Two new species of the genus Milnesium Doyère, 1840 (Tardigrada, Apochela, Milnesiidae) from Madagascar

Łukasz Kaczmarek; Daria Grobys; Adam Kulpa; Tomasz Bartylak; Hanna Kmita; Marta Kepel; Andrzej Kepel; Milena Roszkowska

doi:10.3897/zookeys.884.29469

Research Article

Two new species of the genus Milnesium Doyère, 1840 (Tardigrada, Apochela, Milnesiidae) from Madagascar

Łukasz Kaczmarek^‡, Daria Grobys^‡, Adam Kulpa^‡, Tomasz Bartylak^‡, Hanna Kmita^‡, Marta Kepel^§, Andrzej Kepel^§, Milena Roszkowska^‡

‡ Adam Mickiewicz University, Poznań, Poland

§ Polish Society for Nature Conservation “Salamandra”, Poznań, Poland

Corresponding author: Łukasz Kaczmarek ( kaczmar@amu.edu.pl )

Academic editor: Sandra McInnes

This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation: Kaczmarek Ł, Grobys D, Kulpa A, Bartylak T, Kmita H, Kepel M, Kepel A, Roszkowska M (2019) Two new species of the genus Milnesium Doyère, 1840 (Tardigrada, Apochela, Milnesiidae) from Madagascar. ZooKeys 884: 1-22. https://doi.org/10.3897/zookeys.884.29469

ZooBank: urn:lsid:zoobank.org:pub:725DD9DA-C5FF-450A-ABC0-42A06C6E5C37

Abstract

The knowledge of the diversity and distribution of tardigrades on Madagascar is rather poor. To date, only 13 tardigrade taxa have been reported from this region (including one Milnesium species). We examined 46 specimens belonging to two new-to-science species of the genus Milnesium described herein using an integrative approach, including classical morphology and molecular marker (COI, ITS-2 and 28S rRNA) analysis. The species were found in two moss and lichen samples collected in the Ivohibory forest in Fianarantsoa Province. Milnesium matheusi sp. nov., with claw configuration [3-3]–[3-3] and rather wide buccal tube, morphologically is most similar to: Mil. beatae Roszkowska, Ostrowska & Kaczmarek, 2015, Mil. bohleberi Bartels, Nelson, Kaczmarek & Michalczyk, 2014, Mil. eurystomum Maucci, 1991, Mil. shilohae Meyer, 2015 and Mil. tumanovi Pilato, Sabella & Lisi, 2016; however, it differs from these by morphometric characteristics. Milnesium wrightae sp. nov., by the presence of four points on secondary branches of claws IV, is most similar to Mil. quadrifidum Nederström, 1919. However, Mil. wrightae sp. nov. differs from Mil. quadrifidum by claw configuration ([4-4]–[4-4] in Mil. quadrifidum vs. [3-3]–[4-4] in Mil. wrightae sp. nov.), but also by the position of the fourth points on secondary branches of claws IV, which are located near the base of the claw in the new species and near the top of the claw in Mil. quadrifidum. Genotypic analysis showed that Mil. matheusi sp. nov. is most similar to Milnesium sp. (28S rRNA), Mil. variefidum (COI) and Mil. t. tardigradum (ITS-2) while Mil. wrightae sp. nov. is most similar to Milnesium sp. (28S rRNA), Mil. variefidum (COI) and Mil. matheusi (ITS-2). Five Milnesium taxa are recorded from the African region, including the two new species from Madagascar reported in this study.

Keywords

integrative taxonomy, Milnesiidae, Milnesium matheusi sp. nov., Milnesium wrightae sp. nov., tropical region

Introduction

Madagascar stretches from ~12° to ~26°S latitude on the Indian Ocean, more than 400 km east of Africa. With an area of ca. 590,000 km², Madagascar is the world’s fourth largest island; however, it is sometimes considered a microcontinent due to its geological and biological history. First, it separated from Gondwana as part of East Gondwana, comprising the Antarctic, Madagascar, Indian, and Australian plates. After several subsequent breakups, it finally separated from the Seychelles and India ca. 66–90 My ago (de Witt 2003, Kusky et al. 2007). Madagascar is characterised by high biological endemism, estimated at >90% for terrestrial vertebrates and >80% for vascular plants (Goodman and Benstead 2003, Callmander et al. 2011). A great number of species occurring in Madagascar have restricted geographical ranges and are reported from only one or several localities (Wilmé et al. 2006). Several present taxa are assumed to be Gondwanan relicts. Most of the biota is believed to be derived from African and Asian colonizers (Yoder and Nowak 2006, Warren et al. 2010, Buerki et al. 2013; Hong-Wa and Besnard 2013). Madagascar has a tropical climate with two main climatic and biogeographic zones characterised by a substantially different vegetation cover, i.e., evergreen humid forests and deciduous forests divided by a mountain range that extends from north to south in eastern-central Madagascar (Du Puy and Moat 1996). Both zones are divided into several regions, each of which has distinctive climatic features and a set of unique habitats.

The area studied is located in south-central Madagascar (approximately 22.598830S, 46.720841E Ivohibe District, Fianarantsoa Province) on the eastern slopes of a hill located on the dry side of the main mountain range. The Ivohibory forest – which is a humid rainforest with some patches of grassy clearings – covers an area of approximately 1400 ha with an elevation gradient stretching from 900 to 1500 m asl, surrounded by human-created savannah, with a few lasting micro-patches of dry forest. It is situated on quartzite deposits, which is unique for this region (Wright and Houlihan 2017). This unusual geology strongly influences the species composition of the existing vegetation (Du Puy and Moat 1996).

The phylum Tardigrada currently consists of ca. 1200 species (Guidetti and Bertolani 2005; Degma and Guidetti 2007; Degma et al. 2009–2018; Vicente and Bertolani 2013) that inhabit terrestrial and aquatic (freshwater and marine) environments throughout the world (Ramazzotti and Maucci 1983; Nelson et al. 2015). Our knowledge of the diversity and distribution of terrestrial tardigrades on Madagascar is very poor. To date, only 13 species (Bryodelphax parvulus Thulin, 1928, Calcarobiotus (Discrepunguis) polygonatus (Binda & Guglielmino, 1991), Cornechiniscus madagascariensis Maucci, 1993, Doryphoribius flavus (Iharos, 1966), Echiniscus perarmatus Murray, 1907a, Ech. walteri Pilato & Lisi, 2003, Macrobiotus hufelandi hufelandi C.A.S. Schultze, 1834, Mac. madegassus Maucci, 1993, Mesobiotus harmsworthi harmsworthi (Murray, 1907b), Mil. tardigradum tardigradum Doyère, 1840, Minibiotus intermedius (Plate, 1888), Paramacrobiotus (Paramacrobiotus) richtersi (Murray, 1911) and Pseudechiniscus suillus (Ehrenberg, 1853)) have been reported from this region (Maucci 1993; Pilato and Lisi 2003).

Species of the genus Milnesium Doyère, 1840 are large and carnivorous, feeding mainly on rotifers, nematodes and other tardigrades, but single reports show that they can also feed on amoebas (Miller and Williams 2012; Roszkowska et al. 2015, 2016). Species in this genus reproduce parthogenetically and/or bisexually, and are characterised by sexual dimorphism (e.g., Suzuki 2003; Ciobanu et al. 2015). Thirty-eight species of the genus Milnesium have been reported mostly from mosses and lichens from many localities, ranging from the Antarctic through tropical and temperate to Arctic regions. Most have been described in recent years (Degma et al. 2009–2018; Kaczmarek et al. 2014, 2015, 2016; McInnes et al. 2017). According to its unique morphology (and based on molecular data) the genus Milnesium is classified in the class Apotardigrada (Schuster, Nelson, Grigarick & Christenberry, 1980) (Guil et al. 2019). Until now, only three Milnesium species (Mil. dornensis Ciobanu, Roszkowska & Kaczmarek, 2015, Mil. t. tardigradum and Mil. tetralamellatum Pilato & Binda, 1991) have been reported in the so-called African region (McInnes et al. 2017), in which Madagascar is placed. This paper describes two new species from Madagascar using integrative taxonomy.

Material and methods

Sample processing

Two moss and lichen samples from tree and rocks were collected in the Ivohibory forest on June 4, 2017 (permits No 122/17/MEEF/SG/DGF/DSAP/SCB.Re and 150N-EV06/MG17). The samples were packed in paper envelopes, dried at a temperature of ca. 30 °C and delivered to the laboratory at the Faculty of Biology, Adam Mickiewicz University, Poznań, Poland. Tardigrades were extracted from the samples and studied following the protocol of Stec et al. (2015).

Microscopy and imaging

Specimens for light microscopy were mounted on microscope slides in a small drop of Hoyer’s medium, prepared according to Ramazzotti and Maucci (1983) as in the English translation by Beasley (1995), and secured with a cover slip. The slides were then placed in an incubator and dried for two days at ca. 60 °C. Dried slides were sealed with a transparent nail polish and examined under an Olympus BX41 phase contrast light microscope (PCM) associated with an ARTCAM–300Mi digital camera (Olympus Corporation, Shinjuku-ku, Japan).

All figures were assembled in Corel Photo-Paint 2017. For deep structures that could not be fully focused in a single photograph, a series of 2–10 images were taken every ca. 0.5 μm and then manually assembled into a single deep-focus image in Corel Photo-Paint 2017.

Morphometrics and morphological nomenclature

All measurements are given in micrometres [μm]. Structures were measured only if their orientation was suitable. Body length was measured from the anterior extremity to the end of the body, excluding the hind legs. All measurements (except buccal tube width) followed protocols in Tumanov (2006). Buccal tube width was measured at three points as suggested by Michalczyk et al. (2012). The pt ratio is the ratio of the length of a given structure to the length of the buccal tube, expressed as a percentage (Pilato 1981). The pt values are always provided in [square brackets and in italics]. Configuration of the number of claw points on the secondary branches (“claw configuration”) is given according to Michalczyk et al. (2012).

Morphometric data were handled using the “Apochela” ver. 1.1 template available from the Tardigrada Register (Michalczyk and Kaczmarek 2013). Tardigrade taxonomy follows Bertolani et al. (2014) and Guil et al. (2019). Genus abbreviations follow Perry et al. (2019).

Comparative material

Species were identified using the key in Morek et al. (2016) and other original descriptions/re-descriptions (Nederström 1919; Maucci 1991; Bartels et al. 2014; Meyer 2015; Roszkowska et al. 2015; Pilato et al. 2016), or based on direct examination of fixed specimens (holotype and paratypes of Mil. bohleberi and specimens of Mil. eurystomum from Spitsbergen, Department of Animal Taxonomy and Ecology, Adam Mickiewicz University, Poznań, Poland). Tardigrade taxonomy follows Marley et al. (2011).

Genotyping

All specimens were preliminarily identified using light microscopy (LM) before DNA extraction. Later, each specimen was placed individually in a 1.5 ml Eppendorf microcentrifuge tube in 20 µl of sterile MQ H₂O and kept frozen at -80 °C until DNA isolation. DNA was extracted from individual animals following a modified Chelex100 resin (Bio-Rad) extraction method (Casquet et al. 2012), modified in order to obtain tardigrade exoskeletons, according to Zawierucha et al. (2016). DNA was extracted by incubating each specimen in 40 µl of 10% Chelex100 resin solution in sterile MQ H₂O with the addition of 0.02 mg of Proteinase K (Genoplast) at 55 °C for 5h with shaking (500 RPM, Eppendorf Thermomixer 5436) and occasionally centrifuged. In the next step, Proteinase K was inactivated by incubating at 70 °C for 15 min. Subsequently, 20 µl of sterile MQ H₂O was added to the tube and centrifuged for 2 min at 8000 G. For further analysis, ca. 40 µl of DNA extract (to the level of remaining Chelex beads at the bottom) was carefully transferred from each tube to a new 1.5 ml Eppendorf microcentrifuge tube. The tardigrade exoskeleton, present in a pellet after centrifugation, containing Chelex beads on the bottom of each tube, was extracted under stereomicroscope and then mounted in Hoyer’s medium for further morphological analysis. Polymerase chain reaction (PCR) amplifications were carried out for three DNA fragments differing in mutation rates: mitochondrial cytochrome oxidase subunit I (COI), nuclear internal transcribed spacer 2 (ITS-2) and cytoplasmic ribosome large subunit component (28S rRNA) in a total volume of 15–50 μl (see Table 1 for primers, Table 2 for PCR cocktail recipes and Table 3 for PCR programmes). PCR products were verified by agarose gel electrophoresis (1–1.2% agarose) with ethidium bromide. Prior to sequencing, PCR products were purified with thermosensitive Exonuclease I and FastAP Alkaline Phosphatase (Fermentas, Thermo Scientific) to improve their quality. Properly prepared PCR products were sequenced bidirectionally with BigDye Terminator v3.1 on an ABI Prism 3130XL Analyzer (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s protocol. The sequences were edited and manually checked against non-conservative alignments using BioEdit, version 7.0.5 (Hall 1999), and submitted to GenBank (see Results section).

Table 1.

Download as

CSV

XLSX

Primers used for amplification and sequencing of DNA fragments.

DNA fragment	Direction	Code	Sequence (5’-3’)	Reference
COI	Forvard	bcdF01	CATTTTCHACTAAYCATAARGATATTGG	Dabert et al. 2010
COI	Reverse	bcdR04	TATAAACYTCDGGATGNCCAAAAAA	Dabert et al. 2008
ITS-2	Forvard	ITS2_Eutar_Ff	CGTAACGTGAATTGCAGGAC	Stec et al. 2018
ITS-2	Reverse	ITS2_Eutar_Rr	TGATATGCTTAAGTTCAGCGG	Stec et al. 2018
28S rRNA	Forvard	28SF0001	ACCCVCYNAATTTAAGCATAT	Mironov et al. 2012
28S rRNA	Reverse	28SR0990	CCTTGGTCCGTGTTTCAAGAC	Mironov et al. 2012

Table 2.

Download as

CSV

XLSX

PCR cocktails used for the amplification of DNA fragments.

Component	Concentration	Additional note
H₂O	–	sterile MQ
buffer	1×	5X Phusion HF Buffer; Thermo Scientific
dNTPs	200 µM	dNTP Mix; Thermo Scientific
forward primer	0.5 µM	–
reverse primer	0.5 µM	–
polymerase	0.02 U/µl	Phusion High-Fidelity DNA Polymerase; Thermo Scientific
DNA	–	–

Table 3.

Download as

CSV

XLSX

PCR programmes used for the amplification of COI, ITS-2 and 28S rRNA.

Step	COI			ITS-2 and 28S rRNA
Step	Cycles	Time [min.:sec.]	Temp. [°C]	Cycles	Time [min:sec]	Temp. [°C]
initial denaturation	–	05:00	98	–	05:00	98
denaturation	5	00:30	98	–	–	–
annealing		00:30	45	–	–	–
extension		01:00	72	–	–	–
denaturation	30	00:30	98	35	00:30	98
annealing		00:30	50		00:30	50
extension		01:00	72		01:00	72
final extension	–	07:00	72	–	07:00	72

Comparative molecular analysis

In the first step, the sequences of Mil. wrightae sp. nov. and Mil. matheusi sp. nov. were analysed by Standard Nucleotide BLAST to confirm their uniqueness. Then, a comparison was performed with COI, ITS-2 and 28S rRNA sequences of the genus Milnesium, deposited in GenBank, using only the sequences of good quality and length. All sequences were aligned with the ClustalW Multiple Alignment tool (Thompson et al. 1994) implemented in BioEdit and trimmed to 510 (COI), 184 (ITS-2), 625 (28S rRNA) bp, respectively. Based on the recommendation of Srivathsan and Meier (2012), pairwise distances were calculated using MEGA7 in preference to the genetic distances corrected by the Kimura 2 parametric model (K2P). All positions with less than 95% site coverage were eliminated.

Results

Taxonomic account

Phylum Tardigrada Doyère, 1840

Class Apotardigrada (Schuster, Nelson, Grigarick & Christenberry, 1980)

Order Apochela Schuster, Nelson, Grigarick & Christenberry, 1980

Family Milnesiidae Ramazzotti, 1962

Genus Milnesium Doyère, 1840

Milnesium matheusi sp. nov.

http://zoobank.org/3EB072A7-1C84-4EF6-B6D2-D9486BBF6C4F

Figures 1–3, 4–5, Tables 4, 5

Material examined

Holotype and 18 paratypes, all from sample No 139: Ivohibory forest, Madagascar, lichen sample from quartz rocks, coll. Marta Kepel and Andrzej Kepel.

Description

Adult females (Fig. 1, Table 4) with no modified claws I. Body light yellow before fixation and transparent afterwards, eyes present (in 89% of measured specimens). Dorsal cuticle sculptured with pseudopores, not arranged in bands, sparsely distributed and not forming a reticular design (Fig. 2). Six peribuccal papillae and six peribuccal lamellae present around the mouth opening. Two cephalic papillae positioned laterally. Peribuccal papillae slightly longer than lateral papillae.

The buccal apparatus of the Milnesium type (Figs 1, 3). The buccal tube wide and short (standard width, on average 46% of its length), and slightly funnel-shaped, wider anteriorly (posterior diameter on average 89% of the anterior diameter) (Table 4). The pharyngeal bulb elongated, pear-shaped and without placoids or septulum.

Figures 1–3.

Milnesium matheusi sp. nov. 1 Habitus (ventral view) (holotype) 2 dorsal cuticle with pseudopores (holotype) 3 buccal tube (holotype). All in PCM.

Table 4.

Download as

CSV

XLSX

Measurements and pt values of selected morphological structures of adult females of Milnesium matheusi sp. nov. mounted in Hoyer’s medium (N – number of specimens/structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD – standard deviation, pt – ratio of the length of a given structure to the length of the buccal tube expressed as a percentage).

Character	N	Range						Mean		SD		Holotype
Character	N	µm			pt			µm	pt	µm	pt	µm	pt
Body length	6	630	–	766	–	–	–	691	–	45	–	766	–
Peribuccal papillae length	5	10.0	–	12.0	18.6	–	22.1	11.0	19.9	0.8	1.5	11.8	18.9
Lateral papillae length	7	9.4	–	10.7	16.5	–	19.7	10.0	18.1	0.4	1.2	10.3	16.5
Buccal tube
Length	9	51.3	–	62.5	–	–	–	56.6	–	3.8	–	62.5	–
Stylet support insertion point	9	34.5	–	42.3	66.1	–	69.4	38.4	67.8	2.4	1.3	41.5	66.4
Anterior width	9	25.2	–	35.9	47.6	–	57.9	28.9	51.0	3.2	3.1	31.4	50.2
Standard width	9	23.1	–	31.1	42.4	–	50.8	26.3	46.5	2.7	3.0	29.4	47.0
Posterior width	9	23.0	–	30.2	41.1	–	50.3	25.7	45.3	2.6	3.1	28.9	46.2
Standard width/length ratio	9	42%	–	51%	–	–	–	46%	–	3%	–	47%	–
Posterior/anterior width ratio	9	84%	–	94%	–	–	–	89%	–	4%	–	92%	–
Claw 1 lengths
External primary branch	9	17.2	–	21.8	30.2	–	35.2	18.9	33.3	1.5	1.6	21.8	34.9
External base + secondary branch	9	13.3	–	16.7	23.5	–	27.9	15.0	26.5	1.2	1.5	16.6	26.6
External spur	7	3.5	–	5.3	6.4	–	9.6	4.4	7.8	0.7	1.3	?	?
External branches length ratio	9	76%	–	82%	–	–	–	80%	–	2%	–	76%	–
Internal primary branch	9	16.0	–	21.1	30.2	–	34.5	18.3	32.3	1.6	1.6	21.1	33.8
Internal base + secondary branch	9	13.3	–	16.6	24.5	–	27.3	14.8	26.2	1.1	1.0	16.3	26.1
Internal spur	9	3.3	–	5.5	6.1	–	10.5	4.4	7.7	0.8	1.4	5.5	8.8
Internal branches length ratio	9	77%	–	88%	–	–	–	81%	–	4%	–	77%	–
Claw 2 lengths
External primary branch	8	17.4	–	21.2	32.9	–	36.5	19.5	34.9	1.4	1.4	21.2	33.9
External base + secondary branch	7	13.7	–	17.0	24.5	–	27.5	15.0	26.7	1.1	1.2	17.0	27.2
External spur	3	3.9	–	4.9	7.2	–	7.8	4.4	7.6	0.5	0.4	4.9	7.8
External branches length ratio	7	72%	–	81%	–	–	–	77%	–	3%	–	80%	–
Internal primary branch	8	16.8	–	20.5	31.1	–	35.7	18.7	33.3	1.3	1.5	20.2	32.3
Internal base + secondary branch	9	13.0	–	16.3	25.0	–	27.9	14.7	26.0	1.1	0.9	16.3	26.1
Internal spur	9	3.4	–	5.8	6.1	–	10.3	4.4	7.8	0.8	1.5	4.7	7.5
Internal branches length ratio	8	74%	–	81%	–	–	–	78%	–	3%	–	81%	–
Claw 3 lengths
External primary branch	5	19.7	–	21.0	32.3	–	38.3	20.5	35.7	0.6	2.5	?	?
External base + secondary branch	6	14.2	–	16.3	24.5	–	28.4	15.4	27.1	0.7	1.5	?	?
External spur	5	3.5	–	5.2	6.4	–	9.3	4.4	7.7	0.7	1.1	?	?
External branches length ratio	5	72%	–	82%	–	–	–	75%	–	4%	–	?	–
Internal primary branch	5	18.9	–	20.4	31.3	–	36.5	19.7	34.3	0.6	2.0	?	?
Internal base + secondary branch	6	13.7	–	16.0	23.7	–	28.2	14.9	26.2	0.8	1.9	?	?
Internal spur	5	3.8	–	5.6	7.0	–	9.7	4.8	8.3	0.7	1.1	?	?
Internal branches length ratio	5	70%	–	79%	–	–	–	75%	–	4%	–	?	–
Claw 4 lengths
Anterior primary branch	7	19.6	–	23.0	35.1	–	39.8	20.9	37.2	1.3	1.5	23.0	36.8
Anterior base + secondary branch	7	14.6	–	17.2	26.3	–	29.4	15.8	28.2	0.9	1.1	17.2	27.5
Anterior spur	6	4.1	–	6.3	7.5	–	11.5	5.4	9.7	0.9	1.6	6.0	9.6
Anterior branches length ratio	7	71%	–	80%	–	–	–	76%	–	4%	–	75%	–
Posterior primary branch	7	20.5	–	24.0	38.1	–	41.3	21.8	38.9	1.1	1.1	24.0	38.4
Posterior base + secondary branch	7	15.2	–	17.7	26.9	–	29.6	16.1	28.6	0.8	1.0	17.7	28.3
Posterior spur	7	4.4	–	5.8	7.6	–	10.3	5.2	9.3	0.6	1.1	5.5	8.8
Posterior branches length ratio	7	70%	–	76%	–	–	–	74%	–	2%	–	74%	–

Claws of the Milnesium type, slender (Figs 4, 5). Primary branches on all legs with small, but distinct accessory points detaching from the branch at its greatest curvature (Fig. 5, arrowhead). Secondary branches with rounded basal thickenings (Figs 4, 5). All secondary branches on all legs with three points (claw configuration: [3-3]–[3-3]). Single, long transverse, cuticular bars present under claws I–III (Fig. 4, arrow).

Figures 4, 5.

Milnesium matheusi sp. nov. 4 Claws II (paratype), arrow indicates bar under claw 5 claws IV (holotype), arrowhead indicates small accessory point. All in PCM.

Adult males (Table 5) with modified claws I. Similar to females but clearly smaller, with secondary branches of claws I modified into strong hooks and with a different proportion of peribuccal and lateral papillae length (peribuccal papillae clearly shorter than lateral), eyes present only in 33% of measured specimens.

Eggs oval, smooth and deposited in the exuvium as in all other known Milnesium species.

Table 5.

Download as

CSV

XLSX

Measurements and pt values of selected morphological structures of adult males (with modified claws I) of Milnesium matheusi sp. nov. mounted in Hoyer’s medium (N – number of specimens/structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD – standard deviation, pt – ratio of the length of a given structure to the length of the buccal tube expressed as a percentage).

Character	N	Range						Mean		SD
Character	N	µm			pt			µm	pt	µm	pt
Body length	2	409	–	428	–	–	–	419	–	13	–
Peribuccal papillae length	3	3.0	–	3.9	8.9	–	11.3	3.5	10.2	0.5	1.2
Lateral papillae length	3	5.6	–	6.0	16.2	–	17.8	5.9	17.1	0.2	0.8
Buccal tube
Length	3	33.8	–	34.5	–	–	–	34.2	–	0.4	–
Stylet support insertion point	2	21.2	–	22.3	62.7	–	64.6	21.8	63.7	0.8	1.4
Anterior width	3	9.4	–	11.2	27.8	–	32.6	10.5	30.8	1.0	2.6
Standard width	3	9.1	–	9.8	26.9	–	28.5	9.5	27.8	0.4	0.8
Posterior width	3	9.4	–	10.2	27.8	–	29.6	9.8	28.7	0.4	0.9
Standard width/length ratio	3	27%	–	28%	–	–	–	28%	–	1%	–
Posterior/anterior width ratio	3	88%	–	100%	–	–	–	94%	–	6%	–
Claw 1 lengths
External primary branch	2	15.8	–	16.3	45.9	–	48.2	16.1	47.1	0.4	1.6
External base + secondary branch	3	14.1	–	15.0	41.7	–	43.5	14.6	42.7	0.5	0.9
External spur	2	3.2	–	3.4	9.3	–	9.9	3.3	9.6	0.1	0.4
External branches length ratio	2	87%	–	94%	–	–	–	90%	–	5%	–
Internal primary branch	3	14.9	–	15.7	43.2	–	46.4	15.4	45.1	0.5	1.7
Internal base + secondary branch	3	14.0	–	14.5	40.6	–	42.9	14.2	41.4	0.3	1.3
Internal spur	3	3.0	–	3.7	8.9	–	10.7	3.4	9.9	0.4	0.9
Internal branches length ratio	3	89%	–	94%	–	–	–	92%	–	2%	–
Claw 2 lengths
External primary branch	2	16.9	–	17.9	49.0	–	53.0	17.4	51.0	0.7	2.8
External base + secondary branch	1	13.2	–	13.2	39.1	–	39.1	13.2	39.1	?	?
External spur	1	3.5	–	3.5	10.4	–	10.4	3.5	10.4	?	?
External branches length ratio	1	74%	–	74%	–	–	–	74%	–	?	–
Internal primary branch	3	16.4	–	16.9	47.5	–	50.0	16.7	48.8	0.3	1.2
Internal base + secondary branch	2	12.7	–	12.8	37.2	–	37.6	12.8	37.4	0.1	0.3
Internal spur	2	3.5	–	5.0	10.4	–	14.5	4.3	12.4	1.1	3.0
Internal branches length ratio	2	75%	–	76%	–	–	–	76%	–	1%	–
Claw 3 lengths
External primary branch	3	16.2	–	17.4	47.1	–	51.5	16.8	49.0	0.6	2.3
External base + secondary branch	2	12.1	–	12.8	35.2	–	37.9	12.5	36.5	0.5	1.9
External spur	1	3.9	–	3.9	11.3	–	11.3	3.9	11.3	?	?
External branches length ratio	2	74%	–	75%	–	–	–	74%	–	1%	–
Internal primary branch	3	14.8	–	17.0	43.0	–	50.3	16.0	46.7	1.1	3.6
Internal base + secondary branch	2	12.7	–	13.0	37.6	–	37.8	12.9	37.7	0.2	0.2
Internal spur	2	2.9	–	4.0	8.4	–	11.8	3.5	10.1	0.8	2.4
Internal branches length ratio	2	75%	–	88%	–	–	–	81%	–	9%	–
Claw 4 lengths
Anterior primary branch	3	16.3	–	17.0	47.4	–	49.3	16.6	48.5	0.4	1.0
Anterior base + secondary branch	2	12.4	–	12.9	36.7	–	37.5	12.7	37.1	0.4	0.6
Anterior spur	1	3.8	–	3.8	11.0	–	11.0	3.8	11.0	?	?
Anterior branches length ratio	2	75%	–	79%	–	–	–	77%	–	3%	–
Posterior primary branch	3	17.7	–	18.8	51.3	–	54.7	18.3	53.4	0.6	1.8
Posterior base + secondary branch	3	12.7	–	13.7	37.1	–	39.8	13.1	38.2	0.6	1.5
Posterior spur	2	3.0	–	4.1	8.7	–	11.9	3.6	10.3	0.8	2.3
Posterior branches length ratio	3	69%	–	73%	–	–	–	72%	–	2%	–

DNA sequences

We obtained good quality sequences for the applied molecular markers: 28S rRNA sequence (GenBank: MN191503), 756 bp long; COI sequence (GenBank: MN187056), 628 bp long; ITS-2 sequence (GenBank: MN239906), 218 bp long.

Type locality

Madagascar, 22°37'07.7"S, 46°43'14.5"E, ca. 1187 m asl, Fianarantsoa Province, Ivohibory forest.

Etymology

The second author with great pleasure dedicates this species to her fiance – Mateusz Wojciechowski.

Type depositories

The holotype and 13 paratypes (slides: MAD139/14, MAD139/16, MAD139/18, MAD139/19, MAD139/34, MAD139/35, MAD139/42, MAD139/56, MAD139/72) are deposited at the Department of Animal Taxonomy and Ecology, Adam Mickiewicz University in Poznań, Uniwersytetu Poznańskiego 6, Poznań, Poland; five paratypes (slides: MAD139/12, MAD139/13, MAD139/15) are deposited at the Natural History Museum, University of Copenhagen, Universitetsparken 15, DK-2100 Copenhagen, Denmark.

Morphological differential diagnosis

The new species with three points on the secondary branches of all claws (claw configuration [3-3]–[3-3]) and a rather wide buccal tube, in relation to its length, is most similar to: Mil. beatae Roszkowska, Ostrowska & Kaczmarek, 2015, Mil. bohleberi Bartels, Nelson, Kaczmarek & Michalczyk, 2014, Mil. eurystomum Maucci, 1991, Mil. shilohae Meyer, 2015 and Mil. tumanovi Pilato, Sabella & Lisi, 2016, but it differs from:

1. Milnesium beatae, only reported from Argentina and USA (Roszkowska et al. 2015; Tibbs et al. 2016) by: narrower buccal tube (25.2–35.9 [47.6–57.9] and 23.1–31.1 [42.4–50.8] anterior and standard width, respectively, in the new species vs. 37.0–53.5 [70.3–78.9] and 32.0–42.5 [58.1–65.6] anterior and standard width respectively in Mil. beatae), smaller standard width/length ratio of the buccal tube (42%–51% in new species vs. 58%–66% in Mil. beatae) and larger posterior/anterior width ratio (84%–94% in new species vs. 69%–76% in Mil. beatae).

2. Milnesium bohleberi, only recorded from North Carolina and Tennessee (USA) (Bartels et al. 2014) by: presence of pseudopores on dorsal cuticle, shorter peribuccal papillae (10.0–12.0 [18.6–22.1] in new species vs. 15.5–20.3 [27.2–32.3] in Mil. bohleberi), smaller pt values of anterior, standard and posterior widths of the buccal tube (47.6–57.9, 42.4–50.8, 41.1–50.3, respectively, in new species vs. 63.4–74.7, 54.5–64.0, 52.4–62.0, respectively, in Mil. bohleberi), smaller standard width/length ratio of the buccal tube (42%–51% in new species vs. 54%–64% in Mil. bohleberi) and slightly shorter claws (see Table 4 below and Bartels et al. (2014: Table 1) for the exact differences in claw dimensions).

3. Milnesium eurystomum reported from a few localities in Argentina, Chile, Greenland, Mongolia and USA (see review by Kaczmarek et al. 2016) by: shorter buccal tube (51.3–62.5 in new species vs. 70.8–77.5 in Mil. eurystomum), stylet supports inserted in a more posterior position (pt = 66.1–69.4 in new species vs. ca. pt = 60.0–60.3 in Mil. eurystomum), narrower buccal tube (25.2–35.9 [47.6–57.9], 23.1–31.1 [42.4–50.8] and 23.0–30.2 [41.1–50.3] anterior, standard and posterior width, respectively, in new species vs. 53.7–55.9 [72.1–75.8], 45.9–47.9 [61.8–64.8] and 33.9–41.0 [43.7–57.9] anterior, standard and posterior width, respectively, in Mil. eurystomum), smaller standard width/length ratio of the buccal tube (42%–51% in new species vs. 62%–65% in Mil. eurystomum) and larger posterior/anterior width ratio (84%–94% in new species vs. 61%–76% in Mil. eurystomum).

4. Milnesium shilohae, only reported from the type locality in Hawaii (USA) (Meyer 2015) by: presence of pseudopores on dorsal cuticle, presence of similar in length spurs on internal and external claws (internal and posterior spurs larger than external and anterior spurs in Mil. shilohae), slightly longer lateral papillae (9.4–10.7 in new species vs. 5.0–9.0 in Mil. shilohae), slightly longer buccal tube (51.3–62.5 in new species vs. 38.4–50.3 in Mil. shilohae), stylet supports inserted in a more anterior position (pt = 66.1–69.4 in new species vs. pt = 75.5–77.5 in Mil. shilohae) and larger spurs on some external and anterior claws (see Table 4 below and Table 3 in Meyer (2015) for the exact differences in claw dimensions).

5. Milnesium tumanovi, only recorded from the type locality in the Crimea (Ukraine) (Pilato et al. 2016) by: presence of pseudopores on dorsal cuticle, funnel-shaped buccal tube (cylindrical in Mil. tumanovi) and stylet supports inserted in a more posterior position (pt = 66.1–69.4 in new species vs. ca. pt = 52–54 in Mil. tumanovi).

Genotypic differential diagnosis

The ranges of uncorrected genetic p-distances between Mil. matheusi sp. nov. and species of the genus Milnesium, for which molecular marker sequences are available from GenBank (see Table 6 for details), are as follows:

Table 6.

Download as

CSV

XLSX

Sequences of 28S rRNA, COI and ITS-2 of Milnesium taxa available in GenBank and used in differential diagnosis.

DNA marker	Taxon	Accession number	Source
28S rRNA	Milnesium sp.	JX888585.1	Adams et. al. unpublished
		JX888586.1	Adams et. al. unpublished
		JX888587.1	Adams et. al. unpublished
	Milnesium tardigradum	JX888541.1	Adams et. al. unpublished
		JX888540.1	Adams et. al. unpublished
		KC138808.1	Zawierucha unpublished
		KC138809.1	Zawierucha unpublished
	Milnesium sp.	AY210826.1	Mallatt et. al. 2004
	Milnesium tardigradum	FJ435780.1	Guil and Giribet 2012
	Milnesium tardigradum	FJ435779.1	Guil and Giribet 2012
	Milnesium berladnicorum	KT951661.1	Morek et. al. 2016
	Milnesium variefidum	KT951665.1	Morek et. al. 2016
COI	Milnesium sp.	KX306950.1	Fox et al. unpublished
	Milnesium tardigradum	EU244603.1	Schill unpublished
		EU244604	Schill unpublished
		FJ435810.1	Guil and Giribet 2012
	Milnesium t. tardigradum	JN664950.1	Michalczyk et al. 2012
	Milnesium cf. tardigradum	JX683824.1	Vicente et al. 2013
		JX683823.1	Vicente et al. 2013
		JX683822.1	Vicente et al. 2013
	Milnesium sp.	KJ857002.1	Velasco-Castrillón et al. 2015
	Milnesium sp.	KJ857001.1	Velasco-Castrillón et al. 2015
	Milnesium cf. alpigenum	KU513422.1	Kosztyła et al. 2016
	Milnesium variefidum	KT951663.1	Morek et al. 2016
	Milnesium berladnicorum	KT951659.1	Morek et al. 2016
	Milnesium sp.	EF632553.1	Sands et. al unpublished
	Milnesium cf. granulatum	MH751517.1	Jackson and Meyer 2019
	Milnesium lagniappe	MH751518.1	Jackson and Meyer 2019
	Milnesium tardigradum	MG923558.1	Morek et al. 2019
		MG923559.1	Morek et al. 2019
		MG923560.1	Morek et al. 2019
		MG923561.1	Morek et al. 2019
		MG923562.1	Morek et al. 2019
		MG923563.1	Morek et al. 2019
		MG923564.1	Morek et al. 2019
		MG923565.1	Morek et al. 2019
	Milnesium dornensis	MG923566.1	Morek et al. 2019
ITS-2	Milnesium alpigenum	MH000382.1	Morek et al. unpublished
	Milnesium sp.	MH000386.1	Morek et al. unpublished
	Milnesium sp.	MH000387.1	Morek et al. unpublished
	Milnesium tardigradum	HM150648.2	Wełnicz et. al. 2010
		GQ403682.1	Schill et al. 2010
		GQ403681.1	Schill et al. 2010
	Milnesium t. tardigradum	JF951049	Michalczyk et al. 2012
	Milnesium variefidum	KT951667.1	Morek et. al. 2016
	Milnesium variefidum	KT951666.1	Morek et. al. 2016
	Milnesium berladnicorum	KT951662.1	Morek et. al. 2016
	Milnesium cf. granulatum	MK681875.1	Jackson and Meyer 2019
		MK681876.1	Jackson and Meyer 2019
		MK681877.1	Jackson and Meyer 2019
		MK681878.1	Jackson and Meyer 2019
		MK681879.1	Jackson and Meyer 2019
		MK681880.1	Jackson and Meyer 2019
		MK681881.1	Jackson and Meyer 2019
		MK681882.1	Jackson and Meyer 2019
		MK681883.1	Jackson and Meyer 2019
		MK681884.1	Jackson and Meyer 2019
		MK681885.1	Jackson and Meyer 2019
		MK681886.1	Jackson and Meyer 2019

1. 28S rRNA: 4.5–6.7% (5.4% on average), with the most similar being Milnesium sp. from North America (JX888585.1, JX888586.1, JX888587.1) (unpublished) and the least similar being Mil. wrightae sp. nov. (MN191504.1) (present studies);

2. COI: 20.1–38.8% (23.3% on average), with the most similar being Mil. variefidum Morek, Gąsiorek, Stec, Blagden & Michalczyk, 2016 from UK (KT951663.1) (Morek et al. 2016) and the least similar being Mil. t. tardigradum from Spain (FJ435810.1) (Guil and Giribet 2012);

3. ITS-2: 17.8–31.1% (23.7% on average), with the most similar being Mil. t. tardigradum from Germany (JF951049.1) (Michalczyk et al. 2012) and the least similar being Mil. cf. granulatum from USA (MK681879.1) (Jackson and Meyer 2019).

Milnesium wrightae sp. nov.

http://zoobank.org/A62CF1FF-8BDA-42D1-A090-6AE72608E529

Figures 6–8, 9–11, Table 7

Material examined

Holotype and 28 paratypes, all from sample No 109: Ivohibory forest, Madagascar, moss sample from tree, coll. Marta Kepel and Andrzej Kepel.

Description

Adult females (Fig. 6, Table 7) with no modified claws I. Body light yellow before fixation and transparent afterwards, eyes present only in 39% of measured specimens. Dorsal cuticle sculptured with pseudopores not arranged in bands, sparsely distributed and not forming reticular design (Fig. 7). Six peribuccal papillae and six peribuccal lamellae present around the mouth opening. Two cephalic papillae positioned laterally. Peribuccal papillae slightly longer than lateral papillae.

The buccal apparatus of the Milnesium type (Figs 6, 8). The buccal tube with standard width on average 62% of its length, and funnel-shaped, wider anteriorly (posterior diameter on average 91% of the anterior diameter) (Table 7). The pharyngeal bulb elongated, pear-shaped and without placoids or septulum.

Figures 6–8.

Milnesium wrightae sp. nov. 6 Habitus (ventral view) (holotype) 7 dorsal cuticle with pseudopores (holotype) 8 buccal tube (paratype). All in PCM.

Table 7.

Download as

CSV

XLSX

Measurements and pt values of selected morphological structures of females of Milnesium wrightae sp. nov. mounted in Hoyer’s medium (N – number of specimens/structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD – standard deviation, pt – ratio of the length of a given structure to the length of the buccal tube expressed as a percentage).

Character	N	Range						Mean		SD		Holotype
Character	N	µm			pt			µm	pt	µm	pt	µm	pt
Body length	17	329	–	553	–	–	–	448	–	60	–	515	–
Peribuccal papillae length	12	6.8	–	10.4	13.2	–	16.6	9.0	14.9	1.1	1.0	9.3	15.3
Lateral papillae length	8	5.1	–	8.4	10.0	–	13.0	6.7	11.3	1.0	0.9	6.1	10.0
Buccal tube
Length	17	44.8	–	65.6	–	–	–	58.4	–	6.5	–	60.9	–
Stylet support insertion point	15	31.2	–	45.8	69.3	–	73.2	40.8	70.6	4.7	1.1	43.9	72.1
Anterior width	16	14.0	–	23.0	29.5	–	37.9	19.0	32.7	2.5	2.4	20.1	33.0
Standard width	14	13.0	–	20.7	27.5	–	36.4	17.7	31.0	2.3	2.6	19.8	32.5
Posterior width	14	12.7	–	20.1	26.6	–	33.5	16.9	29.6	2.2	2.3	18.9	31.0
Standard width/length ratio	14	28%	–	36%	–	–	–	31%	–	3%	–	33%	–
Posterior/anterior width ratio	14	88%	–	97%	–	–	–	91%	–	3%	–	94%	–
Claw 1 lengths
External primary branch	16	11.0	–	15.2	19.5	–	24.6	13.0	21.9	1.2	1.6	13.8	22.7
External base + secondary branch	15	9.6	–	14.9	19.5	–	23.4	12.6	21.2	1.4	1.0	13.8	22.7
External spur	7	2.8	–	3.7	4.7	–	5.6	3.2	5.2	0.3	0.3	?	?
External branches length ratio	14	87%	–	103%	–	–	–	97%	–	5%	–	100%	–
Internal primary branch	16	10.9	–	14.0	19.4	–	24.6	12.4	20.9	0.9	1.4	12.7	20.9
Internal base + secondary branch	16	9.0	–	14.0	18.9	–	21.7	12.1	20.4	1.4	0.8	12.8	21.0
Internal spur	13	2.8	–	3.6	4.7	–	6.5	3.1	5.2	0.3	0.5	3.2	5.3
Internal branches length ratio	15	83%	–	103%	–	–	–	98%	–	7%	–	101%	–
Claw 2 lengths
External primary branch	15	10.6	–	15.3	20.5	–	26.0	13.3	22.4	1.2	1.5	14.6	24.0
External base + secondary branch	14	9.3	–	13.7	18.8	–	21.5	12.2	20.5	1.4	0.7	12.5	20.5
External spur	8	3.1	–	4.1	4.9	–	6.7	3.4	5.5	0.3	0.6	4.1	6.7
External branches length ratio	13	78%	–	103%	–	–	–	92%	–	7%	–	86%	–
Internal primary branch	14	10.9	–	15.0	19.2	–	24.3	12.5	21.3	1.1	1.7	13.5	22.2
Internal base + secondary branch	15	9.0	–	14.2	18.0	–	22.3	12.1	20.2	1.5	1.0	12.9	21.2
Internal spur	12	2.6	–	4.6	4.3	–	6.9	3.4	5.7	0.6	0.7	3.7	6.1
Internal branches length ratio	13	82%	–	103%	–	–	–	95%	–	8%	–	96%	–
Claw 3 lengths
External primary branch	17	10.8	–	15.2	19.0	–	26.5	13.2	22.6	1.4	1.7	?	?
External base + secondary branch	16	9.5	–	15.7	19.1	–	24.7	12.0	20.7	1.6	1.4	?	?
External spur	7	3.0	–	4.0	4.9	–	6.8	3.3	5.5	0.4	0.7	?	?
External branches length ratio	16	79%	–	103%	–	–	–	92%	–	6%	–	?	–
Internal primary branch	17	10.7	–	14.1	19.2	–	25.0	12.4	21.3	1.1	1.7	?	?
Internal base + secondary branch	16	9.0	–	14.1	17.8	–	21.8	11.5	19.7	1.5	1.1	?	?
Internal spur	10	2.4	–	4.0	4.1	–	6.8	3.3	5.7	0.5	0.9	?	?
Internal branches length ratio	16	80%	–	102%	–	–	–	93%	–	7%	–	?	–
Claw 4 lengths
Anterior primary branch	12	12.6	–	18.4	23.7	–	28.9	15.2	25.8	1.6	1.9	15.8	25.9
Anterior base + secondary branch	12	11.2	–	17.4	22.6	–	27.5	14.7	25.0	1.8	1.6	16.5	27.1
Anterior spur	7	2.7	–	5.2	5.6	–	8.2	3.7	6.3	0.8	0.9	4.2	6.9
Anterior branches length ratio	11	85%	–	104%	–	–	–	97%	–	6%	–	104%	–
Posterior primary branch	12	11.7	–	20.0	23.7	–	31.4	16.0	27.3	2.2	2.0	17.5	28.7
Posterior base + secondary branch	11	12.1	–	18.5	24.0	–	28.9	15.6	26.5	2.2	1.8	17.5	28.7
Posterior spur	7	2.9	–	5.2	5.3	–	8.2	3.8	6.7	0.9	1.0	4.4	7.2
Posterior branches length ratio	10	92%	–	103%	–	–	–	98%	–	4%	–	100%	–

Claws of the Milnesium type, stout (Figs 8–11). Primary branches on all legs with small, but distinct accessory points detaching from the branch at its greatest curvature (Fig. 10, empty arrowhead). Secondary branches of claws similar in length to primary branches and sometimes even longer. Secondary branches with rounded basal thickenings (Figs 9–11). Secondary branches on legs I–III with three points, secondary claws of anterior and posterior claws IV with four points (claw configuration: [3-3]–[4-4]). The fourth point on secondary branches is always very small and located near the base of the claw (Figs 10–11, arrowheads). Single, long transverse, cuticular bars present under claws I–III (Fig. 9, arrow).

Figures 9–11.

Milnesium wrightae sp. nov. 9 Claws I (paratype), arrow indicates bar under claw 10 claws IV (holotype), empty arrowhead indicates small accessory point, filled arrowheads indicate the fourth points on secondary branches near the base of the claw 11 focus on the fourth points on secondary branches near the base of the claw IV (holotype, filled arrowheads). All in PCM.

Males unknown.

Eggs oval, smooth and deposited in the exuvium as in all other known Milnesium species.

DNA sequences

We obtained good quality sequences for the applied molecular markers: 28S rRNA sequence (GenBank: MN191504), 638 bp long; COI sequence (GenBank: MN187057), 638 bp long; ITS-2 sequence (GenBank: MN239907), 392 bp long.

Remarks

The fourth points on secondary branches of posterior claws can be barely visible or not visible at all in some positions of the specimens.

Type locality

Madagascar, 22°37'04.5"S, 46°43'14.1"E, ca. 1198 m asl, Fianarantsoa Province, Ivohibory forest.

Etymology

This species is named after Patricia Chapple Wright, an American primatologist and conservationist, best known for her studies on lemurs. She contributed to the establishment of the Ranomafana National Park in Madagascar. She also organized and led the expedition to the Ivohibory forest, during which several new species of tardigrades were found, including this species.

Type depositories

The holotype and 23 paratypes (slides: MAD109/1, MAD109/3, MAD109/4, MAD109/5, MAD109/7) are deposited at the Department of Animal Taxonomy and Ecology, Adam Mickiewicz University in Poznań, Uniwersytetu Poznańskiego 6, Poznań, Poland, five paratypes (slides: MAD109/2) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9,30-387, Kraków, Poland.

Morphological differential diagnosis

The new species, by the presence of four points on secondary branches of claws IV, is most similar to Mil. quadrifidum Nederström, 1919, which is the only valid Milnesium species with four points on secondary branches of all claws. However, Mil. wrightae sp. nov. differs from Mil. quadrifidum not only by claw configuration ([4-4]–[4-4] in Mil. quadrifidum vs. [3-3]–[4-4] in Mil. wrightae sp. nov.), but also by the position of fourth points on secondary branches of claws IV (located near the base of the claw in the new species vs. near the top of the claw in Mil. quadrifidum). Additionally, all secondary branch points have similar length in Mil. quadrifidum, whereas the fourth points are very clearly smaller than the others in Mil. wrightae sp. nov.

Genotypic differential diagnosis

The ranges of uncorrected genetic p-distances between the Mil. wrightae sp. nov. and species of the genus Milnesium, for which molecular marker sequences are available from GenBank (see Table 6 for details), are as follows:

1. 28S rRNA: 5.7–8.0% (6.7% on average), with the most similar being Milnesium sp. from North America (JX888585.1, JX888586.1, JX888587.1) (unpublished) and the least similar being Mil. t. tardigradum from Poland (KC138808.1 and KC138809.1) (unpublished);

2. COI: 17.7–38.4% (22.0 % on average), with the most similar being Mil. variefidum from UK (KT951663.1) (Morek et al. 2016) and the least similar being Mil. t. tardigradum from Spain (FJ435810.1) (Guil and Giribet 2012);

3. ITS-2: 25.6–36.3% (31.5% on average), with the most similar being Mil. matheusi sp. nov. (present studies) and the least similar being Mil. cf. granulatum from USA (MK681879.1) (Jackson and Meyer 2019).

Conclusions

Milnesium matheusi sp. nov. and Mil. wrightae sp. nov. are new for science taxa, based on morphological as well as molecular characteristics. Until now, five Milnesium taxa have been reported from the African region, including Madagascar (i.e. Mil. dornensis, Mil. matheusi sp. nov. Mil. tardigradum s.s., Mil. tetralamellatum and Mil. wrightae sp. nov.). The presence of Mil. tardigradum s.s. in Madagascar needs confirmation and currently this record should be considered dubious.

Acknowledgements

Field study was the result of the collaboration and support of many people and institutions, especially ICTE/MICET in Antatananarivo and Centre ValBio in Ranomafana (Madagascar). The main funding for the expedition was obtained from the National Geographic Society’s Committee (USA) for Research and Exploration and Rainforest Trust exploratory grants.

The study was conducted on the basis of the authorization No. 122/17/MEEF/SG/DGF/DSAP/SCB.Re of Le Ministère de l’Environnement, de l’Ecologie et des Forêts (MEEF) of the Republic of Madagascar. Export of samples from Madagascar was authorized with the MEEF permit No 150N-EV06/MG17.

Studies (excluding field research) have been conducted in the framework of activities of BARg (Biodiversity and Astrobiology Research group at Adam Mickiewicz University, Poznań, Poland).

Milena Roszkowska is a scholarship holder of the AMU Foundation for the academic year 2018/2019.

References

Bartels PJ, Nelson DR, Kaczmarek Ł, Michalczyk Ł (2014) The genus Milnesium (Tardigrada: Eutardigrada: Milnesiidae) in the Great Smoky Mountains National Park (North Carolina and Tennessee, USA), with the description of Milnesium bohleberi sp. nov. Zootaxa 3826(2): 356–368. https://doi.org/10.11646/zootaxa.3826.2.5

Beasley CW (1995) The phylum Tardigrada [Third Edition by G. Ramazzotti and W. Maucci, English Translation]. Published by the translator Clark Beasley, Abilene, 1014 pp.

Bertolani R, Guidetti R, Marchioro T, Altiero T, Rebecchi L, Cesari M (2014) Phylogeny of Eutardigrada: New molecular data and their morphological support lead to the identification of new evolutionary lineages. Molecular Phylogenetics and Evolution 76: 110–126. https://doi.org/10.1016/j.ympev.2014.03.006

Binda MG, Guglielmino A (1991) Tardigradi dell’Africa. VI: Macrobiotus polygonatus nuova specie di Eutardigrado del Kilimangiaro (Tanzania). Animalia 18: 223–227. http://hdl.handle.net/2067/2225

Buerki S, Devey DS, Callmander MW, Phillipson PB, Forest F (2013) Spatio-temporal history of the endemic genera of Madagascar. Botanical Journal of the Linnaean Society 171: 304–329. https://doi.org/10.1111/boj.12008

Callmander MW, Phillipson PB, Andriambololonera S, Rabarimanarivo M, Rakotonirina N, Raharimampionona J, Chatelain C, Gautier L, Lowry II PP (2011) The endemic and non-endemic vascular flora of Madagascar updated. Plant Ecology and Evolution 144: 121–125. https://doi.org/10.5091/plecevo.2011.513

Casquet J, Thebaud C, Gillespie RG (2012) Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Molecular Ecology Resources 12: 136–141. https://doi.org/10.1111/j.1755-0998.2011.03073.x

Ciobanu DA, Roszkowska M, Kaczmarek Ł (2015) Two new tardigrade species from Romania (Eutardigrada: Milnesiidae, Macrobiotidae), with some remarks on secondary sex characters in Milnesium dornensis sp. nov. Zootaxa 3941(4): 542–564. https://doi.org/10.11646/zootaxa.3941.4.4

Ciobanu DA, Zawierucha K, Moglan I, Kaczmarek Ł (2014) Milnesium berladnicorum sp. n. (Eutardigrada, Apochela, Milnesiidae), a new species of water bear from Romania. ZooKeys 429: 1–11. https://doi.org/10.3897/zookeys.429.7755

Dabert J, Ehrnsberger R, Dabert M (2008) Glaucalges tytonis sp. nov. (Analgoidea: Xolalgidae) from the barn owl Tyto alba (Strigiformes: Tytonidae): compiling morphology with DNA barcode data for taxa descriptions in mites (Acari). Zootaxa 1719: 41–52. http://www.mapress.com/zootaxa/2008/f/zt01719p052.pdf

Dabert M, Witalinski W, Kazmierski A, Olszanowski Z, Dabert J (2010) Molecular phylogeny of acariform mites (Acari, Arachnida): strong conflict between phylogenetic signal and long-branch attraction artifacts. Molecular Phylogenetic and Evolution 56(1): 222–241. https://doi.org/10.1016/j.ympev.2009.12.020

de Witt MJ (2003) Madagascar: Heads It’s a Continent, Tails It’s an Island, Annual Review of Earth and Planetary Science 31: 213–248. https://doi.org/10.1146/annurev.earth.31.100901.141337

Degma P, Guidetti R (2007) Notes to the current checklist of Tardigrada. Zootaxa 1579: 41–53. https://doi.org/10.11646/zootaxa.1579.1.2

Degma P, Bertolani R, Guidetti R (2009–2018) Actual checklist of Tardigrada species. [Version 34: Edition: 30-06-2018] http://www.tardigrada.modena.unimo.it/miscellanea/Actual%20checklist%20of%20Tardigrada.pdf

Doyère M (1840) Memoire sur les tardigrades. Annales des Sciences Naturelles. Zoologie Series 2.14: 269–362.

Du Puy DJ, Moat J (1996) A refined classification of the primary vegetation of Madagascar based on the underlying geology: using GIS to map its distribution and to assess its conservation status. In: Lourenço WR (Ed.) Proceedings of the International Symposium on the 'Biogeography de Madagascar', Paris (France), September 1995. Editions de l’ORSTOM, Paris, 205–218.

Ehrenberg CG (1853) Diagnoses novarum formarum. Verhandlungen der Königlichen Preussische der Akademie Wissenschaften zu Berlin 8: 526–533.

Goodman SM, Benstead JP (2003) The Natural History of Madagascar. Journal of Mammalogy 84(4): 813–814. https://doi.org/10.1644/1545-1542(2004)085%3C0813:BR%3E2.0.CO;2

Guidetti R, Bertolani R (2005) Tardigrade taxonomy: an updated check list of the taxa and a list of characters for their identification. Zootaxa 845: 1–46. https://doi.org/10.11646/zootaxa.845.1.1

Guil N, Giribet G (2012) A comprehensive molecular phylogeny of tardigrades adding genes and taxa to a poorly resolved phylum-level phylogeny. Cladistics 28(1): 21–49. https://doi.org/10.1111/j.1096-0031.2011.00364.x

Guil N, Jorgensen A, Kristensen R (2019) An upgraded comprehensive multilocus phylogeny of the Tardigrada tree of life. Zoologica Scripta 48: 120–137. https://doi.org/10.1111/zsc.12321

Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. http://brownlab.mbio.ncsu.edu/JWB/papers/1999Hall1.pdf

Hong-Wa C, Besnard G (2013) Intricate patterns of phylogenetic relationships in the olive family as inferred from multi-locus plastid and nuclear DNA sequence analyses: a close-up on Chionanthus and Noronhia (Oleaceae). Molecular Phylogenetic and Evolution 67(2): 367–378. https://doi.org/10.1016/j.ympev.2013.02.003

Iharos G (1966) Neue Tardigraden-arten aus Ungarn. Acta Zoologica Academiae Scientiarum Hungaricae 12: 111–122.

Jackson KJA, Meyer HA (2019) Morphological and genetic analysis of Milnesium cf. granulatum (Tardigrada: Milnesiidae) from Northeastern North America. Zootaxa 4604(3): 497–510. https://doi.org/10.11646/zootaxa.4604.3.6

Kaczmarek Ł, Michalczyk Ł, McInnes SJ (2014) Annotated zoogeography of non-marine Tardigrada. Part I: Central America. Zootaxa 3763(1): 1–62. https://doi.org/10.11646/zootaxa.3763.1.1

Kaczmarek Ł, Michalczyk Ł, McInnes SJ (2015) Annotated zoogeography of non-marine Tardigrada. Part II: South America. Zootaxa 3923(1): 1–107. https://doi.org/10.11646/zootaxa.3923.1.1

Kaczmarek Ł, Michalczyk Ł, Sandra JM (2016) Annotated zoogeography of non-marine Tardigrada. Part III: North America and Greenland. Zootaxa 4203(1): 1–249. https://doi.org/10.11646/zootaxa.4203.1.1

Kosztyła P, Stec D, Morek W, Gąsiorek P, Zawierucha K, Michno K, Ufir K, Małek D, Hlebowicz K, Laska A, Dudziak M, Frohme M, Prokop ZM, Kaczmarek Ł, Michalczyk Ł (2016) Experimental taxonomy confirms the environmental stability of morphometric traits in a taxonomically challenging group of microinvertebrates. Zoological Journal of the Linnaean Society 178(4): 765–775. https://doi.org/10.1111/zoj.12409

Kusky TM, Toraman E, Raharimahefa T (2007) The Great Rift Valley of Madagascar: An extension of the Africa-Somali diffusive plate boundary? Gondwana Research 11(4): 577–579. https://doi.org/10.1016/j.gr.2006.11.009

Mallatt JM, Garey JR, Shultz JW (2004) Ecdysozoan phylogeny and Bayesian inference: first use of nearly complete 28S and 18S rRNA gene sequences to classify the arthropods and their kin. Molecular Phylogenetic and Evolution 31(1): 178–191. https://doi.org/10.1016/j.ympev.2003.07.013

Marley NJ, McInnes SJ, Sands CJ (2011) Phylum Tardigrada: A re-evaluation of the Parachela. Zootaxa 2819: 51–64. https://doi.org/10.11646/zootaxa.2819.1.2

Maucci W (1991) Tre nuove specie di eutardigradi della Groenlandia meridionale. Bollettino del Museo Civico di Storia Naturale di Verona 15: 279–289.

Maucci W (1993) Prime notizie su Tardigradi “terrestri” del Madagascar con descrizione di tre specie nuove. Bollettino del Museo Civico di Storia Naturale di Verona, 17: 381–392.

McInnes SJ, Michalczyk Ł, Kaczmarek Ł (2017) Annotated zoogeography of non-marine Tardigrada. Part IV: Africa. Zootaxa 4284(1): 1–74. https://doi.org/10.11646/zootaxa.4284.1.1

Meyer HA (2015) Water bears (Phylum Tardigrada) of Oceania, with the description of a new species of Milnesium. New Zealand Journal of Zoology 42(3): 173–186. https://doi.org/10.1080/03014223.2015.1062402

Michalczyk Ł, Kaczmarek Ł (2013) The Tardigrada Register: a comprehensive online data repository for tardigrade taxonomy. Journal of Limnology 72(S1): 175–181. https://doi.org/10.4081/jlimnol.2013.s1.e22

Michalczyk Ł, Wełnicz W, Frohme M, Kaczmarek Ł (2012) Redescriptions of three Milnesium Doyère, 1840 taxa (Tardigrada: Eutardigrada: Milnesiidae), including the nominal species for the genus. Zootaxa 3154: 1–20. https://doi.org/10.11646/zootaxa.3154.1.1

Miller WR, Williams S (2012) A note on a Greenland tardigrade: Milnesium eurystomum Maucci, 1991 eating an amoeba. Transactions of the Kansas Academy of Science 115: 26–27. https://doi.org/10.1660/062.115.0104

Mironov SV, Dabert J, Dabert M (2012) A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus (Passeriformes: Aegithalidae): morphological description with DNA barcode data. Zootaxa 3253: 54–61. https://doi.org/10.11646/zootaxa.3253.1.2

Morek W, Gąsiorek P, Stec D, Blagden B, Michalczyk Ł (2016) Experimental taxonomy exposes ontogenetic variability and elucidates the taxonomic value of claw configuration in Milnesium Doyère, 1840 (Tardigrada: Eutardigrada: Apochela). Contributions to Zoology 85(2): 173–200. https://doi.org/10.1163/18759866-08502003

Morek W, Stec D, Gąsiorek P, Surmacz B, Michalczyk Ł (2019) Milnesium tardigradum Doyère, 1840: The first integrative study of interpopulation variability in a tardigrade species. Journal of Zoological Systematics and Evolutionary Research 57: 1–23. https://doi.org/10.1111/jzs.12233

Murray J (1907a) Some South African Tardigrada. Journal of the Royal Microscopical Society 5: 515–524. https://doi.org/10.1111/j.1365-2818.1907.tb01665.x

Murray J (1907b) Arctic Tardigrada, collected by Wm. S. Bruce. Transactions of the Royal Society of Edinburgh 45: 669–681. https://doi.org/10.1017/S0080456800011789

Murray J (1911) Scottish Tardigrada, a review of our present knowledge. Annals of Scottish Natural History 78: 88–95.

Nederström P (1919) Die bis jetzt aus Finland bekannten Tardigraden. Acta Societatis pro Fauna et Flora Fennica 46(8): 1–25.

Nelson DR, Guidetti R, Rebecchi L (2015) Phylum Tardigrada. In: Throp JH, Rogers DC (Eds) Ecology and General Biology. Vol. 1. Thorp and Covich’s Freshwater Invertebrates. Academic Press, Cambridge, 347–380. https://doi.org/10.1016/B978-0-12-385026-3.00017-6

Perry E, Miller WR, Kaczmarek Ł (2019) Recommended abbreviations for the names of genera of the phylum Tardigrada. Zootaxa 4608(1): 145–154. https://doi.org/10.11646/zootaxa.4608.1.8

Pilato G (1981) Analisi di nuovi caratteri nello studio degli Eutardigradi. Animalia 8: 51–57.

Pilato G, Binda MG (1991) Milnesium tetralamellatum, new species of Milnesiidae from Africa (Eutardigrada). Tropical Zoology 4: 103–106. https://doi.org/10.1080/03946975.1991.10539480

Pilato G, Lisi O (2003) Echiniscus walteri, new species of tardigrade from Madagascar. Bollettino Museo Civico di Storia Naturale di Verona 27: 65–70.

Pilato G, Sabella G, Lisi O (2016) Two new species of Milnesium (Tardigrada: Milnesiidae). Zootaxa 4132(4): 575–587. https://doi.org/10.11646/zootaxa.4132.4.9

Plate L (1888) Beiträge zur Naturgeschichte der Tardigraden. Zoologische Jahrbücher 3: 487–550. https://doi.org/10.5962/bhl.part.1265

Ramazzotti G (1962) Tardigradi del Cile, con descrizione di quattro nuove specie e di una nuova varieta. Atti della Società italiana di scienze naturali e del Museo civico di storia naturale di Milano 101: 275–287.

Ramazzotti G, Maucci W (1983) Il Phylum Tardigrada. III edizione riveduta e aggiornata. Memorie dell’Istituto Italiano di Idrobiologia 41: 1–1012.

Richters F (1926) Tardigrada. In: Kükenthal W, Krumbach T (Eds) “Handbuch der Zoologie Vol. 3. Walter de Gruyter & Co. Berlin and Leipzig, 58–61.

Roszkowska M, Ostrowska M, Kaczmarek Ł (2015) The genus Milnesium Doyère, 1840 (Tardigrada) in South America with descriptions of two new species from Argentina and discussion of the feeding behaviour in the family Milnesiidae. Zoological Studies 54(1): 1–12. https://doi.org/10.1186/s40555-014-0082-7

Roszkowska M, Bartels PJ, Gołdyn B, Ciobanu D, Fontoura P, Michalczyk Ł, Nelson DR, Ostrowska M, Moreno-Talamantes A, Kaczmarek Ł (2016) Is the gut content of Milnesium (Eutardigrada) related to buccal tube size? Zoological Journal of the Linnean Society 178(4): 794–803. https://doi.org/10.1111/zoj.12459

Schill RO, Forster F, Dandekar T, Wolf M (2010) Using compensatory base change analysis of internal transcribed spacer 2 secondary structures to identify three new species in Paramacrobiotus (Tardigrada). Organism Diversity and Evolution 10(4): 287–296. https://doi.org/10.1007/s13127-010-0025-z

Schultze CAS (1834) Macrobiotus Hufelandii animal e crustaceorum classe novum, reviviscendi post diuturnam asphixiam et aridiatem potens, etc. 8, 1 tab. C. Curths, Berlin.

Schuster RO, Nelson DR, Grigarick AA, Christenberry D (1980) Systematic criteria of the Eutardigrada. Transactions of the American Microscopical Society 99: 284–303. https://doi.org/10.2307/3226004

Srivathsan A, Meier R (2012) On the inappropriate use of Kimura–2–parameter (K2P) divergences in the DNA-barcoding literature. Cladistics 28: 190–194. https://doi.org/10.1111/j.1096-0031.2011.00370.x

Stec D, Smolak R, Kaczmarek Ł, Michalczyk Ł (2015) An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa 4052(5): 501–526. https://doi.org/10.11646/zootaxa.4052.5.1

Stec D, Morek W, Gąsiorek P, Michalczyk Ł (2018) Unmasking hidden species diversity within the Ramazzottius oberhaeuseri complex, with an integrative redescription of the nominal species for the family Ramazzottiidae (Tardigrada: Eutardigrada: Parachela). Systematics and Biodiversity 16(4): 357–376. https://doi.org/10.1080/14772000.2018.1424267

Suzuki AC (2003) Life history of Milnesium tardigradum Doyère (Tardigrada) under the rearing environment. Zoological Science 20(1): 49–57. https://doi.org/10.2108/zsj.20.49

Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Research 22(22): 4673–4680. https://doi.org/10.1093/nar/22.22.4673

Thulin G (1928) Über die Phylogenie und das System der Tardigraden. Hereditas, Lund 11: 207–266. https://doi.org/10.1111/j.1601-5223.1928.tb02488.x

Tibbs L, Emanuels A, Miller WR (2016) Tardigrades of the canopy: Argentine species Milnesium beatae Roszkowska, Ostrowska and Kaczmarek, 2015 (Eutardigrada, Milnesidae) discovered in the trees of Kansas, USA. Transactions of the Kansas Academy of Science 119(2): 173–178. https://doi.org/10.1660/062.119.0207

Tumanov D (2006) Five new species of the genus Milnesium (Tardigrada, Eutardigrada, Milnesiidae). Zootaxa 1122: 1–23. https://doi.org/10.11646/zootaxa.1122.1.1

Velasco-Castrillón A, McInnes SJ, Schultz MB, Arróniz-Crespo M, D’Haese CA, Gibson JAE, Adams BJ, Page TJ, Austin AD, Cooper SJB, Stevens MI (2015) Mitochondrial DNA analyses reveal widespread tardigrade diversity in Antarctica. Invertebrate Systematics 29: 578–590. https://doi.org/10.1071/IS14019

Vicente F, Bertolani R (2013) Considerations on the taxonomy of the Phylum Tardigrada. Zootaxa 3626(2): 245–248. https://doi.org/10.11646/zootaxa.3626.2.2

Vicente F, Cesari M, Serrano A, Bertolani R (2013) The impact of fire on terrestrial tardigrade biodiversity: a first case-study from Portugal. Journal of Limnology 72(S1): 152–159. https://doi.org/10.4081/jlimnol.2013.s1.e19

Warren BH, Strasberg D, Bruggemann J, Prys-Jones RP, Thébaud C (2010) Why does the biota of Madagascar region have such a strong Asiatic flavor? Cladistics 26: 526–538. https://doi.org/10.1111/j.1096-0031.2009.00300.x

Wełnicz W, Grohme MA, Kaczmarek Ł, Schill RO, Frohme M (2010) ITS-2 and 18S rRNA data from Macrobiotus polonicus and Milnesium tardigradum (Eutardigrada, Tardigrada). Journal of Zoological Systematic and Evolutionary Research 49(Suppl. 1): 34–39. https://doi.org/10.1111/j.1439-0469.2010.00595.x

Wilmé L, Goodman S, Ganzhorn J (2006) Biogeographic evolution of Madagascar’s micro-endemic biota. Science 312: 1063–1065. https://doi.org/10.1126/science.1122806

Wright PC, Houlihan PR (2017) Vohibory Rainforest: Biological Inventory Report – September 27^th to October 12^th 2016. 23 pp.

Yoder AD, Nowak MD (2006) Has vicariance or dispersal been the predominant biogeographic force in Madagascar? Only time will tell. Annual Review of Ecology Evolution and Systematics 37: 405–431. https://doi.org/10.1146/annurev.ecolsys.37.091305.110239

Zawierucha K, Kolicka M, Kaczmarek Ł (2016) Re-description of the Arctic tardigrade Tenuibiotus voronkovi (Tumanov, 2007) (Eutardigrada; Macrobiotidea), with the first molecular data for the genus Zootaxa 4196(4): 498–510. https://doi.org/10.11646/zootaxa.4196.4.2