCT | ||
16Sb | CCGGTCTGAACTCAGATCATGT | ||
18S | 18S 5’ | GACAACCTGGTTGATCCTGCCAGT(1) |
|
18S b5.0 | TAACCGCAACAACTTTAAT(1) | ||
H3 | H3aF (5’) | ATGGCTCGTACCAAGCAGACRCG |
|
H3aR (3’) | ATATCCTTRGGCATRATRGTGAC |
Edited sequences were aligned using the online version of MAFFT 7 with the G-INS-I algorithm (
BEAST 1.8 (
The two BEAST analyses (GTR and HKY evolutionary models) resulted in identical topologies and very similar branch lengths, although convergence for GTR evolutionary models was poor for some genes (nad1, 18S), so we present here only the results of the HKY models (Fig.
We obtained a well-supported, well-resolved phylogeny of Siettitiina (Fig.
According to our calibration, the separation between the new species and Iberoporus cermenius was dated at ca. 10 Ma (95% HPD 13.4-6.9 Ma), with a similar age for the split from I. agnus + I. argaensis (11.4 Ma [15.0-8.3]), during the Tortonian (Fig.
Portugal, Penela, Gruta Soprador do Carvalho (39°59'N, 8°23'W) (Fig.
Holotype female (NHMD) Portugal, Penela, Gruta Soprador do Carvalho, ASPS Reboleira leg., 24.X.2014, with red holotype label and DNA voucher label “IBE-AN151”.
A blind and depigmented species of Iberoporus, larger and wider than the other subterranean species of the genus, with a cordiform pronotum without lateral stria, less prominent constriction between pronotum and elytra and with a more transverse pronotum. Appendages longer and more slender, especially antennae and pro- and mesotibiae. Male unknown.
Body length 2.8 mm, maximum width 1.1 mm. Habitus: Body elongate, strongly parallel-sided (including pronotum and head) (Fig.
Head (Fig.
Pronotum (Figs
Elytra (Figs
Ventral surface (Fig.
Legs (Figs
From “Πλούτων” (Ploutōn), the ruler of the underworld in the Greek mythology. Name in apposition.
Soprador do Carvalho is a cave with approximately 4 km of horizontal development (Fig.
Iberoporus pluto sp. n. is most similar in its external morphology to I. cermenius. Both share a similar shape of the head, a cordiform pronotum without lateral stria, and similar general appearance (Figs
We obtained for the first time a phylogeny of Siettitiina including a species of its type genus, Siettitia. Despite the incomplete data, there is strong support for the existence of a clade including Siettitia, Iberoporus, and Rhithrodytes, what we call the Siettitia group of genera. Our results also clearly demonstrate the parayphyly of Rhithrodytes, and the need to transfer two of the species to maintain its monophyly. The relationships between Rhithrodytes and the other three European stygobiont genera of Siettitiina (Siettitia, Iberoporus, and Etruscodytes), although widely recognised, had not been clearly established. Originally, the genus Rhithrodytes was erected for a group of species of Graptodytes (the group IV of
Summary comparison of some character states among the taxa of the Siettitia group of genera (character states of Etruscodytes obtained from
Character and character state | Siettitia | Etruscodytes | Iberoporus cermenius, I. pluto sp. n. | Iberoporus agnus, I. argaensis | Rhithrodytes sensu novo |
sublateral pronotal stria | long | long | absent | long | long |
subhumeral epipleural carina | absent | absent? | absent | present | present |
pigmentation of elytra | weak | weak | weak | strong | generally strong |
eyes | absent | absent | absent | present | present |
body shape, general | parallel | parallel | parallel | oval-parallel | generally oval |
constriction at bases of pronotum and elytra | absent | absent | present | absent | absent |
contact between prosternal process and anteromedial metaventral process | absent | present | absent | present | present |
ventrites II and III | fused | not fused | fused in I. cermenius | not fused | not fused |
elytra | fused | partly fused? | not fused | not fused | not fused |
Subsequent to the description of Rhithrodytes two genera were described each for a single European stygobiont species: Iberoporus and Etruscodytes. Iberoporus cermenius shares the structure of the male genitalia with Rhithrodytes and Siettitia, but it is in particular very similar to that of I. agnus and I. argaensis. These two species (formerly in Rhithrodytes) have a more straight median lobe and a different shape of the apex of the parameres (
The body shape of I. agnus and I. argaensis has also some similarities to the species of Iberoporus, parallel-sided and elongated (Figs
Etruscodytes, described from a male and a female, also shares with Rhithrodytes and Siettitia the general structure of the aedeagus (note that the tip of the aedeagus in the figure of
We thank all collectors listed in Table